ID: 1113507212

View in Genome Browser
Species Human (GRCh38)
Location 13:110825619-110825641
Sequence CTGTGGCCATGGGTGGAGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113507212_1113507220 -10 Left 1113507212 13:110825619-110825641 CCCAACTCCACCCATGGCCACAG No data
Right 1113507220 13:110825632-110825654 ATGGCCACAGCCTCCGGGGCAGG No data
1113507212_1113507221 -9 Left 1113507212 13:110825619-110825641 CCCAACTCCACCCATGGCCACAG No data
Right 1113507221 13:110825633-110825655 TGGCCACAGCCTCCGGGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113507212 Original CRISPR CTGTGGCCATGGGTGGAGTT GGG (reversed) Intergenic
No off target data available for this crispr