ID: 1113507453

View in Genome Browser
Species Human (GRCh38)
Location 13:110827016-110827038
Sequence CTGGACAATGAGCTGGACAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113507453_1113507462 19 Left 1113507453 13:110827016-110827038 CCAGTGTCCAGCTCATTGTCCAG No data
Right 1113507462 13:110827058-110827080 TGCCCAGTGTCCAGTGATTATGG No data
1113507453_1113507465 24 Left 1113507453 13:110827016-110827038 CCAGTGTCCAGCTCATTGTCCAG No data
Right 1113507465 13:110827063-110827085 AGTGTCCAGTGATTATGGACAGG No data
1113507453_1113507456 -10 Left 1113507453 13:110827016-110827038 CCAGTGTCCAGCTCATTGTCCAG No data
Right 1113507456 13:110827029-110827051 CATTGTCCAGTGATAATGGATGG No data
1113507453_1113507457 -9 Left 1113507453 13:110827016-110827038 CCAGTGTCCAGCTCATTGTCCAG No data
Right 1113507457 13:110827030-110827052 ATTGTCCAGTGATAATGGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113507453 Original CRISPR CTGGACAATGAGCTGGACAC TGG (reversed) Intergenic
No off target data available for this crispr