ID: 1113508472

View in Genome Browser
Species Human (GRCh38)
Location 13:110832628-110832650
Sequence TCCAGAACCCTGGTTTTCAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113508472_1113508482 23 Left 1113508472 13:110832628-110832650 CCCGTGAAAACCAGGGTTCTGGA No data
Right 1113508482 13:110832674-110832696 ATGAGAGCTTATTTGGAAATTGG No data
1113508472_1113508475 -9 Left 1113508472 13:110832628-110832650 CCCGTGAAAACCAGGGTTCTGGA No data
Right 1113508475 13:110832642-110832664 GGTTCTGGAGCCCGAAACCCTGG No data
1113508472_1113508483 24 Left 1113508472 13:110832628-110832650 CCCGTGAAAACCAGGGTTCTGGA No data
Right 1113508483 13:110832675-110832697 TGAGAGCTTATTTGGAAATTGGG No data
1113508472_1113508481 16 Left 1113508472 13:110832628-110832650 CCCGTGAAAACCAGGGTTCTGGA No data
Right 1113508481 13:110832667-110832689 CCTGTGAATGAGAGCTTATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113508472 Original CRISPR TCCAGAACCCTGGTTTTCAC GGG (reversed) Intergenic
No off target data available for this crispr