ID: 1113509136

View in Genome Browser
Species Human (GRCh38)
Location 13:110838057-110838079
Sequence AACTCTGTGCTCGCAGAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113509136_1113509142 11 Left 1113509136 13:110838057-110838079 CCTGTTTCTGCGAGCACAGAGTT No data
Right 1113509142 13:110838091-110838113 CACAGATTAACAGCATCTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113509136 Original CRISPR AACTCTGTGCTCGCAGAAAC AGG (reversed) Intergenic
No off target data available for this crispr