ID: 1113514410

View in Genome Browser
Species Human (GRCh38)
Location 13:110881636-110881658
Sequence AAATTCATATGAATTTCCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 297
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 277}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113514410_1113514411 12 Left 1113514410 13:110881636-110881658 CCAGGGGAAATTCATATGAATTT 0: 1
1: 0
2: 0
3: 19
4: 277
Right 1113514411 13:110881671-110881693 AGTATAAACAATGTTTTCCTAGG 0: 1
1: 0
2: 3
3: 43
4: 328

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113514410 Original CRISPR AAATTCATATGAATTTCCCC TGG (reversed) Intronic
908505804 1:64798659-64798681 TAATTTAGATGTATTTCCCCAGG + Intronic
909822116 1:80078556-80078578 AAATTCACATTAATTTCTCAAGG - Intergenic
909897998 1:81098093-81098115 AAAATCATAGGAATTTCGCCTGG + Intergenic
910118119 1:83755188-83755210 AAAATCAGAGAAATTTCCCCTGG + Intergenic
910330115 1:86063248-86063270 AAATTTATTTGCATTTCCTCAGG + Intronic
910721667 1:90293574-90293596 TAATTTATCTGAATTTCCCTGGG - Intergenic
910924616 1:92385571-92385593 AAACTCAAATGAATTTACCATGG - Intronic
914655327 1:149734705-149734727 AAGTTCTTATGAAGTTCCCAGGG + Intergenic
916206084 1:162317680-162317702 AGATTCATATGAATTCCTCCTGG - Intronic
917439137 1:175051343-175051365 AAGTTTATAGTAATTTCCCCCGG - Intergenic
918024068 1:180725723-180725745 AAGTAAATCTGAATTTCCCCTGG + Intronic
918564066 1:185905513-185905535 ACATCCAAATGAATTTCCCCAGG - Intronic
919040716 1:192384588-192384610 AAATTCATATGGAATTCCAAAGG + Intergenic
919273294 1:195379058-195379080 AAATAAATATGAATATTCCCAGG + Intergenic
919753022 1:201049969-201049991 AAATGCATACGAATGTCCCAAGG + Intronic
919844773 1:201634994-201635016 AATTGGATATGAATTTCCTCTGG - Intronic
920058624 1:203212310-203212332 AAATACATATGATTTTAACCTGG + Intergenic
921375768 1:214471901-214471923 AATGTCATATCAATTTCCCCTGG - Intronic
921375769 1:214471908-214471930 AAATTGATATGACATTCCCTTGG + Intronic
921451770 1:215316888-215316910 AAAATAATGTGAATTGCCCCAGG - Intergenic
921975318 1:221196492-221196514 AAATTCATATGAAATTTCATGGG - Intergenic
1064608443 10:17070351-17070373 AAATTCATATGAATATGCAAGGG - Intronic
1066677828 10:37906847-37906869 AAATACACAAGAATGTCCCCTGG - Intergenic
1067364775 10:45615607-45615629 ATATTTATTTGAATTTCTCCTGG + Exonic
1068087112 10:52388128-52388150 AAACTCAAATGAATATCCACAGG + Intergenic
1068809139 10:61236127-61236149 AAATTCATATGAAATTCATATGG + Intergenic
1069051707 10:63802350-63802372 AAATTTATCTGAATTTACCACGG + Intergenic
1069252321 10:66284474-66284496 AAATTATCATGAATTCCCCCAGG - Intronic
1071186053 10:83046859-83046881 AATTTCATTTGTATTTCCTCTGG - Intergenic
1071887024 10:89962414-89962436 AAAGTCTTATGAATTTTCTCTGG + Intergenic
1072664909 10:97385703-97385725 AAATTCACATCAGTGTCCCCAGG - Intronic
1072824452 10:98592164-98592186 AAAATCAGATTAATTTCTCCAGG - Intronic
1073569466 10:104564531-104564553 AAACTCATATGAAATTTTCCAGG - Intergenic
1073774261 10:106768420-106768442 GAAATCATTTGAATATCCCCAGG + Intronic
1073851816 10:107629393-107629415 AAATTAAGATGAGTTTCACCAGG - Intergenic
1073917419 10:108422123-108422145 AAATTTATATGAATATTTCCTGG + Intergenic
1074624776 10:115169600-115169622 AAATTCATATGAAATTGCAAGGG - Intronic
1074677025 10:115862885-115862907 AATTTCATATGAGTTTCTCAAGG - Intronic
1076473002 10:130732701-130732723 AAATTGAAATGATTTTCCCATGG + Intergenic
1079336199 11:19572877-19572899 ATATTCATATAGGTTTCCCCAGG - Intronic
1079472482 11:20791060-20791082 AAATTCATATGAAAATCCAAGGG - Intronic
1079556847 11:21769402-21769424 AAAGTCACATGAATTACCCGTGG - Intergenic
1079790690 11:24735287-24735309 ATATTCATAGGAGATTCCCCAGG + Intronic
1081725684 11:45326872-45326894 AAACTCATATGAAATTCCAGAGG - Intergenic
1082195802 11:49303699-49303721 AAATGCATATAAATTTCTCTGGG + Intergenic
1084993078 11:72947228-72947250 AAATTTATTTAAACTTCCCCTGG + Intronic
1085887551 11:80537899-80537921 AAGTTCATATGATTATCCTCCGG - Intergenic
1086660040 11:89404537-89404559 AAATGCATATACATTTCCCTGGG - Intronic
1087257139 11:95968765-95968787 AAATGCATATGAATGCCCTCTGG + Intergenic
1087558209 11:99749565-99749587 GATTTCAGATAAATTTCCCCTGG + Intronic
1089859210 11:121573711-121573733 AGATTAAAATTAATTTCCCCAGG + Intronic
1091546433 12:1504235-1504257 AAATTCTTCTAAATCTCCCCAGG + Intergenic
1091913569 12:4251157-4251179 AAAGTCATGTAATTTTCCCCAGG - Intergenic
1093467060 12:19460285-19460307 AAATTCATGTAAATTTTCTCAGG + Intronic
1095131330 12:38546838-38546860 AAATTCAAATGCATTACCCAAGG - Intergenic
1096569560 12:52513926-52513948 AAATGCATCTGACTTTCTCCAGG + Intergenic
1097027698 12:56069863-56069885 AAATTCATATGGAATTAACCAGG + Intergenic
1097384794 12:58937761-58937783 AAATTCAAATTAATTTCAACTGG + Intergenic
1098503106 12:71217231-71217253 AGGTTTATATGAATTTCCCATGG - Intronic
1100172788 12:91994823-91994845 ATATTGATATGAATTTACCATGG + Intronic
1102113054 12:110379878-110379900 AAGTTCATGTGAATTGACCCTGG - Intronic
1102588824 12:113942241-113942263 AAATCCATCTGCATCTCCCCTGG + Intronic
1104222672 12:126800329-126800351 AAATTCAAATGCATTTCTACAGG - Intergenic
1105289627 13:19043338-19043360 TTATTCATATGAATTTTCACTGG + Intergenic
1107650998 13:42544872-42544894 AAGTGCATTTGAATTTCCTCTGG - Intergenic
1107758074 13:43647434-43647456 GAATTCAGGTGAACTTCCCCAGG + Intronic
1107883351 13:44852969-44852991 AAATTCAACTGAATTTCACTTGG + Intergenic
1108424296 13:50282899-50282921 AATTTCACATGAATTCTCCCAGG - Intronic
1109489417 13:63076562-63076584 AGATTCATGTTAATTTCCTCTGG - Intergenic
1110199895 13:72836893-72836915 AAGTTCATATTAATTTCCTTTGG - Intronic
1110988210 13:82001997-82002019 AATTAGATATAAATTTCCCCAGG + Intergenic
1111090680 13:83442009-83442031 AAATTCACATGATTTTACCTAGG + Intergenic
1111694983 13:91612196-91612218 TAAGTGATAAGAATTTCCCCAGG + Intronic
1111735354 13:92132126-92132148 GTATTCATATAAATTTCCTCAGG + Intronic
1113514410 13:110881636-110881658 AAATTCATATGAATTTCCCCTGG - Intronic
1114303470 14:21399237-21399259 TAATTTATATGACTTTCCTCTGG - Intronic
1114346000 14:21795904-21795926 AAATACATTTGCATTTACCCTGG - Intergenic
1114537333 14:23431463-23431485 GAATTCGAATGAATTTCCCCTGG + Exonic
1114697178 14:24637276-24637298 AAATTCATATGTAATTCCATAGG - Intergenic
1115255356 14:31395033-31395055 AGAGTTATATGAATTTCCCAAGG - Intronic
1115651691 14:35406693-35406715 AAATGCATAGAAATTTACCCAGG + Intergenic
1116154090 14:41181399-41181421 AAATTTATATGAATATTTCCTGG - Intergenic
1116739193 14:48733805-48733827 AAAACCATATCAATTTCCTCTGG + Intergenic
1117818228 14:59620262-59620284 AAATTAACTTGAATTTTCCCTGG + Intronic
1117921531 14:60729776-60729798 ATGGTGATATGAATTTCCCCAGG + Intergenic
1120010191 14:79405009-79405031 AAGTTCATAGCAATTTCCCCAGG + Intronic
1120416542 14:84226186-84226208 AAATTTATATTATTTTCCCAAGG - Intergenic
1121942006 14:98079973-98079995 AAATTTATATGAATTTTCTTAGG + Intergenic
1122243999 14:100388478-100388500 AGAATCATCTGAATTACCCCAGG + Intronic
1128235824 15:66066408-66066430 AAATTCCTATAGATTCCCCCTGG - Intronic
1128762755 15:70228995-70229017 TATTTCATATGTATTTCCCGAGG - Intergenic
1130052491 15:80495474-80495496 CAAATCATATGAATTTTCCTAGG + Intronic
1130207042 15:81886678-81886700 AAATTCTTCTGATTTTTCCCTGG - Intergenic
1131368273 15:91857830-91857852 AAATACATTTGAATTTCCTCAGG + Intronic
1131608349 15:93933746-93933768 AGATTCAAATAAATTTCCCTAGG - Intergenic
1133122201 16:3616323-3616345 AAATTCATATGGAATTGGCCGGG + Intronic
1133896221 16:9931911-9931933 AATGTGATATGAATTTCACCTGG + Intronic
1134910991 16:18026249-18026271 AACTTCATATGATTCTCCTCTGG - Intergenic
1136488275 16:30587111-30587133 AAATTCATGTGAATTCGGCCGGG + Intergenic
1140599055 16:76452785-76452807 AAATCCATATGCTTTGCCCCAGG - Intronic
1141306779 16:82872027-82872049 AATTTCATCTCCATTTCCCCAGG - Intronic
1141541844 16:84729560-84729582 AAATTCTAATCAAGTTCCCCGGG + Intronic
1145820328 17:27828832-27828854 AAATTCATATGAAATCCCAAAGG + Intronic
1147541365 17:41362800-41362822 AAATTCATATGTAGTTCCCATGG + Intergenic
1147855768 17:43478686-43478708 AAATTAATAAGGATTTCCTCAGG - Intergenic
1149418318 17:56483446-56483468 AAATTCAGATGCAGTTGCCCAGG - Intronic
1150015297 17:61550848-61550870 AAATTCAAATAAATATCCCTGGG + Intergenic
1150030649 17:61731288-61731310 ATATTCACATCCATTTCCCCTGG + Intronic
1153121859 18:1738414-1738436 AAATTCAAATGAAAATCACCAGG + Intergenic
1156859752 18:41822095-41822117 AAATTCATATTAAGGTTCCCAGG - Intergenic
1157962717 18:52174678-52174700 AGATGCATATGAGTTTCTCCAGG - Intergenic
1162290708 19:9778075-9778097 AAATAAATATAAATTTTCCCTGG + Intronic
1165524117 19:36338283-36338305 AAATTCAAATGAATTTGGCCTGG - Exonic
1166023294 19:40053775-40053797 TACTTAATATGAATTTCTCCAGG - Intronic
1168182191 19:54669488-54669510 TTCTTCATATGAATATCCCCAGG + Exonic
1202652079 1_KI270707v1_random:15178-15200 AAATTCATATGGAATCCCCAGGG + Intergenic
925511370 2:4629367-4629389 AAAATCAAATGAAGATCCCCAGG + Intergenic
927098650 2:19768928-19768950 AAATTCATATGAAATTTCAAGGG + Intergenic
927813652 2:26194968-26194990 ACTTTGATATGATTTTCCCCTGG - Intronic
928975104 2:37078401-37078423 ACATTCATATGTATTTCCAGTGG - Intronic
929247750 2:39721123-39721145 AATTGCATATGAATTTCTCTGGG + Intergenic
929862917 2:45694571-45694593 TCATTCATATGCATTTCCCAGGG - Intronic
930907240 2:56586169-56586191 AAATTCATATGGATTTGCAAGGG - Intergenic
931202483 2:60111853-60111875 AATTTTGTATGAATTTTCCCTGG - Intergenic
931519145 2:63076254-63076276 AAATTTATATGAAATTCCAAAGG - Intergenic
931797862 2:65728979-65729001 GAAGTCATATGAGTTTCTCCTGG - Intergenic
932901998 2:75711383-75711405 AAAATCAAATGACTTCCCCCAGG + Intergenic
934542101 2:95184068-95184090 GAATTGAGATGAATTTCCTCTGG + Intronic
935106027 2:100044551-100044573 AAAATAAAATGAATTTCCCTGGG + Intronic
935289350 2:101596488-101596510 AAATTCCTGTGAATGTCTCCTGG - Intergenic
935291602 2:101615673-101615695 AAATGCCTATGAATTGTCCCAGG + Intergenic
935799098 2:106675104-106675126 AAATTCATATGGAGTGCCACTGG - Intergenic
936413132 2:112278139-112278161 AATTTCTTAAGAATTTCCCAGGG - Intronic
938068833 2:128296870-128296892 AAATTCATATGAAATTTCAAGGG + Intronic
939656259 2:144829684-144829706 CTATTAATGTGAATTTCCCCTGG - Intergenic
940135251 2:150428439-150428461 AAATATATATGAATTTGCCAAGG - Intergenic
940671222 2:156670603-156670625 AAATTCATATCAAATTCCAAGGG - Intergenic
941288309 2:163643041-163643063 AAATTCATACGAAATTGCCAGGG + Intronic
941624800 2:167819819-167819841 AAATTCATAGTAATTTGCACTGG + Intergenic
942275469 2:174319301-174319323 AATTTCTTATAAATTTCCCCTGG + Intergenic
942364005 2:175203479-175203501 AAAGTAAAATGAATTTCCCAAGG + Intergenic
942718112 2:178917937-178917959 ATATTCATATGTATTTTACCTGG + Intronic
943158098 2:184210917-184210939 TAATTCATATTAATTTCTACTGG + Intergenic
945075728 2:206037327-206037349 AAATTAAAATGAATTTCCCTTGG - Intronic
946083875 2:217151512-217151534 AAATTTAGATGAATCTACCCTGG + Intergenic
946658141 2:221970889-221970911 ACATGCATATGAATTTCCCAGGG - Intergenic
947090543 2:226506191-226506213 TAATTCATTTGCATTTCCACAGG - Intergenic
1168961599 20:1873897-1873919 AACTTCATAGAAATTTCTCCTGG + Intergenic
1169751975 20:9003815-9003837 AAAGTCATATGGGTTTCCCAAGG - Intergenic
1169814028 20:9638110-9638132 ACTTTCATAAGAATTTCCCTGGG - Intronic
1169844370 20:9973668-9973690 TAATACATATGATTTTCCCTTGG - Intergenic
1169937772 20:10903375-10903397 AATTTCATAAGAAAGTCCCCAGG - Intergenic
1170602392 20:17850638-17850660 AATTTCATAGGAATTTTTCCAGG - Intergenic
1171905786 20:30899060-30899082 AAATTCGTCTGAATTGCTCCCGG + Intergenic
1172562325 20:35900242-35900264 TAATTCTTCTGAAATTCCCCTGG - Intronic
1173560219 20:43999731-43999753 AAATTCATATGGAATTGCCAGGG + Intronic
1174389219 20:50207416-50207438 AAATTCCTATGTTTTACCCCAGG + Intergenic
1176174444 20:63712477-63712499 AAATTCATATGAAATTGCAAAGG - Intronic
1176908049 21:14528376-14528398 AAATTCTCAAGAATTTCCCCAGG + Intronic
1178665121 21:34539961-34539983 CAATTCAGATGAGTGTCCCCTGG - Intronic
1179234690 21:39535410-39535432 AAATTCGTCTAAATTTCCACAGG - Intergenic
1179412932 21:41175890-41175912 AAAAGCTTAGGAATTTCCCCAGG - Intronic
1180339200 22:11605161-11605183 AAATTCGTCTGAATTGCTCCCGG + Intergenic
1181037341 22:20176258-20176280 AAATTCACATGCATTTGGCCAGG - Intergenic
1182063512 22:27414785-27414807 GGAATCATATGAATTTCCCTTGG + Intergenic
949223565 3:1665684-1665706 AAATTCACATGAATTGCAACAGG + Intergenic
949226848 3:1705145-1705167 AAAATGAAATTAATTTCCCCTGG - Intergenic
951021855 3:17789944-17789966 AAATTCATAGTAATTTCAACTGG - Intronic
954932726 3:54297997-54298019 ATATGCATATGAATCTCCCGAGG - Intronic
955009194 3:54997745-54997767 AAATTTATTTGAAGTTCCCCAGG + Intronic
956671352 3:71694197-71694219 AAATTCTTCTGAATTTCACCAGG - Intronic
958150871 3:89692883-89692905 AAAATTACATGAGTTTCCCCAGG - Intergenic
959607427 3:108257660-108257682 AAATTTTTAAGAATTTCGCCTGG + Intergenic
959871998 3:111339341-111339363 AGATGAATATGAATTTCTCCTGG - Intronic
961619267 3:128210687-128210709 CAATTCCTACGGATTTCCCCTGG + Intronic
962608883 3:137056122-137056144 TAATTCATCTGCATTTCACCAGG + Intergenic
963321891 3:143817675-143817697 AAATACCTATGAATTTTCCTAGG - Intronic
964537208 3:157736454-157736476 CAATTCTTTGGAATTTCCCCTGG - Intergenic
965061114 3:163786828-163786850 AAATTATTATGAAGTTCCACTGG + Intergenic
965515095 3:169612998-169613020 AAAGTCCTTTGACTTTCCCCAGG + Intronic
966121423 3:176525606-176525628 AAATACATTAGAATGTCCCCAGG + Intergenic
966258493 3:177947499-177947521 AAATTTATGTGAGTTTCCCTAGG - Intergenic
966666304 3:182475304-182475326 AAATTCTAATGAATATCCCTAGG + Intergenic
967484246 3:190011633-190011655 AAATTAAGATGACATTCCCCAGG - Intronic
969859596 4:10025159-10025181 AAATACAAATAAATTTTCCCTGG + Intronic
971442386 4:26701438-26701460 AAATACTTAAGAATTTACCCGGG - Intronic
971520526 4:27545196-27545218 AAATTCATATGAAGATGCCTTGG - Intergenic
972198268 4:36680252-36680274 TAATTTATATGATTTTCCCTTGG + Intergenic
976986879 4:91312243-91312265 AAGATAATATGAATTTCCACAGG + Intronic
977421047 4:96799986-96800008 CAATTCATAAGATATTCCCCAGG - Intergenic
978239943 4:106503313-106503335 AATTTCATTTGAATTTCCTGTGG + Intergenic
978245455 4:106566726-106566748 AAATACATATGTATTTCATCAGG + Intergenic
978961656 4:114686944-114686966 AAATTAATATCAAGTTCCCACGG + Intergenic
979118730 4:116864954-116864976 TTCTTCATTTGAATTTCCCCAGG - Intergenic
979823821 4:125207594-125207616 AAATTAATATATGTTTCCCCTGG - Intergenic
981108364 4:140906613-140906635 AAAATGATATGGATTTCCTCTGG - Intronic
983186682 4:164708564-164708586 AAATTAATAACAATTTCCTCGGG - Intergenic
983443892 4:167824250-167824272 AAATTTAGATCAATTTTCCCAGG - Intergenic
983928530 4:173428640-173428662 CAATTCAAATGTATTTCCTCTGG - Intergenic
984724341 4:183006109-183006131 AAATTCATATGAAATTTCAAGGG + Intergenic
986967589 5:13293844-13293866 AGATTACTATAAATTTCCCCTGG + Intergenic
987029296 5:13961032-13961054 AAATTGGAATGAGTTTCCCCAGG + Intergenic
987229607 5:15879897-15879919 AAATCCATATGAATTAATCCTGG + Intronic
987293073 5:16526105-16526127 AAATTCATGTCAACTTGCCCAGG - Intronic
987692647 5:21286983-21287005 ATATTTATATGAATTTTACCTGG + Intergenic
989638293 5:43558151-43558173 AAATTTAAATTAATTTCACCTGG - Intergenic
990055439 5:51571574-51571596 AAATTCATGTGCATGTCACCTGG - Intergenic
990828812 5:59933124-59933146 AAATTCAAGTGATTTTCCTCAGG + Intronic
991140675 5:63238189-63238211 AAATTCATATGGAATTGCCATGG + Intergenic
991747707 5:69763065-69763087 ATATTTATATGAATTTTACCTGG - Intergenic
991750022 5:69792259-69792281 ATATTTATATGAATTTTACCTGG + Intergenic
991799285 5:70342919-70342941 ATATTTATATGAATTTTACCTGG - Intergenic
991801595 5:70372064-70372086 ATATTTATATGAATTTTACCTGG + Intergenic
991827001 5:70637962-70637984 ATATTTATATGAATTTTACCTGG - Intergenic
991829312 5:70667117-70667139 ATATTTATATGAATTTTACCTGG + Intergenic
991891644 5:71342346-71342368 ATATTTATATGAATTTTACCTGG - Intergenic
992630620 5:78676732-78676754 CAATTCAAATGAATTTCCAATGG + Intronic
994563848 5:101414328-101414350 AAAATCATATTAAATTACCCAGG + Intergenic
994932095 5:106202671-106202693 AAATCCAGATGAATTTCACATGG - Intergenic
996810721 5:127513922-127513944 ATATTCATATGAATATTTCCAGG - Intergenic
997760345 5:136441610-136441632 AAATTCATATGAAATTACATGGG - Intergenic
997936475 5:138116390-138116412 AAATTCATATGAAATTGCAAGGG + Intronic
1000680445 5:164177320-164177342 AAACTCCTATGAAGTTGCCCAGG + Intergenic
1001322315 5:170692926-170692948 AAATTTATATTAATTTCCTCTGG - Intronic
1001679135 5:173543580-173543602 AAAGTGATATGAATTGCCCAAGG + Intergenic
1002950783 6:1809143-1809165 AAATTCATTTTATTTTCTCCAGG + Intronic
1004161753 6:13220348-13220370 AAATTCATCTGTTTTTCCCTTGG + Intronic
1004943826 6:20590178-20590200 ATAGTCATATGACTGTCCCCAGG + Intronic
1006711944 6:36081726-36081748 AAATTCATATGAAATTACAAGGG - Intronic
1008386409 6:50896472-50896494 AAATTTATATGAGTTTCCTATGG - Intergenic
1008811411 6:55505032-55505054 CAATTCATATTCATTTCCACAGG - Intronic
1010499234 6:76575121-76575143 AAATTAATATAAATTTCACACGG - Intergenic
1010579998 6:77584430-77584452 ACATTCATATGCTTGTCCCCTGG + Intergenic
1010658366 6:78539697-78539719 AAATTCATTTGATTTTCACTGGG - Intergenic
1011533026 6:88345747-88345769 AAATTCATTTGAATTTCTGGAGG + Intergenic
1012767785 6:103390434-103390456 AAAGTCATATGAATTTACAATGG - Intergenic
1013950097 6:115769859-115769881 AAAATCATCTGAATGACCCCAGG - Intergenic
1014071647 6:117188112-117188134 AAATTCCCAGGAGTTTCCCCAGG - Intergenic
1018204137 6:161421115-161421137 AAAATCATGTGAAGTTCACCTGG + Intronic
1018757117 6:166859629-166859651 ACAGTCAGATGAATCTCCCCTGG + Intronic
1020024665 7:4890622-4890644 CAATTCTGTTGAATTTCCCCCGG + Intergenic
1020285337 7:6675042-6675064 ACATTCATATGGCTTTTCCCTGG - Intergenic
1020776463 7:12460521-12460543 AAATTCATATGAATTGCAAGAGG + Intergenic
1022206766 7:28172160-28172182 ATATTCATATCATTTTCCACAGG + Intronic
1023212052 7:37816541-37816563 AAATTCATAGAAATCTCCACAGG - Intronic
1024480926 7:49861963-49861985 AAATTCATATGGAATTGCACAGG - Intronic
1028478302 7:91275651-91275673 TAATTCATATGAAATTTACCAGG - Intergenic
1029508921 7:100981121-100981143 AAAAGCATATAAATTTCACCAGG - Intronic
1031137855 7:117904921-117904943 CAATTCAAATTACTTTCCCCAGG + Intergenic
1032446208 7:131985899-131985921 AAATCAATATGAATTTCCGATGG - Intergenic
1033049923 7:137994844-137994866 AAATTCACAGTAATTTGCCCTGG - Intronic
1033137859 7:138799478-138799500 AAATTCTTAGGAATTTTCACCGG + Intronic
1035944515 8:3946512-3946534 AAATTCATATGAAATTGCCAAGG - Intronic
1037058548 8:14477205-14477227 TTATTCATATGAATTTTCACTGG + Intronic
1038622691 8:29159065-29159087 ATATTCATATGAATGTGACCGGG - Intronic
1039796360 8:40918785-40918807 AACTTCACAGGAGTTTCCCCAGG - Intergenic
1040102579 8:43518726-43518748 AAAATCATATTATTTTGCCCTGG - Intergenic
1040722038 8:50336196-50336218 AAATTCTTTTTTATTTCCCCTGG - Intronic
1042625897 8:70756350-70756372 AAATTCATATGAAATTGCAAGGG - Intronic
1044067962 8:87721619-87721641 AAATTCAAATAAATTTCCTAGGG + Intergenic
1044834421 8:96281741-96281763 AAGTTCATAGGAAAGTCCCCAGG + Intronic
1045182541 8:99800931-99800953 ATAGTCATTTGAATTTCCCTGGG - Intronic
1046528835 8:115417789-115417811 AATATCACATGAATCTCCCCAGG - Intronic
1050449728 9:5767364-5767386 AAAATCATGAGAATTTCCTCTGG + Intronic
1050488159 9:6157676-6157698 AAATTCATATGAAATTTCAAGGG + Intergenic
1050962908 9:11759214-11759236 TAATTCATATTATTTTCTCCTGG - Intergenic
1051194728 9:14551585-14551607 AAATTCATATAAATTTAACAAGG - Intergenic
1051500966 9:17777457-17777479 AAATTCATTTCATTTTCCCCCGG + Intronic
1052539539 9:29791248-29791270 AAAGTTATTTGTATTTCCCCAGG - Intergenic
1052630782 9:31035823-31035845 CAATTCATATCATTTCCCCCGGG + Intergenic
1055424357 9:76178717-76178739 AAAATCATATGAATTTTCAGTGG + Intronic
1055545082 9:77362600-77362622 AAATTCATATGAAATTTCAAAGG - Intronic
1056971386 9:91207485-91207507 AAATTGTTTTGAGTTTCCCCCGG - Intergenic
1057323781 9:94040462-94040484 AATTCCAGATTAATTTCCCCTGG + Intronic
1057343627 9:94226866-94226888 AAATTCATATGAAATTACAAAGG - Intergenic
1058304224 9:103416975-103416997 AAATTCATATGGAATTCCAAGGG - Intergenic
1058398035 9:104578657-104578679 AAAGTTATATGAATTGCCCTAGG + Intergenic
1059080799 9:111247334-111247356 AAATTACTATGAATTTTCCTAGG + Intergenic
1187780274 X:22814155-22814177 AATTTCATGTGAATTTCCATGGG - Intergenic
1188765993 X:34091518-34091540 AAATTCATATAAAATTACACGGG + Intergenic
1189082138 X:37985686-37985708 AAATTCATATGAAATTTCAAGGG + Intronic
1189610540 X:42729165-42729187 AAATTTTTATAAATTTACCCAGG - Intergenic
1191255664 X:58278518-58278540 AAAGTGATAAGAATTCCCCCGGG - Intergenic
1191258349 X:58289538-58289560 AAATTGGCATGAATTCCCCCTGG + Intergenic
1191587335 X:62842927-62842949 AATTTCATAGGAAGTTACCCTGG + Intergenic
1191926814 X:66321018-66321040 GAATACATATTATTTTCCCCAGG + Intergenic
1192384975 X:70658767-70658789 AAATTCATATGAAGTTTCAAGGG + Intronic
1192455993 X:71276300-71276322 AAATTCATATGGAATTCCCAGGG - Intergenic
1193241405 X:79174402-79174424 AGGTTCATATTAATTTACCCAGG + Intergenic
1196317472 X:114245454-114245476 AAATTCATATGAAAATCCAAGGG + Intergenic
1196362578 X:114881831-114881853 AAATTCATATGAAATTGCAAAGG - Intronic
1197572227 X:128163541-128163563 AAATTCATATAAAGTTCAACTGG + Intergenic
1200328461 X:155267469-155267491 AAATTCATATGAAATTGCAAAGG - Intergenic
1201257204 Y:12120216-12120238 AAATTCATGTGAATGTTTCCTGG - Intergenic
1201435043 Y:13949236-13949258 ATTTTGATATGAATTTCCCAAGG - Intergenic
1201675752 Y:16582475-16582497 AAATGCTTAAGAATTTCCACTGG + Intergenic
1202605034 Y:26632085-26632107 AAATACCTATGTATTTCCCTAGG - Intergenic