ID: 1113515807

View in Genome Browser
Species Human (GRCh38)
Location 13:110897190-110897212
Sequence AATCATAGTTCACCACACCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 539
Summary {0: 1, 1: 0, 2: 4, 3: 67, 4: 467}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113515802_1113515807 7 Left 1113515802 13:110897160-110897182 CCTGTTGCCCCAGCTGGAGTGCA 0: 2
1: 111
2: 3072
3: 5353
4: 7367
Right 1113515807 13:110897190-110897212 AATCATAGTTCACCACACCCTGG 0: 1
1: 0
2: 4
3: 67
4: 467
1113515805_1113515807 -1 Left 1113515805 13:110897168-110897190 CCCAGCTGGAGTGCAGTGGCACA 0: 1055
1: 29995
2: 93960
3: 183855
4: 210741
Right 1113515807 13:110897190-110897212 AATCATAGTTCACCACACCCTGG 0: 1
1: 0
2: 4
3: 67
4: 467
1113515806_1113515807 -2 Left 1113515806 13:110897169-110897191 CCAGCTGGAGTGCAGTGGCACAA 0: 214
1: 774
2: 1709
3: 2241
4: 2341
Right 1113515807 13:110897190-110897212 AATCATAGTTCACCACACCCTGG 0: 1
1: 0
2: 4
3: 67
4: 467
1113515804_1113515807 0 Left 1113515804 13:110897167-110897189 CCCCAGCTGGAGTGCAGTGGCAC 0: 110
1: 2304
2: 60928
3: 161162
4: 216823
Right 1113515807 13:110897190-110897212 AATCATAGTTCACCACACCCTGG 0: 1
1: 0
2: 4
3: 67
4: 467
1113515801_1113515807 8 Left 1113515801 13:110897159-110897181 CCCTGTTGCCCCAGCTGGAGTGC 0: 1
1: 95
2: 2663
3: 4752
4: 6965
Right 1113515807 13:110897190-110897212 AATCATAGTTCACCACACCCTGG 0: 1
1: 0
2: 4
3: 67
4: 467

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113515807 Original CRISPR AATCATAGTTCACCACACCC TGG Intronic
901722119 1:11207472-11207494 AATCATAGCTCACTGCACCCTGG + Intronic
902349684 1:15845346-15845368 AATCATAGTGCACTACAGCTTGG + Intergenic
902521661 1:17021374-17021396 AATCATAGCTCACTGCAGCCTGG - Intronic
902522153 1:17025473-17025495 AATCACAGTTCACTGCAGCCTGG + Intronic
903204278 1:21768863-21768885 AATCATAGCTCACTGCAGCCTGG + Intronic
903511570 1:23879545-23879567 AATCATAGATCACTGCACACTGG - Intronic
904061090 1:27711069-27711091 AATCATAGCTCACTGCAACCTGG - Intergenic
904178193 1:28646209-28646231 AATCATAGCTCACTGCAGCCTGG - Intergenic
904180375 1:28662593-28662615 AATCATAATTCACTATAGCCTGG - Intergenic
905551982 1:38849247-38849269 AATCATAGCTCACTGCAGCCTGG + Intronic
905738292 1:40346913-40346935 AATCATAGCTCACTGCAGCCTGG + Intronic
906230267 1:44156703-44156725 AATCATAGCTCACTGCAGCCCGG + Intergenic
906518651 1:46454312-46454334 AATCATAGTTCACCGCAGCCTGG - Intergenic
906630681 1:47364835-47364857 GATCATAGCTCACTACATCCTGG + Intronic
907688295 1:56635991-56636013 AATCATAGCTCACTGCAGCCTGG + Intronic
907690754 1:56663157-56663179 AATCATAGCTCACTGCAGCCTGG + Intronic
908860394 1:68479735-68479757 GATCATAGCTCACTGCACCCTGG - Intronic
909524141 1:76603736-76603758 AATCACAGCTCACTACAGCCTGG + Intronic
910532804 1:88259734-88259756 AAGGATAGTTAACCACTCCCTGG + Intergenic
910762273 1:90745522-90745544 AATCATAGCTCACTGCAGCCTGG + Intergenic
912403000 1:109411684-109411706 GATCATAGCTCACTACAGCCTGG + Intronic
913009127 1:114665201-114665223 AATCATAGCTCACTGCAGCCTGG - Intronic
913023101 1:114806490-114806512 AATCATAGCTCACTGCAACCTGG - Intergenic
914003538 1:143712827-143712849 AATGATAGTTCACTGCAGCCTGG + Intergenic
914094754 1:144535297-144535319 AATTATAGTTCACTGCAGCCTGG + Intergenic
914254913 1:145953992-145954014 AATCATAGCTCACCGCAGCCTGG - Intronic
914303768 1:146398601-146398623 AATTATAGTTCACTGCAGCCTGG - Intergenic
914515977 1:148374578-148374600 AATCATAGTTCACTGCAGCCTGG + Intergenic
916008420 1:160682396-160682418 AATCATAGTTTATTGCACCCTGG - Intronic
916670191 1:167010509-167010531 AATCATAGCTCACTGCAGCCTGG + Intronic
916695778 1:167234666-167234688 AATCACAGTCCATCACAGCCTGG - Intronic
919673561 1:200359788-200359810 GATCATAGTACACTACAGCCTGG - Intergenic
919686179 1:200485650-200485672 AATCATAGTGCACTGCAACCTGG - Intergenic
920024928 1:202987419-202987441 AATCATAGCTCCCCTCTCCCAGG - Intergenic
921251388 1:213301631-213301653 AATCATAGCTCACTGCAGCCTGG - Intergenic
921379344 1:214507913-214507935 AATCATAGCTCACTGCAGCCTGG - Intronic
921522696 1:216176299-216176321 AATGATAGCTCACTACAGCCTGG + Intronic
922333642 1:224600573-224600595 AATCATAGTGCACTGCAGCCTGG + Intronic
922543895 1:226440576-226440598 AATCATAGCTCACTGCAGCCTGG + Intergenic
922590365 1:226771189-226771211 AATCATAGCTCACTGCAGCCTGG + Intergenic
923142428 1:231172019-231172041 AATCATAGCACACCACAGCCTGG - Intronic
923654772 1:235906021-235906043 AATCATAGCTCACTGCAGCCTGG - Intergenic
923922396 1:238582441-238582463 AATCATGGTGAAACACACCCTGG + Intergenic
924058590 1:240147556-240147578 AATCATAGCTCACTGCAGCCTGG + Intronic
1062795470 10:341811-341833 AATCATAGCTCACTGCAGCCGGG - Intronic
1064153103 10:12881543-12881565 AATCATAGTTCACTGCAACCTGG - Intergenic
1064716447 10:18181678-18181700 AGTCATAGTTCACTGCAGCCTGG + Intronic
1064843579 10:19624989-19625011 GATCATAGCTCACTACAGCCTGG - Intronic
1065380866 10:25088513-25088535 AATCATAGCTCACTGCAGCCTGG - Intergenic
1065620381 10:27575105-27575127 AATCATAGCTTACTACAGCCTGG + Intergenic
1065715707 10:28565436-28565458 AATCATAGCTCACTGCAGCCTGG + Intronic
1066042310 10:31562139-31562161 AATCATAGCTCACTGCAGCCTGG - Intergenic
1066627965 10:37428607-37428629 AATCACAGTTCACTGCAGCCTGG - Intergenic
1067726962 10:48777682-48777704 AATCATAGTTCACTGCAGCCTGG - Intronic
1068994513 10:63187501-63187523 GATCATGGCTCACCACAGCCTGG + Intronic
1069485684 10:68821547-68821569 AATCATAGTTCACTTCACTTTGG + Intergenic
1070365177 10:75729861-75729883 GATCATAGCTCACTACAGCCTGG + Intronic
1071136234 10:82457697-82457719 TATCATAATTCAGCACACACTGG + Intronic
1071618764 10:87098839-87098861 GATCACAGTTTACCACAGCCTGG + Intronic
1072411892 10:95210563-95210585 AATCAGAGATTACCAAACCCAGG + Intronic
1072517236 10:96197368-96197390 AATCACAGTCCACTACAGCCTGG + Intronic
1072729058 10:97832558-97832580 CATCATAGCTCACTACACCCTGG - Intergenic
1072759032 10:98040697-98040719 GATCATGGCTCACCACAGCCTGG - Intergenic
1073361376 10:102902134-102902156 AATCATAGCTCACTGCAGCCTGG - Intergenic
1073800030 10:107031667-107031689 AATCATAGTGCACTACAGGCTGG + Intronic
1073850909 10:107617106-107617128 TATCATCCTTCTCCACACCCAGG - Intergenic
1075039341 10:119095459-119095481 GATCATAGCTCACCACAACCTGG + Intergenic
1075154246 10:119961140-119961162 AATTATAGTCCTCCACACCAGGG + Intergenic
1075619705 10:123916841-123916863 AATCATAGCTCACCACAGCTTGG + Intronic
1075726737 10:124614421-124614443 AAGCAAAGCTCACCACCCCCAGG - Intronic
1076442861 10:130492405-130492427 ACCCAGAGTCCACCACACCCAGG - Intergenic
1078208723 11:9252913-9252935 AATCATGGCTCACCACAGTCTGG + Intronic
1079439767 11:20499559-20499581 AATCATAGCTCACCACAGCCTGG - Intronic
1080141865 11:28931439-28931461 AATCATAGCTCACTGCAGCCTGG + Intergenic
1080272036 11:30460555-30460577 TATCATAGTTCACTGCAGCCTGG - Intronic
1080567155 11:33521103-33521125 GATCATAGTTCACTGCAGCCTGG - Intergenic
1080981784 11:37416240-37416262 AATCATAGCTCACTTCATCCTGG + Intergenic
1081077809 11:38697225-38697247 AAGCATAATCCACCGCACCCGGG + Intergenic
1081412617 11:42777606-42777628 AATCATAGCTCACTGCAGCCTGG + Intergenic
1081901651 11:46633743-46633765 AATCATAGCTCACCGTAACCTGG - Intronic
1081913695 11:46717863-46717885 AATCATAGCTCACTGCAGCCTGG + Intergenic
1082187484 11:49202465-49202487 AATCATAGCTCACTAAAACCTGG + Intronic
1083412917 11:62506141-62506163 GATCATGGCTCACCACAGCCTGG - Intronic
1083808749 11:65090459-65090481 GATCATAGTTCACTGCAGCCTGG - Intronic
1084501036 11:69535577-69535599 GATCATAGTTCACTACAGCCTGG + Intergenic
1085418716 11:76337378-76337400 AATCATGGCTCACCACAACCTGG + Intergenic
1086678846 11:89642961-89642983 AATCATAGCTCACTAAAACCTGG - Intergenic
1086867875 11:92002012-92002034 GATCATAGTTCACTGCAGCCTGG - Intergenic
1089028387 11:115296014-115296036 AACCATAGTTCACTATAACCTGG + Intronic
1089475235 11:118754339-118754361 AATCATAGCTCACTGCAGCCTGG - Intronic
1089715553 11:120355639-120355661 AATCATAGCTCACTGCAGCCTGG - Intronic
1090094950 11:123733621-123733643 AATCATAGCTCACTACAGCCTGG + Intronic
1090127409 11:124101723-124101745 AATCATGGTTCACTATAGCCTGG - Intergenic
1091234080 11:134008016-134008038 AATCATAGCTCACTGCAACCAGG - Intergenic
1091721685 12:2818595-2818617 GATCATAGCTCACTACAGCCTGG - Intronic
1092135092 12:6141739-6141761 AATCATAGCTCACTGCAGCCTGG - Intergenic
1092232139 12:6782039-6782061 AATCATGGCTCACTACAGCCTGG - Intergenic
1092533249 12:9362722-9362744 AATCACAGCTCACCACAGCCTGG + Intergenic
1092766137 12:11854685-11854707 AATCAAAGTTCTCCACACTCTGG - Intronic
1093422314 12:18988545-18988567 AATCATAGCTCACTATAACCTGG + Intergenic
1093882628 12:24422943-24422965 CATCATAGCTCACTACAGCCTGG - Intergenic
1095896892 12:47288854-47288876 AATCTTAGTTCACCGCAGCCTGG + Intergenic
1098013991 12:66084999-66085021 GATCATAGCTCACTACAACCTGG - Intergenic
1098318446 12:69216187-69216209 GACCATAGTTCACCAAATCCTGG + Intergenic
1098900602 12:76108550-76108572 AATCATAGCTCACTGCAGCCGGG + Intergenic
1099174145 12:79401326-79401348 AATCATAGTGCACTGCAGCCTGG - Intronic
1099337820 12:81386554-81386576 AATCATGGCTCACTACAACCTGG - Intronic
1099662732 12:85585865-85585887 AATCATAGCTCACTACAACCTGG - Intergenic
1099932493 12:89090469-89090491 AATCATAGTTCAGCACAGCTGGG - Intergenic
1102160300 12:110763413-110763435 CATCATAGTTCACTGCAGCCTGG - Intergenic
1102373767 12:112404395-112404417 AATCACAGGTCACCACAGCCTGG + Intergenic
1102885858 12:116521376-116521398 AATCCTGGATCATCACACCCTGG + Intergenic
1102902380 12:116648352-116648374 AATCATAGCTCACTGCAGCCTGG - Intergenic
1103042746 12:117709397-117709419 AATCATAGCTCACTACTCCCGGG + Intronic
1103383827 12:120515987-120516009 AATCATAGCTCACTGCAGCCTGG + Intronic
1103650250 12:122426467-122426489 AATCATAGCTCACTACAACCTGG + Intergenic
1103664805 12:122554977-122554999 AATCATAGCTCACTGCAGCCTGG - Intronic
1103981464 12:124739538-124739560 AATCATAGCTCACCTCAGCCTGG + Intergenic
1105380779 13:19885206-19885228 AATCATGGCTCACTACAGCCTGG - Intergenic
1105599860 13:21876982-21877004 AATCATAGCTCACTGCAGCCTGG + Intergenic
1105802930 13:23925441-23925463 AATCACAGCTCACTACAGCCTGG + Intergenic
1106289397 13:28346642-28346664 AATCATAGCTCACTACAGCATGG - Intronic
1106628766 13:31447831-31447853 AATCATGGCTCACCATAGCCTGG + Intergenic
1107558954 13:41543680-41543702 AAACATAGTGCACTACAACCTGG + Intergenic
1107751248 13:43569867-43569889 AATCATCCCACACCACACCCTGG + Intronic
1107993926 13:45842407-45842429 AGTCATGGCTCACCACAGCCTGG + Intronic
1108719864 13:53119679-53119701 AATCCTCTTTCACCACAACCTGG - Intergenic
1108859807 13:54842771-54842793 AATCATAGCTCACTGCAGCCTGG + Intergenic
1109586836 13:64415874-64415896 AATCATAGCTCACTGCAGCCAGG + Intergenic
1109720030 13:66264154-66264176 AATCATAGCTCACTTCAGCCTGG + Intergenic
1109751460 13:66698642-66698664 GATCATAGCTCACTACAGCCTGG + Intronic
1110217667 13:73041523-73041545 AATCATAGCTCACTGCAGCCTGG - Intergenic
1110409969 13:75194259-75194281 AATCATAGCTCACTGCAGCCTGG + Intergenic
1111019705 13:82432808-82432830 AATCATAGTTCTTGACACACAGG - Intergenic
1112131588 13:96530566-96530588 AATCATAGCTCACTACAGCCTGG + Intronic
1113515807 13:110897190-110897212 AATCATAGTTCACCACACCCTGG + Intronic
1115218720 14:31037884-31037906 GATCATAGCTCACTACACCCTGG - Intronic
1115223795 14:31083568-31083590 GATCATGGCTCACTACACCCTGG + Intronic
1115247477 14:31310936-31310958 AATCATAGTGCACTACAGCTGGG - Intronic
1115397687 14:32927248-32927270 AATCATAGCTCACCATAGCCTGG - Intergenic
1115647379 14:35378446-35378468 GATCATAGCTCACCGCAGCCTGG - Intergenic
1115710952 14:36050058-36050080 AATCATAGCTCACTGCAGCCTGG - Intergenic
1116963343 14:50989602-50989624 CATCATATTTCATCACACGCAGG + Intronic
1117030658 14:51666043-51666065 AATCATAGATTACCACCCACTGG - Intronic
1117127836 14:52650151-52650173 AATCATAGCTCACTGCAGCCTGG - Intronic
1117560658 14:56934532-56934554 AATCATAGTTCACTGTAACCTGG + Intergenic
1117675868 14:58154228-58154250 AATCACAGTTCACTGCAGCCTGG + Intronic
1118797546 14:69156899-69156921 AATCATAGCTCACAGCAGCCTGG + Intergenic
1122727445 14:103767246-103767268 AATCATAGTTCACTGCAGCTTGG - Intronic
1122731551 14:103803183-103803205 AATCATAGTACACCTCACGATGG + Intronic
1122755085 14:103972086-103972108 AATCACAGTTCACTGCAGCCTGG - Intronic
1122962257 14:105100411-105100433 AATCATAGCTCACTACAGCCTGG + Intergenic
1123022014 14:105403486-105403508 AATCACAGCTCACTACAGCCTGG + Intronic
1124339798 15:28883447-28883469 GATCATAGTTCACTGCAGCCTGG + Intergenic
1124984314 15:34591432-34591454 GATGATAGTGTACCACACCCGGG - Intergenic
1125049626 15:35282235-35282257 AATCATAGCTCACTACAGCCTGG + Intronic
1125229826 15:37441027-37441049 AATCATGGTTCACTGCAGCCTGG + Intergenic
1125557685 15:40599874-40599896 AATCATAGTACACTGCAGCCTGG + Intronic
1125638879 15:41212973-41212995 AATCAGAGTTCACTGCAGCCTGG - Intronic
1126010294 15:44296114-44296136 GATCATAGCACACCACAGCCAGG + Intronic
1128037379 15:64538898-64538920 GATCATAGTTCACTGCAGCCTGG + Intronic
1129134918 15:73539666-73539688 AATGTTAGTCCACCACAGCCAGG - Intronic
1129473585 15:75768350-75768372 AATCATAGCTCATCACAGCCTGG + Intergenic
1129486308 15:75876140-75876162 AATCTTAGCTCAGCAGACCCTGG + Intronic
1129666123 15:77580296-77580318 AATCATAGGTCACTGCAGCCTGG - Intergenic
1130019722 15:80218199-80218221 AATCATAGCTCACTGCAGCCTGG + Intergenic
1130120790 15:81045872-81045894 ACTCATAGTTCAGCACAGCTAGG - Intronic
1130327594 15:82893688-82893710 AATCATAGCTCACTGCAGCCTGG + Intronic
1131120574 15:89820931-89820953 GATCCCAGTTCCCCACACCCTGG - Intergenic
1131755246 15:95553051-95553073 AATCGTAGCTCACCGCAGCCTGG - Intergenic
1131834771 15:96379418-96379440 AATCATAGCTCACTTCAACCTGG + Intergenic
1131929622 15:97426801-97426823 AATCATAGCTCACTGCAACCCGG + Intergenic
1132077730 15:98836451-98836473 GATCATAGTTCACTGCAGCCTGG - Intronic
1132479098 16:157474-157496 AATCATAGCTTACTACAGCCTGG - Intronic
1132905783 16:2282164-2282186 AATCATAGGTCACTGCAGCCCGG + Intronic
1133037869 16:3044783-3044805 GATCATAGCTCACCGCAGCCTGG - Intergenic
1135117310 16:19734713-19734735 AATCATAGCTCACTGCATCCTGG - Intronic
1135182013 16:20283264-20283286 GATCATAGCTCACTGCACCCTGG - Intergenic
1135304578 16:21357008-21357030 AATCATGGCTCACCGCAGCCTGG - Intergenic
1135392787 16:22107678-22107700 AATCATAGCTCACTGCAGCCTGG - Intronic
1135417722 16:22281303-22281325 AATCATAGCTCACTCCAGCCTGG + Intronic
1135809231 16:25572410-25572432 AATCATAGCTCACTGCAGCCTGG + Intergenic
1136301318 16:29336135-29336157 AATCATGGCTCACCGCAGCCTGG - Intergenic
1136467113 16:30451976-30451998 AATCACAGTTCACTGCAGCCTGG + Intergenic
1137896836 16:52222023-52222045 AATCATAGTGCATTACAGCCTGG - Intergenic
1137978104 16:53047931-53047953 AATCATAGCTCACTACAGCCTGG - Intergenic
1138090002 16:54166101-54166123 GATCATAGCTCACTACAGCCTGG - Intergenic
1138940237 16:61781544-61781566 TATCATAGCTCACTCCACCCTGG - Intronic
1139488514 16:67272708-67272730 AATCATAGCTCACTGCAGCCTGG + Intergenic
1139710894 16:68775058-68775080 AATCATAGCTCATTGCACCCTGG - Intronic
1139918644 16:70444406-70444428 AATCATGGTTCACTGCAGCCTGG - Intergenic
1139956497 16:70695726-70695748 AATCCTGCTTCACCACAACCAGG - Intronic
1140390100 16:74579113-74579135 GATCATAGCTCACTACAGCCTGG - Intronic
1140578350 16:76199239-76199261 AATCATAGCTCACTGCAGCCTGG - Intergenic
1141777200 16:86132314-86132336 AATCATAGCTCACTGCAGCCTGG - Intergenic
1142802204 17:2353312-2353334 AATCAGAATTCACAAAACCCAGG - Intronic
1144066776 17:11631361-11631383 AATCTTAGTTGGCCAGACCCAGG + Intronic
1144235692 17:13258227-13258249 AATCATAGCTCACTGCAGCCTGG + Intergenic
1144330793 17:14222485-14222507 AATCATTGTTGACCCCTCCCTGG + Intergenic
1144526134 17:15991843-15991865 AATCATAGCTCACTGCAGCCTGG + Intronic
1144665160 17:17097425-17097447 AATCCTAGCTCACCGCAGCCTGG - Intronic
1146131608 17:30281731-30281753 AATCATAGCTCACTGCAGCCTGG + Intronic
1147060564 17:37874107-37874129 AATGATAGTTCTCCCCAACCTGG - Intergenic
1147267143 17:39241535-39241557 AATCATAGCTCACTGCAGCCTGG + Intergenic
1148409851 17:47456587-47456609 AATTATAGTTCTCCCCAACCTGG - Intergenic
1148599436 17:48883008-48883030 AATCATAGCTCACTGCAGCCTGG - Intergenic
1148918141 17:51002079-51002101 AATCATAGCTCACTGCAGCCTGG + Intronic
1148962217 17:51402827-51402849 AATCATAGCTCACAGCAGCCTGG + Intergenic
1149272332 17:54993413-54993435 AATCATAGCTCACTGCAACCTGG - Intronic
1149788812 17:59459623-59459645 AATCATAGCTCACTACAGCCTGG + Intergenic
1150063889 17:62092398-62092420 AATCATAGCTCACTGCAACCTGG - Intergenic
1150206106 17:63409235-63409257 GATCATAGCTCACCAAAGCCTGG + Intronic
1150244466 17:63663824-63663846 AATCATAGCTCATCGCAGCCTGG - Intronic
1151173833 17:72270655-72270677 AATCATTGTTCTCCCCAGCCTGG + Intergenic
1151350047 17:73526311-73526333 AATCAGAGTTCATCTCACCCAGG - Intronic
1152010460 17:77710105-77710127 AATCATAGCTCACTGCAACCTGG - Intergenic
1153809455 18:8739177-8739199 CATCAAAGCTCACCACAGCCTGG - Intronic
1153836910 18:8971562-8971584 AATCATAGCTCACGACAACCTGG + Intergenic
1155305973 18:24478736-24478758 AATCATAGCTCACTGCAGCCTGG + Exonic
1155468112 18:26161670-26161692 GATCATAGTGCACTACAGCCTGG - Intronic
1156582082 18:38389219-38389241 AATCATAGGTCACTACAGCCTGG - Intergenic
1158612557 18:58955189-58955211 GATCATGGTTCACTGCACCCTGG - Intronic
1158719431 18:59910827-59910849 AAGCATAAGCCACCACACCCGGG + Intergenic
1158962009 18:62595453-62595475 GATCACAGTTCACTACAGCCTGG + Intergenic
1161261980 19:3342994-3343016 AATCATAGCTCACTGCAGCCTGG - Intergenic
1161939499 19:7394151-7394173 GATCATAGCTCACCGCAGCCTGG + Intronic
1162006720 19:7785753-7785775 TATCATAGCTCACTACAGCCTGG + Intergenic
1162050836 19:8031738-8031760 GATCATAGCTCACTACAGCCTGG - Intronic
1162063949 19:8113335-8113357 AATCATAGCTCACTGCAGCCTGG + Intronic
1162293809 19:9798882-9798904 AATCATAGCTCACCGCAGCATGG - Intergenic
1162579014 19:11516585-11516607 AATCATAGCTCACTGCAGCCTGG - Intronic
1162671926 19:12265016-12265038 AATCATATTTTAACACACCTAGG + Intronic
1162920744 19:13901036-13901058 AATCATAGCTCACTGCAGCCTGG + Intronic
1163089835 19:15011886-15011908 CATCATAGTTCACTGCAACCTGG - Intronic
1163439629 19:17315519-17315541 AATCATAGCTCACTGCAGCCTGG - Intronic
1163778251 19:19230792-19230814 AATCATAGCTCACTGCACCGAGG + Intronic
1164484722 19:28645198-28645220 AATCATAGCTCACTGCAGCCTGG + Intergenic
1164626110 19:29729172-29729194 AATCATAGCTCACTGCAGCCTGG + Intergenic
1164819269 19:31232439-31232461 AATCCTACTTAACCACAGCCAGG - Intergenic
1165552618 19:36601484-36601506 GATCATAGCTCACTACAGCCTGG - Intronic
1166093503 19:40525386-40525408 AATCATAGCTCACTGCAGCCTGG + Intronic
1166145794 19:40834311-40834333 GATCATAGCTCACCATAGCCAGG - Intronic
1166149898 19:40865205-40865227 GATCATAGCTCACCATAGCCAGG - Intronic
1166610097 19:44183946-44183968 AAACATAGTTTACCAATCCCTGG - Intergenic
1166836788 19:45672075-45672097 CATCATAGTTCACTGCAGCCTGG + Intronic
1166869096 19:45860052-45860074 AATCATACTTCACTACAACCAGG - Intronic
1167145410 19:47678628-47678650 AATCATAGCTCACCGTAGCCTGG + Intronic
1167198087 19:48044493-48044515 AATCGTAGTTCACTGCAGCCTGG - Intergenic
1167873539 19:52392885-52392907 AATCATAGCTCACTGCAGCCTGG + Intergenic
1168411546 19:56143290-56143312 GATCACAGGTCACTACACCCTGG - Intronic
925809656 2:7686615-7686637 CATCATAGCTCACCGCAGCCTGG - Intergenic
926202378 2:10811429-10811451 CATCATAGTTCACTGCAGCCTGG - Intronic
926652352 2:15360487-15360509 AAGCATGCATCACCACACCCAGG + Intronic
927585659 2:24301933-24301955 AACCATAGTTCTCCACCTCCAGG + Intronic
927951719 2:27174835-27174857 AATCATAGCTCACTGCAGCCTGG - Intergenic
928031312 2:27782225-27782247 AATCATAGCTCACTGCAGCCTGG + Intronic
928842782 2:35630680-35630702 GATCATGGTTCACTATACCCAGG + Intergenic
930012076 2:46945166-46945188 TCTCATAGTTCACTTCACCCTGG + Intronic
930667875 2:54117359-54117381 AATCATAGCTCACTGCAGCCTGG + Intronic
931271091 2:60703476-60703498 AATCATAGTTCACTGTAACCTGG + Intergenic
931354033 2:61518185-61518207 AATCATGGTTCACTGCAGCCTGG - Intronic
931367223 2:61629379-61629401 TATCACAGTTCACTACAGCCTGG + Intergenic
933948681 2:87309684-87309706 AATCATAGCTCACCATAGCCTGG + Intergenic
934036252 2:88091083-88091105 AGTCATGGTTCACCAGGCCCAGG - Exonic
935245216 2:101213109-101213131 AATCATAGCTCACTGCAGCCTGG + Intronic
936331517 2:111551912-111551934 AATCATAGCTCACCATAGCCTGG - Intergenic
936476604 2:112845101-112845123 AATCATGGTTCACTACAGCCTGG - Intergenic
937707246 2:124935431-124935453 AATCACAGTTTACAAGACCCAGG + Intergenic
938020120 2:127899460-127899482 AATCATGGTTCACTGCAGCCTGG - Intergenic
939365103 2:141220488-141220510 AAACATACTTCACGACATCCAGG + Intronic
939566470 2:143791624-143791646 AATCATAGCTCACTGCAGCCTGG + Intergenic
941033313 2:160537887-160537909 AATCATAGTTCACTGTAACCTGG + Intergenic
941152597 2:161933456-161933478 AATCATAGCTCACTGCAGCCTGG + Intronic
941688304 2:168470315-168470337 AATCATAGTTCATTGCAGCCTGG - Intronic
941950077 2:171146256-171146278 AATCATAGCTCACTGCAGCCTGG - Intronic
941999262 2:171629700-171629722 AATCATAGCTCACTGCAGCCTGG - Intergenic
942103272 2:172607223-172607245 AATCATAGCTCACTGCAGCCTGG - Intronic
942155703 2:173124920-173124942 AATCATAGCTCACTATAGCCTGG - Intronic
943198764 2:184791826-184791848 AATCATCTTTCCCCAAACCCTGG + Intronic
944311383 2:198237414-198237436 GATCATAGTGCACCACAGCCTGG + Intronic
945468866 2:210203739-210203761 AATCATAGTTCATTACATCCTGG + Intronic
945913123 2:215671980-215672002 AATCATAGCTCACCGCAGCCTGG - Intergenic
945958428 2:216107561-216107583 AATCATAGCTCTCTGCACCCTGG - Intronic
946642899 2:221803225-221803247 GATCATAGCTCACTACAGCCTGG - Intergenic
947039480 2:225899750-225899772 AATAATTGTGCACCAAACCCTGG + Intergenic
947945413 2:234097725-234097747 GATTATAGTTCACCACAGCCTGG + Intergenic
1168964305 20:1889970-1889992 AATCATAGGTCACTGCAGCCTGG + Intergenic
1169444704 20:5661764-5661786 AATCATAGCTCACTGCAACCTGG - Intergenic
1169801687 20:9517501-9517523 CACCATAGATCACCACAGCCTGG + Intronic
1170447601 20:16445132-16445154 AATCATAGCTCACTGCAGCCTGG - Intronic
1171015538 20:21537819-21537841 AATCATAGCTCACAGCAACCTGG + Intergenic
1172670419 20:36631216-36631238 AATCATGGCTCACTGCACCCTGG + Intronic
1174656092 20:52173520-52173542 AATCATAGCTCACTGCAGCCTGG - Intronic
1174792657 20:53494950-53494972 AATCATAATTGAACACACCCAGG - Exonic
1174962348 20:55172804-55172826 AATCATAGCTCACCGCAACCTGG + Intergenic
1175222894 20:57427424-57427446 AATCATAGCTCACTGCAGCCTGG - Intergenic
1175804241 20:61818610-61818632 AATCATAGCTCACTGCAGCCTGG - Intronic
1175830498 20:61962787-61962809 AATCATAGCTCACTGCAGCCTGG - Intronic
1177472564 21:21577779-21577801 AATCAGAGTTCAACACAAACTGG + Intergenic
1178163713 21:29948178-29948200 AATCATTGTTCACTGCAGCCTGG + Intergenic
1178356941 21:31917256-31917278 GATCATAGGTCACTACAGCCTGG + Intronic
1178497182 21:33097125-33097147 AATCATAGCTCACTGCAGCCTGG + Intergenic
1178533103 21:33391589-33391611 AATCATATTTCACCGCAGCCTGG - Intergenic
1179165474 21:38932182-38932204 GATCACAGCTCACCACAGCCTGG + Intergenic
1179843678 21:44095113-44095135 AATCATAGCTCACTGCAGCCTGG + Intronic
1181394094 22:22606170-22606192 AATCTCAGTTCACAACATCCAGG + Intergenic
1182183358 22:28375020-28375042 GATCATAGCTCACTACATCCTGG - Intronic
1182248343 22:28978974-28978996 AATCATTGCTCCCCTCACCCTGG + Intronic
1182273488 22:29170503-29170525 AATCATAGCTCACTGCAGCCTGG - Intergenic
1182276283 22:29190704-29190726 AATCATAGCTCACTGCAGCCTGG - Intergenic
1182335937 22:29583417-29583439 AATCATAACTCACTACAGCCTGG - Intergenic
1182428782 22:30288556-30288578 AATCCTACTCCACCACTCCCTGG - Intronic
1183175999 22:36225178-36225200 AATCATGGCTCACCACATCTTGG - Intergenic
1183901037 22:41006185-41006207 AATCATAGCTCACTGCAGCCTGG - Intergenic
1184180944 22:42825186-42825208 AATCACAGTTCACTGCAGCCTGG - Intronic
1185092508 22:48783981-48784003 GAGCACAGTTCACAACACCCTGG + Intronic
1185175737 22:49325514-49325536 CCTCATTGTCCACCACACCCAGG + Intergenic
1185427388 22:50780464-50780486 AATCATAGCTCACCACAGCCTGG + Intronic
949314776 3:2740292-2740314 AATCATAGCTCACTGCAGCCTGG - Intronic
949408212 3:3736612-3736634 AATCATAGGTCACTGCAGCCTGG - Intronic
949495328 3:4626071-4626093 AATCATAGCACACTACAGCCTGG - Intronic
949937478 3:9127269-9127291 AATCATAGCTCACTGCAGCCTGG - Intronic
950295454 3:11825855-11825877 GATCATAGTTCACTGCAGCCTGG + Intronic
950682529 3:14594960-14594982 AATCACAGTTCACTGCAGCCTGG + Intergenic
950734539 3:14994847-14994869 AATCATAGCTCACTGCAGCCTGG - Intronic
951031389 3:17885657-17885679 ATTCATATTTCACCACTCACTGG + Intronic
951113199 3:18830308-18830330 AATCATGGTTTACCACTTCCTGG + Intergenic
952317543 3:32244253-32244275 AATCATAGCTCACTGCAACCTGG + Intronic
953088301 3:39696356-39696378 AAACTTAGATCACAACACCCAGG + Intergenic
953313748 3:41906461-41906483 AATCATAGCTCACTGCAGCCAGG - Intronic
953937631 3:47059561-47059583 AATCATGTGCCACCACACCCGGG + Intronic
954482143 3:50810067-50810089 AATCATAGCTCACTGCAGCCTGG - Intronic
955215138 3:56979086-56979108 AATCATAGTTCACTGCAGCCTGG - Intronic
955256205 3:57334246-57334268 AATATTATTTCACCCCACCCAGG - Intronic
955887187 3:63613036-63613058 AATCATAGCTCACTATAACCTGG + Intronic
956847607 3:73197640-73197662 AATCATCTTTCCCCACACCTTGG + Intergenic
957248138 3:77738474-77738496 GATCATAGTTCACTGCAGCCTGG + Intergenic
959080795 3:101798999-101799021 GATCATAGCTCACTACAACCTGG + Intronic
959321961 3:104887897-104887919 AATCAAAGGTCCCCAAACCCTGG - Intergenic
960862614 3:122167519-122167541 AAACATAGATCACAACACTCAGG - Intergenic
961008583 3:123421511-123421533 GGTCATAGTGGACCACACCCAGG - Intronic
961145261 3:124587769-124587791 GATCATGGTTCACCACAACCAGG + Intronic
961840739 3:129709408-129709430 AATCTCAGCTCACCACAGCCTGG - Intronic
962213393 3:133498496-133498518 AATCATAGCTCACTGCAGCCTGG - Intergenic
962550947 3:136491181-136491203 GATCATAGTTCACTGCACCCTGG + Intronic
963609020 3:147441948-147441970 AATCATAGCTCGCTACAGCCTGG + Intronic
963905237 3:150768188-150768210 AATCATAGTGCATTACAGCCTGG + Intergenic
964328637 3:155575720-155575742 AATCATAGCTCACTGCAGCCTGG + Intronic
965151569 3:164983653-164983675 AATCATGGCTCACTACAGCCTGG + Intronic
966968571 3:185020534-185020556 GATCATAGTTCACTGCATCCTGG + Intronic
966997362 3:185296176-185296198 AATCATGGCTCACCGCAGCCTGG - Intronic
967141222 3:186562277-186562299 AATCATAGCTCACTATAGCCTGG - Intronic
968562715 4:1293323-1293345 AATCTCGGTTCACCACAGCCTGG - Intronic
968823363 4:2874148-2874170 AATCATAGCTCACTACAGCCTGG - Intronic
969359247 4:6651456-6651478 AATCATAGCTCACTCCAGCCTGG - Intergenic
969661408 4:8531507-8531529 AATCATAGCTTACTACAGCCTGG + Intergenic
970008858 4:11436682-11436704 AACCATCCTTCACCCCACCCGGG - Intergenic
970601896 4:17647316-17647338 AATCATAGCTCACCACAGCCTGG + Intronic
970797223 4:19927553-19927575 AATCATAGCTCACTGCAGCCCGG + Intergenic
971618105 4:28820007-28820029 AAGCATGAGTCACCACACCCTGG - Intergenic
972920489 4:43934486-43934508 GATCATAGCTCACTACAGCCTGG - Intergenic
975091790 4:70412169-70412191 AATCATAGCTCACTACAGCCTGG - Intergenic
976086262 4:81410143-81410165 AATCATAGCTCACTACCTCCTGG + Intergenic
977202733 4:94136081-94136103 CATCATAGTGCACTACAGCCTGG - Intergenic
979235143 4:118391431-118391453 AGTCATAGCTCACTACAGCCTGG - Intergenic
980518436 4:133896882-133896904 TATCATAGCTCATCACAGCCTGG - Intergenic
980712561 4:136589806-136589828 AATCATAGCTCCCCGCAACCTGG - Intergenic
980761825 4:137244514-137244536 AATCATAGTTCACTGCAGTCTGG - Intergenic
981102208 4:140841636-140841658 AATCACAGCTCACTACAGCCTGG + Intergenic
983841931 4:172467957-172467979 GATCATAGCTCACTACAGCCTGG + Intronic
985937973 5:3111312-3111334 AATCATAGCTCACTGCAGCCTGG + Intergenic
986295823 5:6437650-6437672 CATCATAGCTCACTACAGCCTGG - Intergenic
987028524 5:13952846-13952868 AATCATAGCTCACTGCAGCCTGG + Intergenic
987029608 5:13963752-13963774 TATCATAGCTCACTACAGCCTGG + Intergenic
987338410 5:16917807-16917829 AATCACAGCTCACTATACCCCGG - Intronic
987340144 5:16932844-16932866 AATCATGGTTCACTGCAGCCTGG + Intronic
987443487 5:17986599-17986621 AATCATAGCTCACTAAAGCCTGG - Intergenic
988382817 5:30520299-30520321 AATCATAGCTCACCGAAGCCTGG + Intergenic
988679876 5:33474507-33474529 AATCATAGCTCACTATACCCTGG - Intergenic
989161465 5:38395307-38395329 AATCATAGATCACTACAGCCTGG + Intronic
990476066 5:56162733-56162755 AATCACAGTTCACTGCAACCTGG + Intronic
990695517 5:58412200-58412222 AATCACTGTCTACCACACCCTGG + Intergenic
991165042 5:63556218-63556240 AATCATAGCTCACTGCAGCCTGG - Intergenic
992259925 5:74959373-74959395 GATCATAGCTCACTACATCCTGG + Intergenic
992569643 5:78042306-78042328 AATCATAGCTCACTGCAGCCTGG + Intronic
992701023 5:79342113-79342135 GATCATAGTTCACTGCAGCCTGG - Intergenic
992781166 5:80129362-80129384 AATCATAGCTCACTGCAGCCTGG + Intronic
992805814 5:80336735-80336757 AATCATAGCTCATTACAGCCTGG + Intergenic
993295839 5:86138669-86138691 AAACACAGATAACCACACCCTGG + Intergenic
994373377 5:98991987-98992009 ACTAATATATCACCACACCCAGG - Intergenic
995491986 5:112703337-112703359 AATCATAGCTCACCGCAGCCTGG + Intergenic
996064711 5:119068198-119068220 GATCATAGTTCACTGCAACCTGG + Intronic
996721531 5:126635100-126635122 AATCATAGCTCACTGCAGCCTGG - Intronic
997011699 5:129885864-129885886 AATAAAAGTTCACCAATCCCTGG - Intergenic
997433759 5:133859053-133859075 AGACATAGGCCACCACACCCAGG + Intergenic
997864590 5:137449818-137449840 GATCATAGCTCACTACAGCCTGG - Intronic
998052201 5:139045280-139045302 AATCATGGCTCACTACAGCCTGG - Intronic
998145053 5:139722858-139722880 AATCATAGCTCACTGCAGCCTGG - Intergenic
999437170 5:151571754-151571776 CTTCCTAGTTCACAACACCCAGG + Intergenic
999657408 5:153824389-153824411 AATCATATTGCACTACAGCCTGG - Intergenic
999856956 5:155605544-155605566 ATTCACAGTTCCCCACTCCCTGG - Intergenic
1000779241 5:165459757-165459779 AATCATGGCTCACTACAGCCTGG + Intergenic
1001296650 5:170503669-170503691 AATCACAATGCACCACACACAGG + Intronic
1002121917 5:177011515-177011537 AATCATAGCTCACTGCAGCCTGG - Intronic
1002328100 5:178423030-178423052 AATCATAGCTCACTGCAGCCTGG + Intronic
1003040052 6:2679332-2679354 AATCATAGTTCACAACTTCAGGG + Exonic
1003110842 6:3251034-3251056 AATCATAGCTCACTGCAGCCTGG + Intronic
1003691634 6:8360409-8360431 AATCAGAATTCATCACAGCCAGG - Intergenic
1003733917 6:8856436-8856458 GATCATGGTTCACCGCAGCCTGG + Intergenic
1004347249 6:14859950-14859972 AATAATAGTTCCCAACACCTAGG - Intergenic
1005262621 6:24078137-24078159 CATCATAGTTAACCACTTCCCGG + Intergenic
1005346109 6:24892334-24892356 AATCATAGCTCACTAAAGCCTGG + Intronic
1006057689 6:31397715-31397737 AATCATAGCTCACTGCAGCCTGG + Intergenic
1006070176 6:31492711-31492733 AATCATAGCTCACTGCAGCCTGG + Intergenic
1006637323 6:35469756-35469778 AATCATAGTTCACCAGCACCTGG - Intronic
1009663698 6:66647966-66647988 AATCACAGATCACAGCACCCAGG - Intergenic
1009991072 6:70843437-70843459 AATGATAGTTCACCAATCTCAGG - Intronic
1011418483 6:87147794-87147816 GATCATAGCTCACTACAGCCTGG - Intergenic
1011586902 6:88935983-88936005 AATCATGGCTCACCACTGCCTGG + Intronic
1011971698 6:93232980-93233002 AATCAAAATTTACCATACCCTGG + Intergenic
1012035392 6:94131444-94131466 AGTCAAAGTTCACCACTCCTGGG + Intergenic
1012577498 6:100821093-100821115 AATCATGGCTCACTACAGCCTGG + Intronic
1013239054 6:108225972-108225994 AATCATAGTTCACTACAGTCTGG - Intronic
1013248187 6:108308213-108308235 AATCATGGTTCACTGCAGCCTGG + Intronic
1013396932 6:109750565-109750587 AATCATAGCTCACTGCATCCTGG - Intronic
1013509797 6:110834271-110834293 GATCATAGTTCACTGCAGCCTGG - Intronic
1013660254 6:112288675-112288697 AATCATAGTTCATTGCAGCCTGG - Intergenic
1015631652 6:135237501-135237523 AATCATAGCTCACTACCACCTGG - Intergenic
1015712371 6:136156253-136156275 AATCATAGCTCACTGCAGCCTGG + Intronic
1015759680 6:136644992-136645014 AATCATAGCTCACTACAGCCTGG + Intronic
1016620262 6:146101025-146101047 AATCATAGCTCTCTACAGCCTGG - Intronic
1017486075 6:154902919-154902941 AATCACAGCTCACTGCACCCTGG - Intronic
1018051928 6:160016651-160016673 CATCATCCCTCACCACACCCTGG + Intronic
1019818223 7:3217161-3217183 AATCATAGCTCACTGCAGCCTGG - Intergenic
1019918257 7:4147244-4147266 GATCATAGGTCACCGCAGCCTGG + Intronic
1019982386 7:4631013-4631035 AATCATAGCTCACTGCAGCCCGG + Intergenic
1019998632 7:4741659-4741681 AAACAAAGTTCACCAAATCCTGG - Intronic
1020131127 7:5559142-5559164 AATCATCCCTCACCACCCCCAGG + Intronic
1020943802 7:14575057-14575079 AATCATAGCTCACTGCAGCCTGG - Intronic
1021391963 7:20103640-20103662 GATCATAGTTCACCATAACCTGG - Intergenic
1021503339 7:21354017-21354039 AATCATAGCTCACTGCAACCTGG + Intergenic
1021511061 7:21432926-21432948 AATCACAGCTCACCGCAGCCTGG - Intronic
1022350166 7:29560795-29560817 AATCATAGCTCACTGCAGCCTGG + Intergenic
1022354812 7:29603776-29603798 AATCATAGCTCACTGCAGCCTGG + Intergenic
1022813862 7:33895204-33895226 AATCATAGCTCACTGCAGCCTGG - Intergenic
1023011240 7:35926375-35926397 AATCATAGATCACTGCAGCCTGG + Intergenic
1023427016 7:40048398-40048420 AATCATATTTCACTACCACCAGG - Intronic
1024005704 7:45223916-45223938 ATTCATAGCTCAGCACCCCCAGG + Intergenic
1024079906 7:45847529-45847551 AATCATAGATCACTGCAGCCTGG - Intergenic
1024213346 7:47226356-47226378 AATCATAGTTCACTGCAGCCTGG + Intergenic
1024897977 7:54282061-54282083 AATCATAGCTCACTGCAGCCTGG + Intergenic
1025124874 7:56336467-56336489 AATCATAGATCACTGCAGCCTGG + Intergenic
1026206655 7:68263531-68263553 AATCATAGCTCACTGCATCCTGG - Intergenic
1026260415 7:68750263-68750285 AATCATAGTTCACTGCAGCCTGG + Intergenic
1026470495 7:70690893-70690915 AATCATAGCTCACTATAACCTGG - Intronic
1026584922 7:71648334-71648356 AATCACAGCTCACCGCAGCCTGG + Intronic
1026588393 7:71676447-71676469 AATCATAGCTCACTGCAGCCTGG + Intronic
1026600835 7:71776016-71776038 GATCATAGCTCACTACAGCCTGG + Intergenic
1026945043 7:74310455-74310477 AATCATGGTTCACTGCAGCCTGG - Intronic
1027216091 7:76185026-76185048 AATCATAGCTCACTGCAGCCTGG + Intergenic
1028266438 7:88732671-88732693 AAACTTAGGTCACAACACCCAGG - Intergenic
1028593094 7:92519288-92519310 AATCATAGTTCACTGCAGCCTGG + Intronic
1029170028 7:98624024-98624046 AATCATAGCTCACTGCAGCCTGG + Intronic
1029199330 7:98828095-98828117 GATCATAGCTCACTACAGCCTGG + Intergenic
1029255568 7:99267292-99267314 AATCACAGCTCACTACAACCTGG + Intergenic
1029422943 7:100480711-100480733 GATCATAGCTCACCACAGCCTGG + Intergenic
1029429574 7:100521950-100521972 AATCATGGTTCACTACAGCCTGG - Intergenic
1029555437 7:101265665-101265687 AATCATAGCTCACTGCAGCCTGG + Intergenic
1030644749 7:112047756-112047778 GATTATAGCTCACCACAGCCTGG + Intronic
1031405309 7:121378383-121378405 GATCACAGCTCACCACAGCCTGG + Intronic
1031501628 7:122525072-122525094 TATCATGGCTCACCACAGCCTGG - Intronic
1031533961 7:122910793-122910815 AATCATAGCTCACTGCAGCCTGG - Intergenic
1031876044 7:127142046-127142068 GATCATAGCTCACTACAACCTGG + Intronic
1031953824 7:127921879-127921901 AATTATAGTACACCACACAATGG - Intronic
1032907313 7:136383923-136383945 AATCATACTTTACCATGCCCTGG - Intergenic
1033078476 7:138271656-138271678 AATCATAGCTCACTGCAGCCAGG + Intergenic
1033288909 7:140064797-140064819 AGTCATAGCTCACTACAACCTGG + Intergenic
1033307214 7:140233755-140233777 AATCATAGCTCACTACAGCCAGG + Intergenic
1033570441 7:142623139-142623161 GAGCCTAGTTGACCACACCCGGG - Intergenic
1033879009 7:145858396-145858418 AATCATAGCTCACTGCAGCCTGG - Intergenic
1035723270 8:1808984-1809006 AATTATGGCTCACCACAGCCTGG + Intergenic
1035738142 8:1904029-1904051 AATAACAGCTCACCACAGCCTGG - Intronic
1036409311 8:8484084-8484106 GATCATAGTGCACTACAGCCTGG - Intergenic
1036556910 8:9868217-9868239 GATCATAGCTCACTACAGCCTGG + Intergenic
1036923473 8:12880765-12880787 AATCATAGGTCACTGCAGCCTGG - Intergenic
1037160240 8:15760963-15760985 TATCATACTTAATCACACCCAGG + Intronic
1038066498 8:23968756-23968778 GATCATAGTTCACTGCATCCTGG + Intergenic
1038563278 8:28598644-28598666 AATCATAGCTCACTATATCCTGG + Intergenic
1039246821 8:35617794-35617816 AATCAAAATTCACCACAGCAGGG - Intronic
1039563578 8:38532310-38532332 AATCATAGCTCACTGCAGCCTGG - Intergenic
1039937055 8:42053843-42053865 GATCATAGTTCACTGCAGCCTGG - Intergenic
1041206595 8:55505483-55505505 AATCATAGCTCACTGCAACCTGG - Intronic
1045323850 8:101102233-101102255 AATCACAGCTCACTACAGCCTGG + Intergenic
1045565478 8:103310333-103310355 AATCATAGCTCACTGCAACCTGG + Intronic
1045750066 8:105472959-105472981 GATCATAGCTCACTACAGCCTGG + Intronic
1047595523 8:126374201-126374223 AATCATAGCTCACTGCAGCCTGG + Intergenic
1048061120 8:130920075-130920097 AATCATAGCTCACTGCAGCCTGG - Intronic
1048578404 8:135710790-135710812 GATCACAGATCACCACAGCCTGG + Intergenic
1049088388 8:140495218-140495240 AATCATAGCTCACTGCAGCCTGG + Intergenic
1049145443 8:140997871-140997893 AATCATAGCTCACTGCAACCTGG - Intronic
1049431192 8:142565906-142565928 AATCCTAGCTCACTGCACCCTGG - Intergenic
1050257518 9:3810654-3810676 AATAATAGTTCAGCACAGCCAGG + Intergenic
1050572938 9:6960343-6960365 AATCATAGCTCACTGCAGCCTGG + Intronic
1050652355 9:7788454-7788476 ATTCATAGATAACCACCCCCCGG - Intergenic
1051216099 9:14799218-14799240 AATCACAGTTCACTCCAGCCTGG - Intronic
1051942234 9:22521713-22521735 AATCATAGTACACCAAACATTGG + Intergenic
1052000842 9:23278149-23278171 AATCTTGGCTCACTACACCCAGG - Intergenic
1052196663 9:25725002-25725024 AATCATAGCTCACTGCAGCCTGG - Intergenic
1052958174 9:34271027-34271049 GATCATAGTTTACTACAGCCTGG - Intronic
1053088787 9:35253205-35253227 AATCATAGCTCACTACATCCTGG + Intronic
1055188482 9:73487337-73487359 AATCATAGCTCACTGCAGCCTGG - Intergenic
1055708542 9:79034389-79034411 AAACAAAGCTCACCACACCGGGG - Intergenic
1056519499 9:87387101-87387123 GATCATAGTACACTACAGCCTGG - Intergenic
1056806875 9:89735847-89735869 TATCATTCTGCACCACACCCAGG - Intergenic
1057165624 9:92923235-92923257 AATCATAGTTCACGGCAGCCTGG + Intergenic
1060202879 9:121661913-121661935 GATCATAGGTCATCACAACCTGG - Intronic
1060614611 9:125000534-125000556 GATCATAGTTCACTGCAGCCTGG - Intronic
1061598873 9:131652314-131652336 GATCACAGCTCACCACAGCCTGG + Intronic
1062239671 9:135529606-135529628 AATCATAGCTCACTACAGCCTGG + Intergenic
1186028421 X:5339507-5339529 AGACATGGGTCACCACACCCTGG - Intergenic
1186326428 X:8482274-8482296 AATCATAGGTCACTGCAGCCTGG + Intergenic
1186473846 X:9841991-9842013 CATCATAGTTCACTACAGCCTGG - Intronic
1187318884 X:18222902-18222924 AATCATGGTTCACTGCAGCCTGG + Intergenic
1187887249 X:23901202-23901224 ACTCAGAGCTCACCACACCAAGG - Intronic
1187957584 X:24534889-24534911 AATCATAGCTCACTACAGCCTGG - Intronic
1188083531 X:25875155-25875177 AATCATAGCTCACTGCAACCTGG - Intergenic
1188749134 X:33884291-33884313 ACTCACAGTTCAGCACAGCCAGG - Intergenic
1190081585 X:47360815-47360837 AATCATAGCTCACTGCAGCCTGG + Intergenic
1190101610 X:47526472-47526494 AATCAGAGCTCACCGCAGCCTGG + Intergenic
1193147826 X:78095321-78095343 CATCATAGTTCACAGCATCCTGG - Intronic
1195062774 X:101212598-101212620 AATCATAGCTCACTGCAACCTGG + Intergenic
1195939461 X:110155968-110155990 AATCATAGCTCACTGCAGCCTGG + Intronic
1196007432 X:110851368-110851390 AATCAAATTTTACCCCACCCTGG + Intergenic
1196272057 X:113723797-113723819 CATCATGGTTCACTACAGCCTGG - Intergenic
1196338717 X:114570073-114570095 AATCACAGTGCACTACAGCCTGG - Intergenic
1196360953 X:114857400-114857422 AACCATAGTTTGCCAAACCCTGG + Intronic
1196749510 X:119102442-119102464 GATCATAGTGCACTACAGCCTGG + Intronic
1197778119 X:130133692-130133714 GATCATGGCTCACCACAGCCTGG + Intronic
1201551593 Y:15222661-15222683 AATCATACCTCGCCACAGCCTGG + Intergenic