ID: 1113520562

View in Genome Browser
Species Human (GRCh38)
Location 13:110937635-110937657
Sequence CTGAGCATTCCTCACAGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 173}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113520562_1113520570 28 Left 1113520562 13:110937635-110937657 CCTTCCCTGTGAGGAATGCTCAG 0: 1
1: 0
2: 2
3: 16
4: 173
Right 1113520570 13:110937686-110937708 TTACTGCACCGGGGACGTCACGG 0: 1
1: 0
2: 0
3: 1
4: 57
1113520562_1113520569 19 Left 1113520562 13:110937635-110937657 CCTTCCCTGTGAGGAATGCTCAG 0: 1
1: 0
2: 2
3: 16
4: 173
Right 1113520569 13:110937677-110937699 CGACACTTATTACTGCACCGGGG 0: 1
1: 0
2: 0
3: 1
4: 16
1113520562_1113520567 17 Left 1113520562 13:110937635-110937657 CCTTCCCTGTGAGGAATGCTCAG 0: 1
1: 0
2: 2
3: 16
4: 173
Right 1113520567 13:110937675-110937697 AGCGACACTTATTACTGCACCGG 0: 1
1: 0
2: 1
3: 4
4: 25
1113520562_1113520568 18 Left 1113520562 13:110937635-110937657 CCTTCCCTGTGAGGAATGCTCAG 0: 1
1: 0
2: 2
3: 16
4: 173
Right 1113520568 13:110937676-110937698 GCGACACTTATTACTGCACCGGG 0: 1
1: 0
2: 0
3: 2
4: 41

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113520562 Original CRISPR CTGAGCATTCCTCACAGGGA AGG (reversed) Intergenic
900481143 1:2899921-2899943 CTGAGCACTCCTCACCGGCCAGG - Intergenic
900895843 1:5482334-5482356 CTGAGCAGGCATCACTGGGAGGG + Intergenic
902216893 1:14939968-14939990 CTGATCATCCCACCCAGGGAGGG + Intronic
905372567 1:37491825-37491847 GTGTGCTTTCCTCAGAGGGAAGG + Intergenic
906533277 1:46536039-46536061 CTGAGCCCTCCCCACAGGAAGGG - Intergenic
913518925 1:119627441-119627463 CTTAACCTTTCTCACAGGGAGGG + Intronic
915697907 1:157762917-157762939 TTGAGCATTTCTTACAGGGCTGG - Intronic
916679310 1:167089655-167089677 CTGAGCATTTCCCTCTGGGAGGG - Intronic
917229736 1:172823170-172823192 CTGAGCATTACTTAAAGGAATGG - Intergenic
917626770 1:176854265-176854287 CTGAGCATTCCTGAGAGGTACGG + Intergenic
919439692 1:197616303-197616325 TTTAGCATTCCTTAAAGGGAGGG - Intronic
920654956 1:207868286-207868308 CTGAGCATTCTGTAGAGGGAGGG - Intergenic
920791448 1:209096815-209096837 CTGAGCAGTACTCAGATGGACGG - Intergenic
922026843 1:221757754-221757776 CTGAGCATCCCTTACATGCAAGG + Intergenic
922536591 1:226385617-226385639 CCGAGCATTCCTCGCAGGGAAGG + Exonic
922818169 1:228465918-228465940 CTAAGCTTAACTCACAGGGAAGG + Intergenic
922960726 1:229643707-229643729 CTGAGCCTGCCACACAAGGAGGG - Intronic
1063004852 10:1960243-1960265 TTCAGCATTTCTCACAGGGCTGG + Intergenic
1063363747 10:5477408-5477430 CTGAGCAGTTCTCCCAGGAAAGG + Intergenic
1063732146 10:8709986-8710008 CTGTGCATTCCTTAAAGGAAGGG + Intergenic
1064090023 10:12375388-12375410 GTGAGCAATCCTCACACGGAAGG - Intronic
1064485995 10:15790826-15790848 CTGAGCATCCCTCACCCGAAAGG - Intronic
1068931543 10:62595482-62595504 GTGAGCATACCTCAACGGGATGG - Intronic
1070722308 10:78765161-78765183 CTTAGCCTTCCTCACAGCCAGGG - Intergenic
1070964981 10:80524397-80524419 CTGAGCTGTCCTCACAGACACGG - Exonic
1075488322 10:122845992-122846014 ATCAGCATTCCCCACAGTGAGGG + Exonic
1076472000 10:130725418-130725440 CTGAGCATTCTGCCCTGGGAGGG + Intergenic
1076984577 11:226111-226133 CTAAGCAGACCTCTCAGGGAAGG + Intronic
1077378143 11:2215246-2215268 CGGAGCCTTCCTCACAGGAGAGG - Intergenic
1081484753 11:43518934-43518956 CTGAGCATTGCACAAAGGCAAGG - Intergenic
1081733499 11:45387612-45387634 TTCAGCATTGCCCACAGGGAAGG + Intergenic
1083424421 11:62575751-62575773 CTGGGGAGTCCTCTCAGGGAGGG - Exonic
1084136446 11:67186486-67186508 CTGAGCATTTCTTACAAGGCAGG - Intronic
1085294109 11:75421071-75421093 CTGAGCGTTCCCCATAGGGTGGG + Intronic
1085314370 11:75535434-75535456 CTGAACACTCCTCAAGGGGAGGG - Intergenic
1086269952 11:85050630-85050652 CTGAGCCCTCCTCTCAGAGAAGG + Intronic
1089290110 11:117432467-117432489 CTCAGCATCTGTCACAGGGATGG + Exonic
1089768968 11:120788947-120788969 CTGAGCATTCTCCACAGGGCTGG - Intronic
1090070974 11:123544664-123544686 CTGAGCATTGCCCACAGCGGCGG + Intronic
1090132375 11:124158457-124158479 CTGGGCATCCCTCACACGGAGGG + Intergenic
1091242475 11:134063185-134063207 TTGTGCACTCCCCACAGGGAAGG - Intergenic
1091562691 12:1627151-1627173 CTGACCATCCCTCCCAGAGAAGG - Intronic
1092326835 12:7541684-7541706 CTGAACACTCCTCCCAGGCAGGG + Intergenic
1096609153 12:52789760-52789782 GTGAGCATCCCACCCAGGGAGGG + Exonic
1098750590 12:74288941-74288963 CTGGGAATTTCTCACAGGCAAGG - Intergenic
1100234128 12:92640971-92640993 CAGAGCAGTGGTCACAGGGAGGG + Intergenic
1100409429 12:94300275-94300297 CTGAGAAGGCCTCACAGAGATGG + Intronic
1100619222 12:96255513-96255535 CTGAGCTTTCCTCATATGCACGG - Intronic
1105406895 13:20140661-20140683 CAGAGCTGTCCTGACAGGGAAGG - Exonic
1106370768 13:29130467-29130489 TTGAGCAGGCCTCACTGGGAAGG - Intronic
1107789033 13:43982190-43982212 CGGAGCAATCCTTAAAGGGAAGG + Intergenic
1110013055 13:70363558-70363580 CAGATCATTCCCCACAGGTAAGG + Intergenic
1112924757 13:104660519-104660541 CTGAGCATTCCTCAGAAGTCAGG - Intergenic
1113001909 13:105648999-105649021 CTGAGCATTTCTTGCAGGGAAGG - Intergenic
1113466295 13:110515652-110515674 CTGAGTATTTCTCAGGGGGAAGG - Intergenic
1113520562 13:110937635-110937657 CTGAGCATTCCTCACAGGGAAGG - Intergenic
1115834650 14:37387089-37387111 CTGAGCATTCTTCACCTAGATGG - Intronic
1116788305 14:49311943-49311965 CTGACTTTTCCTTACAGGGAAGG - Intergenic
1117019910 14:51559502-51559524 CTGAGAATTTATCACAAGGAAGG - Intronic
1118455786 14:65944859-65944881 CTGTGCATTCCTCATGGGCAGGG + Intergenic
1119974933 14:79015026-79015048 CTGAGCAAATCTCAGAGGGAAGG - Intronic
1124380339 15:29160053-29160075 CTGAGCCTTGCCCAGAGGGAAGG + Intronic
1126435155 15:48629912-48629934 CTCAACATTCCTGAGAGGGAGGG + Intronic
1128221282 15:65970409-65970431 CTGAGCTCTCCTGCCAGGGAGGG - Intronic
1129342773 15:74897082-74897104 CTGAGCATTTCACACAGGGTTGG - Exonic
1131282442 15:91032580-91032602 CTGCTCATTCCTCTCTGGGAAGG - Intergenic
1132142333 15:99406146-99406168 GTGTGCCTTCCTTACAGGGAAGG + Intergenic
1132201472 15:99957189-99957211 CGGAGCAGTGCCCACAGGGATGG + Intergenic
1132375641 15:101326690-101326712 CTGAGCACTCTAGACAGGGATGG + Intronic
1133613354 16:7453713-7453735 CTGTGCATTGCTCAGAGGCAAGG - Intronic
1136557496 16:31016310-31016332 CTCAGCATTCTTCCCAGGGCTGG + Intergenic
1137576353 16:49602757-49602779 GTGAGTGTTCCTCCCAGGGAAGG + Intronic
1138912924 16:61424584-61424606 CTGAGCATTCCTGCAGGGGAGGG - Intergenic
1139793967 16:69466850-69466872 CTGAGGATTACTAACAGGAAAGG + Intergenic
1140087170 16:71807902-71807924 CTAAGTATTCAGCACAGGGAGGG + Intronic
1143769913 17:9162042-9162064 CTGAGCAATGCTCATGGGGAGGG + Intronic
1144693627 17:17286068-17286090 TTGAGAATGCCTCACAAGGAAGG + Intergenic
1147053243 17:37813969-37813991 CTGAGCATTCCTACTTGGGAAGG - Intergenic
1147763697 17:42818608-42818630 CTGTGCATTCCTCACAGAGTGGG + Exonic
1151649282 17:75456411-75456433 CTGAGCTTTACGCACAGGAAAGG + Intronic
1152292427 17:79447729-79447751 CTGAGCAATGCTCACATGGATGG - Intronic
1156083692 18:33373574-33373596 CTGAGTATTCCGCACAGGCAAGG - Intronic
1156778489 18:40822055-40822077 CTCATCCTTCCTCACTGGGAGGG + Intergenic
1157296232 18:46447263-46447285 TTCAGCATTTCTCTCAGGGATGG + Intronic
1157764283 18:50285464-50285486 CTGAGCATTCCTGGCAATGAGGG - Intronic
1158387512 18:57012305-57012327 CCCAGCCGTCCTCACAGGGATGG + Intronic
1161644736 19:5446070-5446092 CTGACCATTCTTCATGGGGATGG + Intergenic
1161819763 19:6522599-6522621 CTGAACATGCCCCCCAGGGAAGG - Intergenic
1163415924 19:17186454-17186476 CCGAGCTGTCCTCCCAGGGATGG - Intronic
1165607953 19:37122990-37123012 CTGAGAACTCCTCACTGTGATGG - Intronic
1167899656 19:52610184-52610206 CAGGGCATTCTTCACAGAGAGGG - Intronic
925162679 2:1696863-1696885 CTGAGCTTGTCTCTCAGGGATGG - Intronic
928173999 2:29022032-29022054 CTGAGCCCACCTAACAGGGAGGG - Intronic
930002653 2:46871413-46871435 CTGAGGATATCTCAAAGGGAAGG + Intergenic
930223541 2:48769008-48769030 CTGAGCATGCCTGAGAGAGATGG + Intronic
931712806 2:65003815-65003837 CTGGGCATTCCTCACTTGGCTGG - Intronic
931797161 2:65722239-65722261 CTGAGCCTCCCTCATAGGCAAGG - Intergenic
933693602 2:85198466-85198488 CTGAGCATTTTCCACAGGCAGGG + Intronic
933765939 2:85709847-85709869 CAGACCCTTCCTCCCAGGGATGG - Intergenic
933779077 2:85788883-85788905 CTGAGCACTCCTCAGAGCAAAGG + Intergenic
933866526 2:86523187-86523209 CTGTGCATTCCCAACACGGAAGG - Intronic
933897208 2:86822744-86822766 CTGAACATTGCTCTCTGGGAAGG - Intronic
937136629 2:119559129-119559151 ATGATCCTGCCTCACAGGGATGG + Intronic
942023735 2:171893111-171893133 CTGAACATTCCTCAAAGTTAAGG + Intronic
942153236 2:173099659-173099681 CTGAGAATGCTTCACAGAGAAGG - Intronic
942703037 2:178735458-178735480 CTGAGGATTCCTTGCAGAGAAGG + Intronic
943330679 2:186555318-186555340 CTGAGCATATCTCACATAGATGG + Intergenic
945141010 2:206686088-206686110 CTGAGCACTCCCCACAGCAAAGG - Intronic
945502212 2:210590004-210590026 CTAACCATTCCTTAAAGGGAAGG - Intronic
1169190220 20:3654111-3654133 AAGAGCATTCCAAACAGGGATGG + Intergenic
1169972050 20:11278771-11278793 ATGAGCAAGCCTCACAGAGAAGG - Intergenic
1171235036 20:23517812-23517834 CTGAGCATTCCACAGGGGAAGGG - Intergenic
1172074228 20:32281784-32281806 CTGAGATTTGCTCCCAGGGACGG + Intronic
1172870008 20:38130005-38130027 CAGAGCATTCCTCACAGCAAAGG + Exonic
1174289310 20:49496452-49496474 CTCACCTTTCCTCCCAGGGAGGG - Intergenic
1175987985 20:62773662-62773684 CTGAGCATTCGTTTCAGTGATGG + Intergenic
1176408231 21:6433487-6433509 CTCAGCAGTCCACACAGGGTGGG - Intergenic
1177190409 21:17845217-17845239 CAGAACATGCCTCAGAGGGAGGG + Intergenic
1179381139 21:40900465-40900487 ATGAGTAGTCCTCAAAGGGATGG + Intergenic
1179683722 21:43041813-43041835 CTCAGCAGTCCACACAGGGTGGG - Intergenic
1184045075 22:41968019-41968041 CTGAGCTTTCCACCCAGGCATGG + Intergenic
1184085115 22:42257192-42257214 CCCAGCATTCCTTACAGGGCAGG + Intronic
1184754538 22:46508502-46508524 CTGAGCATTTCTCACAGCCGGGG + Intronic
1184770326 22:46593431-46593453 CTGGGCCTGCCGCACAGGGAGGG + Intronic
1184802382 22:46769502-46769524 ATGAGCATTCCACCCAGTGAGGG - Intronic
949722422 3:7005909-7005931 CTGAGCATTCCTCAGAAACAGGG - Intronic
951346223 3:21549425-21549447 CTGAGAATTCCTCACAGAGTTGG + Intronic
960708542 3:120504775-120504797 CTGAGCATTTGTCACAGTGAAGG - Intergenic
965428896 3:168562263-168562285 GTGAGCTTTCTTCACATGGAGGG + Intergenic
969499932 4:7546464-7546486 CTGGGGATTCCTCACTGCGATGG - Intronic
973328214 4:48885534-48885556 TTTTGCATTCCTCACAGGTAAGG + Exonic
973542057 4:51944728-51944750 GTATGCATTCCTCACAGGGCTGG + Intergenic
975197742 4:71545206-71545228 CTGAGAACTCATCACAGGCAAGG - Intronic
979395989 4:120189847-120189869 CTGACCTTTGCTCACAGAGATGG - Intergenic
981645355 4:146992078-146992100 CTGAGCCATCTTCAGAGGGAAGG - Intergenic
984204501 4:176769617-176769639 ATGAACATGACTCACAGGGATGG + Intronic
984394428 4:179176438-179176460 TTAAGCATTCCTCTCGGGGAAGG + Intergenic
986310741 5:6549242-6549264 CTGAGCAATACTCACAGCGGAGG + Intergenic
986452413 5:7879944-7879966 CTCAGCAGTCCTCCCAGGTATGG + Intronic
988386233 5:30569026-30569048 CAGAGAATCCCTCACAGAGATGG - Intergenic
990292970 5:54373495-54373517 TTGAGCATTTCTCACAGGGCAGG + Intergenic
991767411 5:70001465-70001487 CTAAGCAATCCCCACAGTGATGG - Intergenic
991846646 5:70876542-70876564 CTAAGCAATCCCCACAGTGATGG - Intergenic
995267397 5:110178999-110179021 CTGTCCATTCCTAACAGAGAGGG - Intergenic
995872674 5:116759271-116759293 GTCAGCATTCCACTCAGGGAAGG - Intergenic
997740913 5:136252910-136252932 CTCAGGCTACCTCACAGGGATGG - Intronic
997828710 5:137130634-137130656 TTGGGAATTCCTCACAGTGATGG + Intronic
999201804 5:149822022-149822044 CTGGTAATTCCTCACAGGGTTGG - Intronic
999288155 5:150406668-150406690 CTGAGCCTTCCTCCCAGGGATGG + Intronic
1002279730 5:178123240-178123262 CTGAGCTTCCCTCAAAGGAAGGG - Exonic
1002431988 5:179209046-179209068 CTGGGCCACCCTCACAGGGAGGG - Intronic
1002575598 5:180172176-180172198 CTGTGCTCTCATCACAGGGAAGG - Intronic
1004967492 6:20871013-20871035 CTGCGCATTCCTCAAGGGCAAGG + Intronic
1006511176 6:34522065-34522087 CACAGCAATCCTCACAGAGAGGG - Intronic
1010456866 6:76066049-76066071 TTGAGCATTTCTCATAGGGGTGG - Intronic
1013235897 6:108197739-108197761 CTGGGCAGTCAGCACAGGGAAGG + Intergenic
1013285398 6:108677116-108677138 CTGAGCAGGCCTCCCTGGGAGGG + Intronic
1016241386 6:141935302-141935324 CTGGGGATTCCTCACAGTCATGG - Intergenic
1019049389 6:169171356-169171378 CTCAGCATTTCCCACATGGAAGG - Intergenic
1021045514 7:15918343-15918365 TTGAGGATGCCTCATAGGGAAGG - Intergenic
1022874262 7:34512671-34512693 CTGAGCATTACTCTCAGCTAGGG + Intergenic
1024692596 7:51819096-51819118 CTGACCAGTGCACACAGGGATGG + Intergenic
1030623944 7:111823045-111823067 CTAAGCACTCCTCACTGGGCTGG - Intronic
1030643217 7:112029260-112029282 ATGTGCATTCTTCACACGGAAGG - Intronic
1035377621 7:158415881-158415903 CAGAGCATTCCTCAGAGGGCTGG + Intronic
1038461135 8:27718032-27718054 CTGAGCAGTCCGCACACGCATGG + Intergenic
1041921751 8:63189612-63189634 TTCAACATTCCTCAGAGGGAAGG + Intronic
1044880749 8:96719693-96719715 CTGATCCTACCTCACAGGGGAGG - Intronic
1047865360 8:129018018-129018040 CTGAGCTTTCCTGACAGTAAAGG - Intergenic
1049527188 8:143133338-143133360 CTGACCCTTCCTCAGAGGGGAGG + Intergenic
1049648625 8:143751802-143751824 TTGAGCATTCCTTGCAGGGCAGG + Intergenic
1055851415 9:80635046-80635068 CTGAACATTTCTTACAGGGCAGG + Intergenic
1056626581 9:88258685-88258707 CTCAGCATTCTTCACAAGGAAGG + Intergenic
1057582448 9:96299445-96299467 TTGAAGATTCCCCACAGGGAGGG - Intronic
1057705169 9:97390607-97390629 GTGAGCAACACTCACAGGGAAGG + Intergenic
1058124546 9:101176434-101176456 CTACGCGTTCCTCACTGGGATGG + Intronic
1058482288 9:105408243-105408265 CTTAGCATTTCTCATAGGGCAGG - Intronic
1061161856 9:128900087-128900109 CTGAGGAATCCCCACAGGGAGGG - Intronic
1061467246 9:130791371-130791393 CTGAGAATTCATCACTGTGATGG + Intronic
1062067009 9:134533992-134534014 CTGAGACAACCTCACAGGGAGGG - Intergenic
1186977177 X:14920327-14920349 TTGAGAATTCCTCCCAGTGATGG + Exonic
1190679403 X:52811801-52811823 CTGGGCAGTCCTCACCGGGCGGG - Intergenic
1193331178 X:80237281-80237303 ATGAGTATTCCTCATGGGGAAGG - Intergenic
1193436879 X:81484821-81484843 TTGAGCATTTCTTACAGGGCTGG - Intergenic
1194034673 X:88855272-88855294 CTAAGCATGCCTCACAGTCATGG - Intergenic
1194498324 X:94646661-94646683 GTGCGCAATCCTCGCAGGGAGGG - Intergenic
1195034542 X:100960460-100960482 TTTAGCATTTCTCACAGGGCAGG - Intergenic
1195264491 X:103166600-103166622 TTGTACATTGCTCACAGGGATGG - Intergenic
1196174841 X:112629164-112629186 TTGAACATACCTCACTGGGAAGG - Intergenic
1198770322 X:140123985-140124007 TTGAGCATTTCTCACAGGACAGG + Intergenic
1199746934 X:150777726-150777748 CTGAGCATGCCTCACATGCCGGG + Intronic
1200127447 X:153822939-153822961 CTGAGAATTTCTCTCAGGAAAGG - Intronic