ID: 1113529217

View in Genome Browser
Species Human (GRCh38)
Location 13:111008177-111008199
Sequence CCCAGGACACTTAGTTCTTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113529217_1113529222 21 Left 1113529217 13:111008177-111008199 CCTAAAGAACTAAGTGTCCTGGG No data
Right 1113529222 13:111008221-111008243 TCTTTTTTACATTATTAACTGGG No data
1113529217_1113529223 30 Left 1113529217 13:111008177-111008199 CCTAAAGAACTAAGTGTCCTGGG No data
Right 1113529223 13:111008230-111008252 CATTATTAACTGGGAAAAAATGG No data
1113529217_1113529221 20 Left 1113529217 13:111008177-111008199 CCTAAAGAACTAAGTGTCCTGGG No data
Right 1113529221 13:111008220-111008242 GTCTTTTTTACATTATTAACTGG 0: 3
1: 10
2: 7
3: 26
4: 391

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113529217 Original CRISPR CCCAGGACACTTAGTTCTTT AGG (reversed) Intergenic
No off target data available for this crispr