ID: 1113529219

View in Genome Browser
Species Human (GRCh38)
Location 13:111008194-111008216
Sequence ACTGACATGGTTAAATTCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 596
Summary {0: 11, 1: 59, 2: 138, 3: 144, 4: 244}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113529219_1113529222 4 Left 1113529219 13:111008194-111008216 CCTGGGAATTTAACCATGTCAGT 0: 11
1: 59
2: 138
3: 144
4: 244
Right 1113529222 13:111008221-111008243 TCTTTTTTACATTATTAACTGGG No data
1113529219_1113529221 3 Left 1113529219 13:111008194-111008216 CCTGGGAATTTAACCATGTCAGT 0: 11
1: 59
2: 138
3: 144
4: 244
Right 1113529221 13:111008220-111008242 GTCTTTTTTACATTATTAACTGG 0: 3
1: 10
2: 7
3: 26
4: 391
1113529219_1113529223 13 Left 1113529219 13:111008194-111008216 CCTGGGAATTTAACCATGTCAGT 0: 11
1: 59
2: 138
3: 144
4: 244
Right 1113529223 13:111008230-111008252 CATTATTAACTGGGAAAAAATGG No data
1113529219_1113529224 14 Left 1113529219 13:111008194-111008216 CCTGGGAATTTAACCATGTCAGT 0: 11
1: 59
2: 138
3: 144
4: 244
Right 1113529224 13:111008231-111008253 ATTATTAACTGGGAAAAAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113529219 Original CRISPR ACTGACATGGTTAAATTCCC AGG (reversed) Intergenic
902598897 1:17527567-17527589 ATTGAGCAGGTTAAATTCCCTGG + Intergenic
903506462 1:23839077-23839099 ATTGACGTGGTTTAATTCCCAGG - Intergenic
904362801 1:29988814-29988836 ATTGACATGATTAAATTCCCAGG + Intergenic
904875151 1:33648915-33648937 ATTGACATGGTTAAATTACCAGG + Intronic
905472078 1:38200678-38200700 ATTGACATGGTCAAATTCCCAGG + Intergenic
906016182 1:42582334-42582356 AATGATATGGTTAAACTCCCAGG - Intronic
906364830 1:45198764-45198786 ATTGACATGGTTGAATTCCTAGG + Intronic
907369311 1:53990046-53990068 ATTGACATAGTTAAACTCCCAGG + Intergenic
907690714 1:56662680-56662702 ACTGACATGGTTAAACTCTGAGG - Intronic
908072703 1:60480806-60480828 ATTGACATGATTATATTTCCAGG - Intergenic
908167422 1:61472118-61472140 ACTGACATGGTTAAATTCCTGGG - Intergenic
909167100 1:72240997-72241019 ATTGACAGGATTAAAGTCCCAGG + Intronic
909198914 1:72663776-72663798 ATTGACATGGTTAAATTCTCAGG + Intergenic
909839382 1:80299839-80299861 ACTGGCATAGTTAAATCCCTAGG - Intergenic
911011554 1:93286582-93286604 ATTGACATGATTAAATTCTCAGG + Intergenic
911289558 1:96040479-96040501 ATTAACATGGTTAAATTCTTAGG + Intergenic
911468949 1:98292048-98292070 CTTGACATGATTAAATCCCCAGG + Intergenic
911940638 1:104042899-104042921 ACGGACATGGTTCCCTTCCCAGG + Intergenic
912407962 1:109457374-109457396 ATTGACATGGTTAAATTCCCAGG - Intergenic
913962058 1:143347674-143347696 ATTGATATGGTTAAATTCTCAGG + Intergenic
914056414 1:144173249-144173271 ATTGATATGGTTAAATTCTCAGG + Intergenic
914122732 1:144793113-144793135 ATTGATATGGTTAAATTCTCAGG - Intergenic
915652236 1:157323133-157323155 ACTGACATGATGAAAATCACTGG + Intergenic
915895480 1:159808423-159808445 ACTGCCATGGTTCAAGTCCAAGG + Exonic
915920799 1:159973797-159973819 ACTGCCATGGTTCAAGTCCAAGG - Intergenic
916455268 1:164964775-164964797 ATTGATGTGGTTAAATTCCTAGG + Intergenic
916653257 1:166850047-166850069 ACTGACATGGTGATCATCCCAGG + Exonic
916692462 1:167203866-167203888 GCTTTGATGGTTAAATTCCCAGG - Intergenic
917570989 1:176265452-176265474 AATCACATGGTTGGATTCCCTGG - Intergenic
919694519 1:200560703-200560725 ACTAACATTGCTAAATTACCTGG + Exonic
920707189 1:208261409-208261431 ATTGACATGGTTAAATTTCCAGG - Intergenic
921091114 1:211844432-211844454 ATTGACATGGTTAAGTTCCCAGG - Intergenic
921958187 1:221005878-221005900 AATGACATGGTTAAATTCCTAGG + Intergenic
922030856 1:221796308-221796330 ATTGATGTGATTAAATTCCCAGG - Intergenic
922527517 1:226317028-226317050 ACTGACATGGTTACGTTCCCAGG + Intergenic
922625680 1:227039217-227039239 ACTGACATGGTTACATTCTCAGG + Intronic
922671903 1:227515753-227515775 CTTGACATGGTTAAATTCCCAGG + Intergenic
923420093 1:233804942-233804964 ACTGACATTACTAAATTTCCAGG + Intergenic
923950064 1:238940274-238940296 ATTGACATAGTTAAATTCCCAGG + Intergenic
924244655 1:242072485-242072507 TTTGACATGGTTAAATTCCCAGG + Intergenic
924297935 1:242607620-242607642 ATTGACAGGCTTAAATTCCCAGG + Intergenic
924388140 1:243519841-243519863 ACTGATATAGGTAAATTACCAGG + Intronic
924821863 1:247500419-247500441 CTTGACATGGTTAAATTCCCAGG + Intergenic
1063342522 10:5280785-5280807 ATTGACATGATTAAATTACCAGG + Intergenic
1064129747 10:12698601-12698623 ACTGACATGGTTAAGTTCCCAGG - Intronic
1064739687 10:18420065-18420087 ACTGGCTGGGTTACATTCCCAGG - Intronic
1064786733 10:18906031-18906053 ATTGACATGGTTGAATTCCCAGG + Intergenic
1064812342 10:19214671-19214693 ATTGACATTGTTAAGTTCCCAGG - Intronic
1065755794 10:28929441-28929463 ATTGACATGGTTAAATTCCCAGG - Intergenic
1067240920 10:44492497-44492519 ATTGACATGGTTAAATTCCTAGG - Intergenic
1067421763 10:46158389-46158411 CCTGATATGGTGACATTCCCTGG - Intergenic
1067507069 10:46864478-46864500 CCTGATATGGTGACATTCCCTGG - Intergenic
1067755990 10:49005774-49005796 ACTGACATGGTTAAGCTCTTGGG + Intergenic
1068318937 10:55384080-55384102 ATTGACTTGTTTACATTCCCAGG + Intronic
1068421683 10:56802261-56802283 ATTGACATGGTTAAATTTCCAGG - Intergenic
1068464642 10:57373856-57373878 ATTGAGATGGTTAAATTCCTAGG + Intergenic
1068562676 10:58533358-58533380 ATTGACATGGCTAAGTTCCTAGG + Intronic
1068647534 10:59484865-59484887 ATTGACATGATTAAATTCCCAGG - Intergenic
1068920144 10:62474874-62474896 TCTGACATGCTTAATTTCTCTGG + Intronic
1070479019 10:76862948-76862970 ATTAATATGGTTAAATTCCCAGG + Intergenic
1070859242 10:79637531-79637553 CCTGATATGGTGACATTCCCTGG - Intergenic
1070931273 10:80262392-80262414 CTTGACATGGTTAAATTCCCAGG - Intergenic
1071480327 10:86060591-86060613 CCTGACATGGTTAAGTGACCCGG - Intronic
1071754137 10:88517054-88517076 GGTGACATGGTTAATTTCCCTGG + Intronic
1072949038 10:99836302-99836324 ACACACATGGGTAAATACCCAGG - Intronic
1073388432 10:103149074-103149096 ACTGACTTGTTCAAATTCTCAGG - Intronic
1074245791 10:111690889-111690911 ATTGACATAGTTAAATTCCCAGG - Intergenic
1074620435 10:115113849-115113871 ATTGACATGGTTAAATTCCTAGG + Intronic
1075296764 10:121284137-121284159 ACTTACATGATTAAACTGCCTGG + Intergenic
1075628874 10:123987532-123987554 ATTGACATAGTTAAATTCCCAGG + Intergenic
1076232117 10:128829253-128829275 ATTCACATGGTTAAATTCCCAGG + Intergenic
1078324916 11:10371864-10371886 ATTGACATGGCTAAGTTCCCAGG - Intronic
1078644324 11:13125845-13125867 ATTGACATGGTGAAATTCCCAGG + Intergenic
1078644639 11:13129171-13129193 ACTGACATGGCTAAATTTGCAGG - Intergenic
1078842709 11:15093357-15093379 ATTGACATGGTTAAATTCTCAGG - Intergenic
1079595014 11:22233509-22233531 ATTGACATGGTTAGATTCCCAGG - Intronic
1079769387 11:24439690-24439712 ATTAACATGTTTAAATTCCCAGG + Intergenic
1080364097 11:31550520-31550542 ACTGACATAGTTAAATTCCCAGG - Intronic
1080556769 11:33424521-33424543 ATTGACATGGTTAAATTCCTAGG + Intergenic
1080753408 11:35171750-35171772 ATTGATGTGATTAAATTCCCAGG - Intronic
1080816711 11:35764808-35764830 TCTGAAATGGTTAAAATGCCAGG - Intronic
1081009227 11:37787072-37787094 ATTGGCATGATTAAATTCCCAGG + Intergenic
1081091789 11:38878939-38878961 CAGGACATGGTTGAATTCCCAGG + Intergenic
1081240826 11:40704576-40704598 ACTAACAGGGTTAGTTTCCCGGG - Intronic
1081445289 11:43125339-43125361 GGTGACATGATTAAATTCCTAGG - Intergenic
1081466730 11:43326168-43326190 ATTGACATGGTTAAGTTCCCAGG + Intronic
1083085519 11:60139715-60139737 AGTGACATAGTTAAATTTCCAGG - Intergenic
1083131676 11:60630668-60630690 ACCGACATGGTTAAAATACCAGG - Intergenic
1083818917 11:65154955-65154977 GTTGACATGGTTAAATTCCCAGG + Intergenic
1086019823 11:82214158-82214180 ATCGACATGGTTAAATTCCCAGG + Intergenic
1086537176 11:87861870-87861892 ATTTATATGGTTATATTCCCAGG + Intergenic
1086864833 11:91968139-91968161 ATTGACCTGGTTACATTCCCAGG + Intergenic
1087121361 11:94577729-94577751 ACTGATGTGGTTAAATTCCCAGG - Intronic
1088187526 11:107188462-107188484 ATTGACATGGTTAAATTCCCAGG + Intergenic
1088840157 11:113620213-113620235 ATTAGCATGGTTAAATTCCCTGG + Intergenic
1089389918 11:118093938-118093960 AATGACATGGATGAATTCCATGG - Intronic
1090841802 11:130496561-130496583 ACTGATGTGGTTAAATTCTCAGG - Intergenic
1091177193 11:133571540-133571562 ATTGACATGATTAAATTCCCGGG - Intergenic
1091853026 12:3715820-3715842 ATTGACATGATTAAGTTCCCAGG - Intronic
1092710124 12:11327383-11327405 ATTAATATGGTGAAATTCCCAGG - Intergenic
1092713880 12:11367873-11367895 ATTTATATGGTGAAATTCCCAGG - Intronic
1092717593 12:11407054-11407076 ATTTATATGGTGAAATTCCCAGG - Intronic
1092937627 12:13378757-13378779 AGTGGTATGGTTAAGTTCCCTGG + Intronic
1093442024 12:19210094-19210116 ATTGACATGGTTAAATTCTTAGG + Intronic
1093738844 12:22657452-22657474 AATGACATTGTTACAGTCCCTGG - Intronic
1094129126 12:27055779-27055801 ATTGACATGGTTAAATTCCCAGG - Intronic
1094296362 12:28911151-28911173 ATTAACATGGTTAAATTCTCAGG + Intergenic
1094812686 12:34154650-34154672 CTTGACATGGTTAAATTCCCAGG - Intergenic
1095318982 12:40802503-40802525 ACTGGCACGATTAAATTCCCAGG - Intronic
1095357821 12:41297031-41297053 ACTGATGTGGTTGAATTCCCAGG + Intronic
1095390333 12:41698377-41698399 AGTGCCATAATTAAATTCCCAGG + Intergenic
1095495469 12:42779489-42779511 AGTGACTTGCTTTAATTCCCTGG + Intergenic
1095578287 12:43764532-43764554 ATTGATGTGGTTAAATTCCCAGG - Intronic
1097412679 12:59274368-59274390 ATTGACATGGGCAAATTCCTAGG - Intergenic
1097538428 12:60903452-60903474 ATTGACATGGTTAAACTTCCAGG + Intergenic
1097547170 12:61018368-61018390 ATTTACATGGTTAAATTCTTAGG - Intergenic
1097674364 12:62582595-62582617 ATTGACATGGTTAAATTCCCAGG + Intronic
1098305870 12:69102101-69102123 ATAGACATGGTTAAGTTCCCAGG + Intergenic
1098466561 12:70793837-70793859 ATTGACATAGTTAAATTCCCAGG + Intronic
1098547203 12:71724872-71724894 ATCAACATGGTTAAATTCCCAGG - Intergenic
1098965627 12:76785218-76785240 ATTAACTTGGTTAAATTGCCAGG + Intronic
1099541636 12:83916967-83916989 ATTACCATGGTTAAATTTCCAGG - Intergenic
1099765557 12:86978618-86978640 ATTGACATGGTTAAATTTTCAGG - Intergenic
1099839923 12:87952700-87952722 GCTGACATGGATAAATTGTCAGG - Intergenic
1099939755 12:89172017-89172039 CTTGACATGGTTAAATCTCCAGG - Intergenic
1100027550 12:90148405-90148427 AAAGACATTGTTAAAGTCCCCGG + Intergenic
1100184117 12:92119859-92119881 ATTCACATGATTAAATTCCCAGG + Intronic
1100282747 12:93133909-93133931 ATTGATATGGTTAAATTCCCAGG + Intergenic
1100693839 12:97068460-97068482 ATTGACAAGGTTAAATTCCCAGG - Intergenic
1100787177 12:98090578-98090600 ACTGACATGACTAAATTCCAAGG - Intergenic
1102387628 12:112523389-112523411 ATTGACAGGGTTCAATTCCCAGG + Intergenic
1102669434 12:114604817-114604839 AGCCACATGGCTAAATTCCCTGG - Intergenic
1103254809 12:119531976-119531998 ACTCAAAAGGTCAAATTCCCAGG + Intronic
1104279496 12:127361746-127361768 ATTGACATGGTAACATTTCCAGG - Intergenic
1105354939 13:19651733-19651755 AATGACATGGGAAAATTCCTTGG + Intronic
1105911849 13:24876120-24876142 ATTGACATGGTTATATTCCCAGG + Intronic
1106341507 13:28832969-28832991 AATGAAATGGGTAAATTCCCAGG + Intronic
1106677431 13:31975902-31975924 ATTAACATGGTCAAATTCCCCGG + Intergenic
1106697187 13:32188282-32188304 ATTGACATGGTTAAGTTTCCAGG - Intronic
1106935948 13:34720104-34720126 ATTTATATGGTTAAATTCCCAGG - Intergenic
1107118260 13:36770353-36770375 ATTGACATGGTTAAATCCCCAGG - Intergenic
1107144159 13:37039772-37039794 ATTGATATGGTTCAGTTCCCAGG + Intronic
1107251553 13:38369593-38369615 ATTGACATGGCTACATTTCCAGG - Intergenic
1107526563 13:41238230-41238252 TCTGACACAGTTAGATTCCCAGG - Intronic
1108206756 13:48097860-48097882 ATTGACACGGTTAAATTCCAAGG - Intergenic
1108215850 13:48183667-48183689 ATTGATATGGGTAAATTCCCAGG + Intergenic
1108278718 13:48839682-48839704 AATGACATGGTTGGTTTCCCTGG - Intergenic
1108367325 13:49729005-49729027 GCTGACATGGTTAAATTCCCAGG + Intronic
1108586202 13:51871948-51871970 CCTGAGCTGGTCAAATTCCCTGG - Intergenic
1108774934 13:53754212-53754234 ATTGACATGGTTAAATTCTTAGG - Intergenic
1108957385 13:56177277-56177299 ATTGGCATAGTTTAATTCCCAGG + Intergenic
1109136790 13:58661804-58661826 ATTAAGATGGTTAAATTCCCAGG - Intergenic
1109525522 13:63569383-63569405 ACTGGCATGGGTAATTTTCCAGG - Intergenic
1109535337 13:63710372-63710394 ATTGACATGGCCAAATTCCCAGG - Intergenic
1110138190 13:72094971-72094993 ACTGACATGTTTTAATTACATGG + Intergenic
1110532183 13:76610312-76610334 ACTGAAATCTTAAAATTCCCTGG + Intergenic
1111176016 13:84597315-84597337 ATTTACATGGTTAAATTCCAAGG + Intergenic
1111336429 13:86830691-86830713 ATTGAAATGGTTACATTTCCAGG + Intergenic
1111936995 13:94568043-94568065 ATTGACATGGTTAGATTTACAGG - Intergenic
1112949963 13:104981785-104981807 ATTGACATGGTTAAATTCTCAGG - Intergenic
1113184033 13:107665908-107665930 ATTGATATGGTTAAATTCCCAGG - Intronic
1113529219 13:111008194-111008216 ACTGACATGGTTAAATTCCCAGG - Intergenic
1114357373 14:21926175-21926197 ATTGACATAATTAAATTCCCAGG + Intergenic
1114581687 14:23766482-23766504 ATTGACATGGTTAAATTCCCAGG + Intergenic
1114753919 14:25237026-25237048 ATTGCCATGGCTAAATTCTCAGG + Intergenic
1114819420 14:25999362-25999384 ATTGATCTGGTTAAATTCCCAGG + Intergenic
1114963449 14:27924243-27924265 ATTGACATGACTAAATTCCCAGG + Intergenic
1114992751 14:28308534-28308556 ATTGAAATGGTTAAATTCCCAGG - Intergenic
1115173894 14:30540028-30540050 ATTGATATGGTTACATTTCCAGG - Intergenic
1115823074 14:37233523-37233545 ACTGACATGGTTAAATTCCTAGG - Intronic
1116116100 14:40653028-40653050 TATGAGTTGGTTAAATTCCCAGG - Intergenic
1116168466 14:41365390-41365412 ATTGACAGGGTTAAATTCCCAGG + Intergenic
1116426930 14:44801959-44801981 ATTGACGTGGTTAAATTCCTAGG + Intergenic
1116877980 14:50133044-50133066 AATGATATGGTTAAATTCCCAGG + Intronic
1117031195 14:51672522-51672544 ATTGACATGGTTAAATTCCCAGG + Intronic
1117223147 14:53627576-53627598 ATTGACATGATTAAATTCTCAGG + Intergenic
1117386055 14:55214169-55214191 ATTGACATGGATAAACTGCCAGG + Intergenic
1117467832 14:56011566-56011588 ATTGACATGGTTAAATGCCCAGG + Intergenic
1117689142 14:58287393-58287415 ATTGACATAGCTAAATTCCCAGG - Intronic
1117933803 14:60878304-60878326 GCTGACATAGTTAAATTCCTAGG - Intronic
1118467844 14:66047051-66047073 ATTGACATGGTTAAGTTTCTGGG - Intergenic
1118830725 14:69429143-69429165 ATTGACATGGTTAAATTTCCAGG + Intronic
1119965384 14:78909679-78909701 ATTGATATGGTTAAATTCCCAGG + Intronic
1120296874 14:82652604-82652626 ACTGAAATGGATAAATAGCCAGG + Intergenic
1120345602 14:83285688-83285710 ATTTACATGGTTAAATTCCCAGG + Intergenic
1120511526 14:85421555-85421577 ACTGACATGGTTAAGGCCCAAGG - Intergenic
1120944920 14:89985726-89985748 ACTGACCTTAATAAATTCCCTGG + Intronic
1121180957 14:91928314-91928336 ACAGAAAAGTTTAAATTCCCTGG - Intronic
1121256853 14:92537296-92537318 ACTGACATGGAAAGATTCCTAGG - Intronic
1122253966 14:100463300-100463322 ACTGAGATTGTCAAATCCCCAGG + Intronic
1127746456 15:61980701-61980723 AATGACATGATTAAATTCCCAGG + Intronic
1128285544 15:66433789-66433811 ACTGACATGCTTCACCTCCCGGG + Intronic
1128510223 15:68309561-68309583 ATTGACATGGTTACATTCCCAGG - Intronic
1129086388 15:73097161-73097183 ACTGAGATGGCTAAATTCTTAGG + Intronic
1129223218 15:74147024-74147046 ATCGACATGGTTAAATTCCCAGG + Intergenic
1129550551 15:76444286-76444308 ACTGACATGGTTAAATTCCCAGG + Intronic
1129627502 15:77217681-77217703 ATTGATGTGGTTAAATCCCCAGG + Intronic
1130127835 15:81108846-81108868 ATTGACATGGTTAAATTCCCAGG - Intronic
1130860403 15:87881127-87881149 ACTGACAAGGATAAACACCCAGG + Intronic
1131618768 15:94044896-94044918 ATTGACATGGTTAAATTCCCAGG - Intergenic
1131765982 15:95676522-95676544 ACTGACATGGTTAATTTGCCTGG - Intergenic
1131954642 15:97719897-97719919 CTTGACATGGTTGAATTCCTTGG - Intergenic
1133722052 16:8503717-8503739 ATTGAGATGGTTGAATTCCCAGG - Intergenic
1135140715 16:19919164-19919186 TCTCAGATGGTTAAATTCCTAGG + Intergenic
1136017784 16:27415805-27415827 ATTGACATGGCTATATTCCCAGG + Intronic
1136023957 16:27458069-27458091 ATTGCCATGGTAAAATTCCCAGG - Intergenic
1137459115 16:48642219-48642241 ATTGACATGGTTCAATTCCTAGG + Intergenic
1137903891 16:52299346-52299368 ACTGATGCGGTTAAATTCACAGG + Intergenic
1137955902 16:52828707-52828729 ACTGACATAATTCAATTGCCAGG - Intergenic
1138326971 16:56182092-56182114 CAGGACATGGTTAAATTCCTTGG + Intergenic
1138614063 16:58150528-58150550 ATTGGCATGGTTAAATTCTCAGG + Intergenic
1138771647 16:59671724-59671746 TTTGACATGGTTAAATTTCCAGG + Intergenic
1139238804 16:65369240-65369262 ATTGAGGTGGTTAAATTCCCAGG + Intergenic
1139247047 16:65455217-65455239 ACTGAGATGGTTTAATTTCATGG - Intergenic
1141914408 16:87085085-87085107 ACTGATGTGTTTAAATTTCCAGG + Intronic
1141945669 16:87307889-87307911 ATTGATGTGGTTAAATTCCCAGG - Intronic
1144326633 17:14188580-14188602 TTTGACATGGTTAAATTCCCAGG - Intronic
1144475512 17:15585444-15585466 TTTGACATGGTTAAATTCCCAGG - Intronic
1145122164 17:20269712-20269734 ACGGACATGTTTAATTCCCCTGG - Intronic
1146102298 17:29994888-29994910 ATTGAAATGGTTAAATTCCCAGG - Intronic
1146210630 17:30939918-30939940 ATTGGCATGGTTAAATTCCCAGG - Intronic
1148598857 17:48878900-48878922 GCTGACTTGGTTGGATTCCCTGG + Intergenic
1149195360 17:54113218-54113240 GTTGACATGGTTAAATTATCAGG + Intergenic
1149307185 17:55359439-55359461 ACTGACATGGTTAAATTCCCAGG - Intergenic
1149617666 17:58014987-58015009 ATTGACATGGTTAAATTCCCAGG + Intergenic
1149956992 17:61062761-61062783 ATTGACATAATTAAATTCCCAGG - Intronic
1150191360 17:63243898-63243920 ATTGACATGGTTAAATTCCCAGG - Intronic
1150504185 17:65681443-65681465 TCTGACATGCTTAAAGTCCTAGG + Intronic
1150742744 17:67792622-67792644 ATTGACATGGTTAAATTCCCAGG + Intergenic
1150891977 17:69162693-69162715 AATGACAAGGTTAAATTCCCAGG + Intronic
1151015997 17:70553491-70553513 ATTGACATGGTTAAATTCCAAGG - Intergenic
1153438742 18:5093714-5093736 ATTGACAAGGTTAAATTCCCAGG - Intergenic
1154200840 18:12299276-12299298 ATTGGCATCGTTAAATTCTCAGG + Intergenic
1155266224 18:24096912-24096934 ACTGACATGGTTAAATTCCCAGG - Intronic
1155411775 18:25554142-25554164 ACTGACATGGTGTGATTTCCAGG + Intergenic
1155918186 18:31576575-31576597 AATGACATGGTTTACTTCTCTGG + Intergenic
1156255309 18:35389864-35389886 ATTGACATGGTTAAATTCCCAGG + Intergenic
1156592358 18:38505388-38505410 ATTGACATGGTTAAATTCTCAGG - Intergenic
1156888364 18:42161820-42161842 ATTGGCCTGGTTAAATTCCCAGG - Intergenic
1157015716 18:43710444-43710466 ATTGAAATGGTTACATTTCCAGG - Intergenic
1157359650 18:46965233-46965255 ATGGAAATAGTTAAATTCCCAGG - Intronic
1157361243 18:47024752-47024774 ATGGAAATAGTTAAATTCCCAGG - Intronic
1157362233 18:47030667-47030689 ATGGAAATAGTTAAATTCCCAGG - Intronic
1157752522 18:50192778-50192800 ATTGACATGGTTAAATTCCCAGG + Intronic
1157768482 18:50323902-50323924 ATGGACATGGTTAAATTCCCAGG + Intergenic
1158270078 18:55703360-55703382 ATTGACATAATTAAATTCCCAGG + Intergenic
1160305164 18:77726505-77726527 ATTGACATGGTTAAATTCCCAGG + Intergenic
1163096207 19:15059156-15059178 ACTGCCATGGCTAGATTCCTGGG - Intergenic
1164428001 19:28160645-28160667 ACTGACATGATTAAATTTCCAGG - Intergenic
1166116481 19:40658585-40658607 ACTGACATGATTAAATTCCTGGG - Intergenic
1167818233 19:51903344-51903366 AATGACATGGTTAGTTGCCCTGG + Intronic
1168504481 19:56921727-56921749 AATCACATGGTTGATTTCCCCGG - Intergenic
1168565983 19:57424144-57424166 ATAGACAAGGTTAAATTCCCAGG - Intronic
1202695894 1_KI270712v1_random:125926-125948 ATTGATATGGTTAAATTCTCAGG + Intergenic
925212445 2:2061501-2061523 CCTGACATTGACAAATTCCCTGG - Intronic
926962544 2:18374324-18374346 ATTGGCATGGTTAAATTCCCAGG + Intergenic
927120922 2:19962034-19962056 ATTGACATGGTTAAATTCCCAGG + Intronic
927338287 2:21950857-21950879 AATTACAGGGTTAAATTGCCAGG - Intergenic
927343200 2:22006275-22006297 ATTGACAAGGTTAAATTCCCAGG - Intergenic
928972353 2:37043673-37043695 ATTGACATGGTTAAATTCCCAGG + Intronic
929065356 2:37967866-37967888 ATTGATATGGTTCAATTCCCAGG + Intronic
929360696 2:41086093-41086115 ATTGACATGGTTAAACTCCCAGG + Intergenic
929421978 2:41800526-41800548 ATTGACATGGTTAAATCTCTGGG + Intergenic
929816144 2:45233322-45233344 ATTGGCATGGTTAAACTCCTGGG - Intergenic
930531546 2:52594919-52594941 ACTACCATGGCTAATTTCCCAGG + Intergenic
932073191 2:68641727-68641749 ATTGACATGGTTAAGTTCCCAGG + Intergenic
932095341 2:68842626-68842648 AATGACATGGTTAAGTTCCCAGG - Intergenic
932532909 2:72556469-72556491 GTTGACATGGTTAAATTTCTAGG + Intronic
933484319 2:82898073-82898095 ATTGAAATGCTTAGATTCCCTGG - Intergenic
933643542 2:84789928-84789950 ATTGACATGGTTAAACTCCCAGG + Intronic
933942682 2:87258020-87258042 ATTGATATGGTTAAATTCTCAGG + Intergenic
934277058 2:91582971-91582993 ATTGATATGGTTAAATTCTCAGG + Intergenic
935281705 2:101523357-101523379 ATTGACATGGTTAAATTCCCAGG - Intergenic
935286964 2:101573504-101573526 GTTGACATGGTTCAATCCCCAGG + Intergenic
935473273 2:103485419-103485441 ATTGACATGCTTAAATTCCCAGG + Intergenic
935801842 2:106705443-106705465 ATTGACATGGTTAAATTCCCAGG - Intergenic
935923807 2:108044762-108044784 ACAGACATGGTTAAATTTCCAGG - Intergenic
937820182 2:126301828-126301850 ACTGACATGGTTAAATTCCTAGG + Intergenic
937861237 2:126712212-126712234 ATTGACATGGTTAAATTCCAAGG + Intergenic
938111626 2:128571119-128571141 ACTGATATGGTTAAATTCCTAGG - Intergenic
939088629 2:137752333-137752355 ATTGACATGGTTAAATTCCCAGG - Intergenic
939291163 2:140196698-140196720 GTTGACATGATTAAATTCCCAGG - Intergenic
940369288 2:152882163-152882185 AGTGACATGGTTAAATTCTCAGG - Intergenic
940555149 2:155216190-155216212 ACGGACATGGTGAAACTACCTGG + Intergenic
941004564 2:160234857-160234879 ATTGGCATGTTTAAGTTCCCAGG + Intronic
941318437 2:164024380-164024402 ATTGGCATGGTTAAAGCCCCAGG - Intergenic
941347261 2:164385958-164385980 ACTGATTTGGTGACATTCCCTGG + Intergenic
941619987 2:167766528-167766550 ATTGGCATGGTTAAATTCCCAGG - Intergenic
941964944 2:171291687-171291709 CTTGACGTGGTTACATTCCCAGG + Intergenic
942844301 2:180404374-180404396 ATTGACCTGGTTAAATTCGTAGG + Intergenic
943249726 2:185503366-185503388 ATTTACATGGTTAAATTTCTAGG - Intergenic
943357477 2:186875179-186875201 ATCGATATGGTTAAATTCCCAGG - Intergenic
943633148 2:190276860-190276882 ATTTGCATAGTTAAATTCCCAGG + Intronic
943914555 2:193613225-193613247 ATAGACAAGGTTAAATTTCCAGG - Intergenic
943928841 2:193823179-193823201 ATTGACATTATTAAATTCCTAGG - Intergenic
943996504 2:194772987-194773009 ATTTACTTGGTTAAATTCGCAGG + Intergenic
944382155 2:199123614-199123636 ATTGACGTGGTTAAATTCCCAGG - Intergenic
945144267 2:206720388-206720410 ACTGACATGGTTAAATTCTCAGG + Intergenic
945602216 2:211882260-211882282 ATTGACATGGTTAAGTTCCCAGG + Intronic
945637666 2:212376702-212376724 ATTGACATTCTTAAATTCCTAGG + Intronic
945841605 2:214893666-214893688 ACTGACATGGTTAAATTCCCAGG - Intergenic
945906272 2:215596959-215596981 ATTGACACGGTGAAATTCCCAGG + Intergenic
946151523 2:217775908-217775930 ATTGACATGGTTAAATTTCCAGG - Intergenic
946324321 2:218976570-218976592 AATGACTTGGTTGAAGTCCCAGG - Intergenic
946933392 2:224694334-224694356 AATGACATATTTAAAATCCCAGG + Intergenic
947279114 2:228428461-228428483 ACTCATATGGATAAAATCCCAGG + Intergenic
948594497 2:239070892-239070914 ATTGACATGGTTAGATTCCCAGG - Intronic
1168744282 20:223715-223737 ACTGATGTGGTTAAATTCCCAGG + Intergenic
1168920461 20:1530743-1530765 TGGGACATGGTTAAATTACCTGG + Intergenic
1169033971 20:2434698-2434720 GTTGACATGGTTAAATCCCCTGG + Intergenic
1169813703 20:9634343-9634365 ACCCACAGGGATAAATTCCCTGG + Intronic
1171193235 20:23176543-23176565 ATTAACGTGGTTAAATTCCCAGG + Intergenic
1173061724 20:39668554-39668576 ACTAACAAGATTAAAATCCCAGG - Intergenic
1173677294 20:44847180-44847202 ATTGACATGGCTAAATCCCCAGG + Intergenic
1174354435 20:49988622-49988644 TCAGACATTGTTAAATTGCCCGG - Exonic
1175282962 20:57816936-57816958 ATTGACATGGCTAAATTCCCAGG - Intergenic
1175589301 20:60174935-60174957 ACTGACATGGTTCAATTCCCAGG - Intergenic
1176055366 20:63142875-63142897 ATTGAGATGGTTAAATTCCCAGG - Intergenic
1176312474 21:5159944-5159966 GTTGACATGGCTAAATTCTCAGG - Intergenic
1177685122 21:24426140-24426162 ATTGACATGGTTAAATTCCAAGG - Intergenic
1178145157 21:29730972-29730994 ATTGACATGGTTAAATTCCCAGG - Intronic
1178789474 21:35686733-35686755 ATAAACATGGATAAATTCCCAGG + Intronic
1179263582 21:39781274-39781296 ACTGACATGGATTGATTTCCAGG - Intronic
1179844574 21:44102086-44102108 GTTGACATGGCTAAATTCTCAGG + Intronic
1183768389 22:39900737-39900759 ACTCACAATGTTAAAATCCCAGG - Intergenic
949434521 3:4013845-4013867 ATAGACATGGTTAACTTACCAGG - Intronic
952366463 3:32679071-32679093 ATTGACATGGTTAAATCCCCAGG + Intergenic
952844380 3:37674787-37674809 ACTGATGTGGTTCAAGTCCCAGG - Intronic
953224574 3:41005608-41005630 ATTGCCATGGTTAAATTCCCAGG + Intergenic
955431638 3:58851697-58851719 ATCGACGTGGTTATATTCCCAGG - Intronic
956091211 3:65668884-65668906 ATTGACATGGTTAAATTCCCAGG - Intronic
957626727 3:82662022-82662044 ATTGACATAGTTAAATTTCCAGG - Intergenic
957762883 3:84582390-84582412 ATTGACATGGTTAAGTTCCCAGG + Intergenic
958790730 3:98648110-98648132 ACCTGCATGGTTAAATTCCCAGG - Intergenic
959007140 3:101032798-101032820 ATTGTCTTGGTTTAATTCCCAGG + Intergenic
959217535 3:103471376-103471398 ATTGACATTGTTAAATTTCCAGG - Intergenic
959451293 3:106506309-106506331 ATTTACATAGTTAAGTTCCCAGG - Intergenic
959669568 3:108960871-108960893 ATTGACATGGTTAAATTCCAAGG + Intronic
959739335 3:109697998-109698020 ATTGACACGGTTAAATTCCCAGG - Intergenic
960097777 3:113704249-113704271 ATTGTCATGGTTAAATTCCCAGG - Intergenic
961121025 3:124370166-124370188 ATTGACCTGGTTAAATTCCCAGG - Intronic
961421488 3:126808609-126808631 ATTGACATGGTTAAATTCCCAGG - Intronic
961928993 3:130513980-130514002 ACTGACATGGTTAAATTCCCAGG + Intergenic
962207618 3:133447847-133447869 ACTGACATTTTTAAGTGCCCAGG - Intronic
963582197 3:147139798-147139820 ACTTAAATAGTTAAATTCCTAGG - Intergenic
964257180 3:154789022-154789044 ATTGACATGGTTAAATTCCCAGG + Intergenic
964494323 3:157271982-157272004 ATCAACATGGTTAAATTCCCAGG - Intronic
964602972 3:158523587-158523609 ATTAACATAGTTAAATTCCTAGG - Intronic
964629141 3:158790653-158790675 ACTGATATGGTGAAATTCTCAGG + Intronic
964954808 3:162340233-162340255 ATTAACATGGATAAATTCCCAGG - Intergenic
965813130 3:172612356-172612378 AGTGACATGGTTAAATTCTCAGG - Intergenic
965991758 3:174827567-174827589 ACTGAGATGGAGAAATTACCTGG - Intronic
967014657 3:185470925-185470947 ATTGACATGGATACATTTCCAGG - Intronic
967581218 3:191157262-191157284 ATTGACATGGTGACCTTCCCAGG - Intergenic
969211294 4:5689472-5689494 ACTGAGACTGATAAATTCCCAGG - Intronic
969389843 4:6884251-6884273 ACTGACAAGGTGAAATTTCCAGG - Intergenic
969683936 4:8658740-8658762 ACTGACATCCTTAAATTCATGGG + Intergenic
970481028 4:16474795-16474817 ATTGACATGGTTAAATTCCCAGG + Intergenic
971327685 4:25657395-25657417 ACTGAGATGAATAAATTCCCTGG - Intronic
971860231 4:32092447-32092469 ATTGACATGGTTAAATTCTCAGG - Intergenic
971878143 4:32330668-32330690 ATTGATGTGGTTAAATTCCCAGG + Intergenic
972313689 4:37905353-37905375 ATAAACATGGTTAAATTCCCAGG - Intronic
972448275 4:39168386-39168408 ATTGACTTGGTTAAATTTCCAGG + Intergenic
972734457 4:41827092-41827114 ACTGACATGGTTAAATTCCCAGG - Intergenic
973979758 4:56298237-56298259 ACTGTCATGGGAAAATGCCCGGG - Exonic
974272381 4:59667203-59667225 TCTGACATGGTCAAGTTTCCAGG - Intergenic
974866921 4:67592427-67592449 ACTAAAATGCTTAAATTCTCTGG + Intronic
974886797 4:67829194-67829216 ATTGACATAGTTAAATTCTCAGG + Intronic
975103026 4:70535844-70535866 ATTGACATGATTAAATTCCCAGG - Intergenic
975127162 4:70795746-70795768 ATTGATATGATTAAATTCCTAGG - Intronic
975397716 4:73896401-73896423 ACGGACATTGTAAAATTCTCAGG + Intergenic
976283623 4:83349460-83349482 ATTGACATGGTTACATTCCCAGG + Intergenic
976586019 4:86798036-86798058 ATTGATATGGTTAAATTTGCAGG - Intronic
976674028 4:87684720-87684742 AATGACATTGTTAAATTCAATGG + Intergenic
976836324 4:89378675-89378697 ATCAACATGGTTAAAGTCCCAGG + Intergenic
976841892 4:89441510-89441532 AGTCACATGCTTAAATTCCCAGG - Intergenic
977156841 4:93584730-93584752 ATAAACATAGTTAAATTCCCAGG - Intronic
977483702 4:97614224-97614246 AATGACATGGTTAAATTCACAGG - Intronic
977733005 4:100378149-100378171 ATTGACATGGGTAAAATCCCTGG + Intergenic
978332538 4:107630068-107630090 ATTGACATGGTTAAATTCCCAGG + Intronic
979359849 4:119748728-119748750 ATTGACATGGTTAAATTCCCAGG - Intergenic
979643863 4:123043603-123043625 ACTGATATGATTAATTTCCCAGG - Intronic
980590612 4:134883048-134883070 TATTGCATGGTTAAATTCCCAGG + Intergenic
980651619 4:135724413-135724435 ATTAACATTGTTAAATTCCCAGG - Intergenic
982381876 4:154757654-154757676 TTTACCATGGTTAAATTCCCTGG - Intergenic
983167094 4:164491082-164491104 ATTGACATGGTGAAATTACCAGG - Intergenic
983277291 4:165633897-165633919 ATTGACATGGTTAAATTCCCAGG - Intergenic
983813966 4:172099446-172099468 ATTGACATGGTTAAATTCCCAGG - Intronic
984061726 4:174996906-174996928 CTTGACATGGTTAAAATCTCAGG - Intergenic
984421490 4:179528083-179528105 ATTGACATGGCTACATTCCCAGG - Intergenic
984956149 4:185047702-185047724 ACTGAGATTGTTAAATTACGTGG - Intergenic
985597738 5:804692-804714 GGTGACATAGTTAAATGCCCTGG + Intronic
985945009 5:3174742-3174764 ATTGCCAGGGTTAAATTCCCAGG + Intergenic
987109804 5:14674875-14674897 ATTCACATTGTTAAATTCCCAGG - Intronic
987895967 5:23947044-23947066 ATTGACATGATTAAATTCCCAGG + Intergenic
988316770 5:29641337-29641359 ATTTACATGTTTAAATTCCCAGG - Intergenic
988556913 5:32244954-32244976 AATGACATGGTTAAATTCCCAGG - Intronic
988608923 5:32706812-32706834 ATTGACATGCTTAAGTTTCCAGG + Intronic
988629013 5:32909476-32909498 ACTGACATTCTTTAATGCCCTGG - Intergenic
988828330 5:34962956-34962978 ATTGACATGGTTAAATTCCCAGG - Intergenic
989471732 5:41827375-41827397 ACTGACATAGATAAATTTCCTGG - Intronic
989786779 5:45342043-45342065 GTTGACATGGTTAAATTCCCAGG + Intronic
989975223 5:50577741-50577763 ATTAACATTTTTAAATTCCCAGG - Intergenic
990590617 5:57259554-57259576 ACTGACACGGTTAAACTGCCAGG - Intronic
990659044 5:57992159-57992181 ACTGACATGGTTAAATTCCCAGG - Intergenic
990709952 5:58569440-58569462 ATTAACATGGTTAGATTTCCAGG + Intergenic
991999537 5:72422091-72422113 ATTGACATGGTTACATTTCCAGG - Intergenic
992475092 5:77094247-77094269 ATTGACATGGCTAAATTCCCAGG - Intergenic
993221736 5:85107283-85107305 ATTTACATCGTTAAATTTCCAGG + Intergenic
993625236 5:90216167-90216189 ATTTACATGGTTAAATTCCTTGG - Intergenic
993922502 5:93824586-93824608 ATTGACATGGTTAAATTACCAGG - Intronic
994384840 5:99119092-99119114 ATTGACATGTTTAAATTCCCAGG + Intergenic
994435407 5:99724137-99724159 ATTAACATGCTTAAGTTCCCAGG + Intergenic
994703373 5:103166506-103166528 ATTGACGTGGGTAAATTCCCAGG + Intronic
994940215 5:106313967-106313989 GTTGACATGGTTAGAGTCCCGGG - Intergenic
995235830 5:109829154-109829176 AATGACATGGTTAAATTTCCAGG - Intronic
995415167 5:111902923-111902945 TTTGATATGGTTAAATTCCTAGG + Intronic
995577858 5:113560254-113560276 ATTGACATGATGACATTCCCTGG + Intronic
995909510 5:117168660-117168682 ACTGATATGTTTAAAATCCTGGG + Intergenic
996000555 5:118356867-118356889 ACTGACATCTTGAAGTTCCCAGG - Intergenic
996020442 5:118585735-118585757 ATTGACATGCTTAGATTCCCAGG - Intergenic
996362280 5:122662933-122662955 TTTGACATGATTAAATTCCAAGG + Intergenic
996832996 5:127760237-127760259 ATTAAAATGGTTAAATCCCCAGG - Intergenic
996904647 5:128584319-128584341 TCTGTCCTGGTTTAATTCCCAGG + Intronic
997276085 5:132592308-132592330 ACTGACATGGTTAAATTCCCAGG - Intronic
998278010 5:140776846-140776868 ATTGACATGGTTAAATTCTTAGG - Intergenic
998346103 5:141465297-141465319 ATTGACATGGCTAAATTCCCAGG - Intronic
998720066 5:144934887-144934909 AAAGACATGGATAAATTCCTAGG + Intergenic
998796342 5:145823616-145823638 ACAGGCCTGGTTTAATTCCCTGG - Intronic
998835598 5:146200259-146200281 ATTGACATGGCTAAATTCCCAGG + Intergenic
998928391 5:147153369-147153391 ATTGACATGATTAAATTCCCAGG + Intergenic
999074143 5:148779128-148779150 ACTGTCATGGCTCAATTGCCAGG - Intergenic
1000490093 5:161902060-161902082 ATTTACATGGTTATATTCCCAGG - Intergenic
1001138633 5:169124158-169124180 ATTGATATGGTTAAATTCCCAGG + Intronic
1003192574 6:3887492-3887514 ACTTACATGTTTTATTTCCCTGG - Intergenic
1003225077 6:4196915-4196937 ATTGACATGGTTAAATTCCCAGG + Intergenic
1004225562 6:13781415-13781437 ATTGATATGGTTAAGTTCCCAGG + Intergenic
1006529978 6:34643574-34643596 ATTTACATGGTTAAATTCTTAGG + Intronic
1007889131 6:45270244-45270266 ACTGACATGGCTAAATTCCCAGG - Intronic
1009503328 6:64444234-64444256 ATTGACATGGGTAAGGTCCCAGG + Intronic
1009961724 6:70530907-70530929 ACTGACATGACTAAATTCCCAGG - Intronic
1010099473 6:72087271-72087293 ATTGGCATGGTAAAATCCCCAGG - Intronic
1010653952 6:78489620-78489642 GCTGACATGTTTACATTACCAGG + Intergenic
1010661687 6:78578768-78578790 ACTGGAATTGTTATATTCCCTGG + Intergenic
1010706874 6:79125028-79125050 ATTGGCATGGTTAAATTTCCAGG + Intergenic
1010907626 6:81511254-81511276 ATTGACACGGTTAAATTCCAAGG - Intronic
1011533186 6:88347315-88347337 ATTGACATGGTTAAATTCCCAGG - Intergenic
1011621745 6:89250104-89250126 ACATCCATGGTTAAATTCTCTGG + Intergenic
1012028012 6:94022892-94022914 ATTGATATGGTTAAACTCCCAGG - Intergenic
1012216181 6:96587399-96587421 ATTTACATGGTTAAATTCCCAGG + Intronic
1012943716 6:105443788-105443810 ATTGACATGGTTAAATTCCCAGG - Intergenic
1013392034 6:109695231-109695253 ACCAATATGGTTAAATTCCCAGG - Intronic
1013460529 6:110371052-110371074 CTTGACATGGGTAAATTCCCAGG + Intergenic
1013468772 6:110441891-110441913 ATTGACATGGGTACATTCTCAGG + Intronic
1013540947 6:111108429-111108451 ATTGACATGATTAAATTCCTGGG + Intronic
1013897298 6:115104464-115104486 ATCGACATGGTTAAGTTCTCAGG + Intergenic
1014722817 6:124938856-124938878 AGTTACATGGATAAATTCCTTGG + Intergenic
1015249614 6:131113330-131113352 ATTGACATAGTTAAATTCTCAGG - Intergenic
1015900555 6:138061196-138061218 CTTGACATGGTTAAATTCCTAGG + Intergenic
1016117788 6:140309638-140309660 ATTGACATGATGAAATTCTCAGG + Intergenic
1016148976 6:140714722-140714744 ATTGACATGGTTAAATTCCCAGG - Intergenic
1016218484 6:141634022-141634044 AATGACATGGCTAAATTCCCAGG - Intergenic
1016301995 6:142643032-142643054 ATTGACATGAGTAAATTCCCAGG + Intergenic
1016445379 6:144126566-144126588 AATTACAAGGTTATATTCCCAGG - Intergenic
1016787710 6:148030947-148030969 GCTGACATGGTTAAATTCCCAGG + Intergenic
1017299433 6:152838806-152838828 ATTGATGTGGTTAAATTCCCAGG - Intergenic
1017313136 6:152997928-152997950 ATTGACATGGTTAAATTCCCAGG + Intronic
1017344056 6:153358602-153358624 ATTGACATGGTGAAATTCCCAGG + Intergenic
1017838019 6:158197879-158197901 AAAGACATGGTTAATTTCCCAGG + Exonic
1018487896 6:164260778-164260800 ATTGGAATGGTTAAATTCCCAGG + Intergenic
1019796379 7:3052319-3052341 ATTGACATGATGAAATTCCAAGG - Intergenic
1019818609 7:3220901-3220923 ATTGACATGGGTAAATTCCCAGG + Intergenic
1020527626 7:9282623-9282645 ACACACATGTTTAAATTCCATGG + Intergenic
1020845638 7:13278535-13278557 ATTGACATGGTTAAATTCCCAGG + Intergenic
1020907338 7:14079822-14079844 ATTGACATAGTTAAATTTCCAGG - Intergenic
1021833502 7:24642958-24642980 AATGAGATGGTTAAGTTCCAAGG + Intronic
1021987399 7:26110159-26110181 ATTGAAATGGTTAAATTCCCAGG + Intergenic
1022513545 7:30960086-30960108 ATTGACATGGCTAAATTCCCAGG + Intronic
1022882507 7:34602696-34602718 ATTAACATGGTTAAATCCCAGGG - Intergenic
1023222831 7:37937916-37937938 ATTGACATGGTTAAATTCCCAGG - Intronic
1024853694 7:53751889-53751911 AATGAAATGGATGAATTCCCTGG - Intergenic
1026515727 7:71069729-71069751 AATAACATGGTTAAATTCCCAGG + Intergenic
1027376004 7:77550502-77550524 ATTGAAATGGTTAAATTTCTAGG - Intronic
1027712156 7:81618105-81618127 ACTGACATGGTTAGATTCCTAGG - Intergenic
1028296725 7:89142006-89142028 ATTGACATGGTTACATTCTCAGG - Intronic
1028325197 7:89515332-89515354 ATTGACATAGTTAACTTCCCAGG + Intergenic
1028516529 7:91683429-91683451 ACTGATATGGTGAAATACTCAGG - Intergenic
1030547379 7:110913712-110913734 ATGGACATGGTTAAATTCCCAGG - Intronic
1030644015 7:112038941-112038963 ACTGCCATGGATAAATTTGCTGG - Intronic
1030737160 7:113062936-113062958 ATTGACATGATTAACTTCCCAGG + Intergenic
1031289721 7:119918002-119918024 ACTGTTATGTTTAAAATCCCAGG + Intergenic
1031567184 7:123314747-123314769 GTTGACATGATTAAGTTCCCAGG - Intergenic
1031769395 7:125824113-125824135 ATTGACATAGTTAAATTCCCAGG + Intergenic
1032152600 7:129442851-129442873 TGTGACCTGGTTAAATTTCCAGG + Intronic
1032221215 7:129995667-129995689 ACTCAGATGGTTACCTTCCCAGG + Intergenic
1033287169 7:140051314-140051336 ATTGACATGGTTAAATTCCTAGG - Intronic
1034481760 7:151326601-151326623 ATTGACATGGTTAGATTCCCAGG - Intergenic
1034822416 7:154228831-154228853 ATTGAAATGGCTAAATTCCAGGG - Intronic
1035834042 8:2728885-2728907 ATTGATTTGGTTAAATTCTCAGG - Intergenic
1035866915 8:3093865-3093887 AATGTCATGGCTAAATTTCCTGG + Intronic
1037362821 8:18091872-18091894 ATTGACATGGTTAAATTCCCAGG - Intergenic
1037661520 8:20931437-20931459 ACTGACATGATTAAATTCCCAGG - Intergenic
1038615921 8:29094883-29094905 ACTGAAATGAAAAAATTCCCTGG + Intronic
1038853510 8:31304639-31304661 ATTGACATGGTTTAATTCCCAGG - Intergenic
1039402845 8:37286050-37286072 ATTGACATGGTTACATTCCCAGG + Intergenic
1039802605 8:40972887-40972909 ATTGACATGGTTACATTCCCAGG + Intergenic
1040394474 8:46983683-46983705 TTTGACATGATTAAATTCCAAGG + Intergenic
1040715446 8:50246437-50246459 ATTGACTTGGTTCTATTCCCAGG - Intronic
1041160727 8:55040781-55040803 ATTGACATGGTTAAATTTTCAGG - Intergenic
1041309364 8:56498858-56498880 ATTGACATGGTTAAATTCCCAGG - Intergenic
1041589700 8:59563250-59563272 ATTGACATGGTAAACTTGCCAGG + Intergenic
1041769799 8:61460401-61460423 ATTGACATGGCTAAGTTCCTAGG - Intronic
1041798148 8:61769007-61769029 ATGGACATGGTTAAATTCCCAGG + Intergenic
1041882363 8:62766682-62766704 AGTGACAGGGCTCAATTCCCTGG + Intronic
1041913031 8:63109910-63109932 ATTCACATGGTTAAATTCCCAGG + Intergenic
1042623031 8:70727047-70727069 ATTGACATGGTTAAATTTCCAGG + Intronic
1042693357 8:71528352-71528374 AGTGACATGTTTATATTTCCAGG - Intronic
1042767615 8:72342907-72342929 ACTGACATGGTTAAATTCTTAGG + Intergenic
1043115083 8:76240807-76240829 ATTGACATGGTTAAATTCCCAGG - Intergenic
1045333223 8:101175198-101175220 ACTGACATTGTTAAATTCCCAGG + Intergenic
1045413890 8:101947550-101947572 ATTGACATGGATAAATTCCCAGG + Intronic
1045778210 8:105831848-105831870 GCTGACATGCTGAATTTCCCTGG - Intergenic
1046305939 8:112366815-112366837 ATTGACATGGTTAAATTCCCAGG + Intronic
1046843804 8:118892072-118892094 ATTGAAATGGTTAAATTCATAGG + Intergenic
1048121995 8:131592016-131592038 ATTGACATGGCTAAATTCTCAGG - Intergenic
1048489045 8:134874895-134874917 ATTGACATGGTTAAATTCCCAGG - Intergenic
1048660083 8:136589527-136589549 ACTAAAATGGTTGAATTCTCTGG - Intergenic
1048956363 8:139540257-139540279 ATTGAGATGGTTAAATTTCCAGG + Intergenic
1049042033 8:140119721-140119743 AAAGACCTGGTTAAATTCCCTGG - Intronic
1049458053 8:142704291-142704313 AGTGGCATGGTTAAATTCCCAGG - Exonic
1052284577 9:26770434-26770456 ATTGACATGGTTAAATTTTCAGG - Intergenic
1052544910 9:29864121-29864143 ACAGGGATAGTTAAATTCCCTGG + Intergenic
1052654733 9:31342700-31342722 ATTGACATGGTCGAATTTCCAGG - Intergenic
1052700236 9:31929288-31929310 AATAACATGGTCAAATTCACTGG + Intergenic
1053855942 9:42339558-42339580 ACAGACATGATGAAATTTCCTGG + Intergenic
1055056482 9:72028908-72028930 ACTGACTGGGCTGAATTCCCAGG + Intergenic
1055119764 9:72645856-72645878 ATTGACATAATTCAATTCCCAGG + Intronic
1055168879 9:73230150-73230172 GTTGACATAATTAAATTCCCAGG + Intergenic
1056419806 9:86413202-86413224 ATGAACATGGTTAAATTCCCAGG + Intergenic
1056572962 9:87832203-87832225 CTTGGCAGGGTTAAATTCCCAGG + Intergenic
1056811686 9:89769856-89769878 ATTGACATGGTTACATTTCTAGG + Intergenic
1057229863 9:93314649-93314671 ATGGCCATGGTTAAATTCCCAGG - Intronic
1058024119 9:100121470-100121492 AGTGAAATGGATAAATTCCTTGG - Intronic
1058331353 9:103764859-103764881 ATTGGCATGGTTAATTTCCCAGG - Intergenic
1060802791 9:126555266-126555288 TCTGACATGGAAAAGTTCCCGGG + Intergenic
1060924774 9:127448689-127448711 AATGACAAGCTTAAATTGCCAGG + Intronic
1203624690 Un_KI270750v1:3024-3046 CTTGACATGGTTAAATTCTTAGG - Intergenic
1186138669 X:6547731-6547753 ATTGAGACGGTTAACTTCCCAGG + Intergenic
1186267988 X:7852337-7852359 AATGACATGGTTGGTTTCCCTGG - Intergenic
1186337837 X:8610094-8610116 ATTGACATGGTTAAATTCCCAGG + Intronic
1186457876 X:9724662-9724684 ACTGACATGGTTAAATTCCCAGG + Intergenic
1186628724 X:11324659-11324681 AATGACATGGTAAAATTCCCAGG + Intronic
1186691636 X:11983940-11983962 ACTGGCATGGTTAAATTCCCAGG - Intergenic
1186714871 X:12241094-12241116 ACTGATATTGAGAAATTCCCAGG - Intronic
1188028350 X:25234939-25234961 ATTGACCCGGTTAAATCCCCAGG + Intergenic
1188120255 X:26297329-26297351 ATTCACCTGGTTAAATCCCCAGG + Intergenic
1188153807 X:26715757-26715779 ATTAATATGGTTAAATTCCCAGG - Intergenic
1188266072 X:28076397-28076419 ATTAATATGGTTAAATTTCCAGG + Intergenic
1188734250 X:33693028-33693050 ATTGACATAGTTAAATCCCCAGG + Intergenic
1188943862 X:36272664-36272686 TTTGACATGGTTAAATTTCCAGG + Intronic
1188982246 X:36736962-36736984 ATTGACATGATTAAATTTCCTGG - Intergenic
1189660306 X:43289808-43289830 ATTGATATGGTTAAATTTCCAGG - Intergenic
1189671546 X:43415540-43415562 ATTGACGTGATTAAATTCCCAGG - Intergenic
1189684139 X:43546182-43546204 ATTGACATAGTTAAATTCCCAGG - Intergenic
1190034957 X:47013579-47013601 ACTGACATGGTTAAATTCCCAGG - Intronic
1190044479 X:47101167-47101189 ACTGACATGGGAAAATCCCCAGG + Intergenic
1190572616 X:51799414-51799436 ATTAACATGGTTAAATTTCCAGG - Intergenic
1190908759 X:54753251-54753273 ATTAACATGGTTAAATTCCCAGG + Intronic
1192003483 X:67182841-67182863 ATTGACATTGTTAAACTCCCAGG - Intergenic
1192531147 X:71887376-71887398 ATTGACATGGCTAAATTCCCAGG + Intergenic
1192887846 X:75355411-75355433 ATTGACATGCTTAAACTCCCAGG - Intergenic
1193491108 X:82148849-82148871 ATTGACATAGATCAATTCCCAGG + Intergenic
1193565576 X:83072374-83072396 ATTGACATGGTTAAACTCCCAGG - Intergenic
1193576137 X:83198645-83198667 ATTGACTTGGTTAAATTCCCAGG - Intergenic
1194037331 X:88892393-88892415 ACTGACATTGGTAAATTTCCAGG + Intergenic
1194220792 X:91187822-91187844 ATTGACATGGCTAAATTCCCAGG + Intergenic
1194548372 X:95267163-95267185 ATTGACATGGATACATTCACAGG + Intergenic
1194560051 X:95409161-95409183 ATTGACATGGTTCAATTCCAAGG - Intergenic
1194931652 X:99895746-99895768 ATTAACATGGTTAGATTCCCAGG - Intergenic
1195897523 X:109762097-109762119 ATTGACATAACTAAATTCCCAGG - Intergenic
1195904701 X:109832130-109832152 CATAACATAGTTAAATTCCCAGG - Intergenic
1196638101 X:118027406-118027428 ATTGATATGGTTAAATTCCCAGG + Intronic
1196836601 X:119819628-119819650 ATTGATGTGGTTAAATTCCAAGG + Intergenic
1197150161 X:123211620-123211642 ACTGACATGTTTATGTTCCATGG - Intronic
1197992864 X:132336749-132336771 ATTGACATGATTAAATTCCCAGG + Intergenic
1198500530 X:137241145-137241167 GTTGACATGATTAAATTCCAAGG - Intergenic
1198668549 X:139052369-139052391 AGTGACATGGTTAAATTTCCAGG - Intronic
1199368978 X:147022386-147022408 ATTGGCATGGTTAAATTTCCAGG - Intergenic
1199949153 X:152692418-152692440 ACTGACGTGGTTAAATTCCCAGG - Intergenic
1199960523 X:152776031-152776053 ACTGACGTGGTTAAATTCCCAGG + Intergenic
1200557298 Y:4651563-4651585 ATTGACATGGCTAAATTCCCAGG + Intergenic
1200869082 Y:8077700-8077722 ACTGCCATGGGTAAAGTCCTGGG - Intergenic
1200934377 Y:8725441-8725463 ACTGTCATGTTTTAATTTCCTGG - Intergenic
1201620485 Y:15951639-15951661 ATTGACATGGGCAAATTCCAAGG + Intergenic
1201757774 Y:17505626-17505648 CCTGACATTGTTAAATTCCCAGG - Intergenic
1201843780 Y:18400356-18400378 CCTGACATTGTTAAATTCCCAGG + Intergenic