ID: 1113529220

View in Genome Browser
Species Human (GRCh38)
Location 13:111008207-111008229
Sequence TAAAAAAGACTGCACTGACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 659
Summary {0: 7, 1: 45, 2: 91, 3: 130, 4: 386}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113529220_1113529223 0 Left 1113529220 13:111008207-111008229 CCATGTCAGTGCAGTCTTTTTTA 0: 7
1: 45
2: 91
3: 130
4: 386
Right 1113529223 13:111008230-111008252 CATTATTAACTGGGAAAAAATGG No data
1113529220_1113529222 -9 Left 1113529220 13:111008207-111008229 CCATGTCAGTGCAGTCTTTTTTA 0: 7
1: 45
2: 91
3: 130
4: 386
Right 1113529222 13:111008221-111008243 TCTTTTTTACATTATTAACTGGG No data
1113529220_1113529225 30 Left 1113529220 13:111008207-111008229 CCATGTCAGTGCAGTCTTTTTTA 0: 7
1: 45
2: 91
3: 130
4: 386
Right 1113529225 13:111008260-111008282 TTACAGATTTTTTAAATATTAGG No data
1113529220_1113529221 -10 Left 1113529220 13:111008207-111008229 CCATGTCAGTGCAGTCTTTTTTA 0: 7
1: 45
2: 91
3: 130
4: 386
Right 1113529221 13:111008220-111008242 GTCTTTTTTACATTATTAACTGG 0: 3
1: 10
2: 7
3: 26
4: 391
1113529220_1113529224 1 Left 1113529220 13:111008207-111008229 CCATGTCAGTGCAGTCTTTTTTA 0: 7
1: 45
2: 91
3: 130
4: 386
Right 1113529224 13:111008231-111008253 ATTATTAACTGGGAAAAAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113529220 Original CRISPR TAAAAAAGACTGCACTGACA TGG (reversed) Intergenic
901932826 1:12607702-12607724 AAAAAAAGACTGTATTGACATGG + Intronic
901964179 1:12852541-12852563 TAAAAAATAGTTAACTGACAGGG + Intronic
903005962 1:20299046-20299068 AAAGAAAGATTGCACTTACAGGG + Intronic
903506463 1:23839090-23839112 CAAAAAAGACTGCATTGACGTGG - Intergenic
904875150 1:33648902-33648924 TAAAAAAGACTACATTGACATGG + Intronic
905472077 1:38200665-38200687 TAAAAAAGACTGTATTGACATGG + Intergenic
906016183 1:42582347-42582369 TGCAAAAGACTGCAATGATATGG - Intronic
906364829 1:45198751-45198773 TAAAGAAGACTGCATTGACATGG + Intronic
907690715 1:56662693-56662715 TAAAAAAGACTGCACTGACATGG - Intronic
907765244 1:57403349-57403371 TAACAAAGCCAGCACTGAGAAGG + Intronic
908167424 1:61472131-61472153 TAAGAAAGACTGCACTGACATGG - Intergenic
908622534 1:66000467-66000489 TAGAAAAGACGTCACTGAGAGGG + Intronic
908679538 1:66645090-66645112 TAAAATAAACTGCACAGACATGG - Intronic
908887227 1:68803341-68803363 TAAAAAAGATTGCATTGATATGG + Intergenic
910519750 1:88106289-88106311 TAAGAAAGACCAGACTGACAAGG - Intergenic
910858360 1:91719044-91719066 TGACAAAGGCTGCACTGTCAAGG - Intronic
910925946 1:92398359-92398381 TTAAAAAGACTCCACTGGCCAGG - Exonic
911550729 1:99276759-99276781 TAAAAAAGATTGCAATGATATGG - Intronic
911693411 1:100861078-100861100 TAAAAACCACTGCCCTGACCGGG - Intergenic
912053742 1:105568242-105568264 TAAAAAAGACTACATTGACATGG - Intergenic
912407963 1:109457387-109457409 AAAAAAATATTGCATTGACATGG - Intergenic
912577847 1:110691494-110691516 TAAAAAAGACTGCATTGGGATGG + Intergenic
913676375 1:121144794-121144816 TAAAAACGACTGCATTGATGTGG + Intergenic
913962057 1:143347661-143347683 TGTAAAAGACTGCATTGATATGG + Intergenic
914028269 1:143932744-143932766 TAAAAACGACTGCATTGATGTGG + Intergenic
914056413 1:144173236-144173258 TGTAAAAGACTGCATTGATATGG + Intergenic
914122733 1:144793126-144793148 TGTAAAAGACTGCATTGATATGG - Intergenic
914835427 1:151202762-151202784 AAAAAAAGACTTTACTGGCAGGG - Intronic
915797639 1:158753412-158753434 TACTAAAGACTGCATTGAAAGGG + Intergenic
916036886 1:160930097-160930119 TAAAGAAGACTTCAGTGAGAAGG - Intergenic
917270886 1:173272373-173272395 AAAAAAAGACTACATTGACATGG - Intergenic
917547159 1:175983194-175983216 TGAAAAAGACTCCTCTGATATGG + Intronic
917759033 1:178135210-178135232 TAAAAAAGACTGCATTGACATGG + Intronic
919543209 1:198877431-198877453 TAAAAAAGTCTTCATTGATAAGG + Intergenic
919612592 1:199763842-199763864 TTAAAAAGAATGCAATGATAAGG + Intergenic
919627760 1:199928648-199928670 TAAAAAAGACTGCATTGATAAGG - Intergenic
920406730 1:205720013-205720035 GAAACAAAACTGAACTGACAGGG + Intronic
920463740 1:206163635-206163657 TAAAAACGACTGCATTGATGTGG + Intergenic
920686454 1:208112729-208112751 TAATAAAGACGGCAGTTACAGGG - Intronic
920707190 1:208261422-208261444 GTAAAAAGACTGCATTGACATGG - Intergenic
921091115 1:211844445-211844467 GTAAAAAGACTGCATTGACATGG - Intergenic
921156635 1:212444218-212444240 TAAAAAAGACTCCACGCTCACGG - Intronic
921511533 1:216037070-216037092 TAAAAAAGACTGCATTGACATGG - Intronic
921876138 1:220198710-220198732 AAAAAAAGAATGCACAGCCAAGG - Intronic
922527516 1:226317015-226317037 TAAAAGAGACTGCACTGACATGG + Intergenic
922625679 1:227039204-227039226 TAAAGGAGACTAGACTGACATGG + Intronic
922671902 1:227515740-227515762 TAAAAAAGACTATCTTGACATGG + Intergenic
924049077 1:240062164-240062186 TAACAAAGATTGCATTGATACGG - Intronic
924244653 1:242072472-242072494 TAAAAAAGACCGTTTTGACATGG + Intergenic
924821862 1:247500406-247500428 TAAAAAAGACTGTCTTGACATGG + Intergenic
1064129749 10:12698614-12698636 TAAAAAACACCACACTGACATGG - Intronic
1064232557 10:13542026-13542048 TAAAACAAACTACACTGACTAGG + Intergenic
1065755795 10:28929454-28929476 TAAAAATGATTGTATTGACATGG - Intergenic
1066276818 10:33877032-33877054 TAAAAAAGACTGCCATGCAATGG + Intergenic
1067240921 10:44492510-44492532 TAAAAAATATTACATTGACATGG - Intergenic
1067514920 10:46930930-46930952 TAAAAAACTCTGCTTTGACAAGG - Intronic
1067647334 10:48120884-48120906 TAAAAAACTCTGCTTTGACAAGG + Intergenic
1067755988 10:49005761-49005783 GGTAAAAGACTGCACTGACATGG + Intergenic
1068025610 10:51639491-51639513 AAAAAAAGACTGGAGTGAGATGG + Intronic
1068562675 10:58533345-58533367 TAAAAAAGACTGCATTGACATGG + Intronic
1068797125 10:61095564-61095586 TGAAAAAGACTTTATTGACATGG - Intergenic
1069152747 10:64985532-64985554 TAAAGAATACTGCATTGATATGG + Intergenic
1069351066 10:67528129-67528151 TAAAAAAGACTGCATTGGCACGG + Intronic
1070447791 10:76524490-76524512 AACAAAAGCCTGCACTGAAAAGG - Intronic
1070931275 10:80262405-80262427 TAAAAAAGACTGCCTTGACATGG - Intergenic
1071182758 10:83005975-83005997 TAAAAAAGATTCAACTGATAAGG - Intergenic
1072235485 10:93449914-93449936 TAAGAGAGTCTGCACAGACATGG - Intronic
1072328373 10:94321132-94321154 TGAACAAAACTGCAGTGACAAGG - Intronic
1073368890 10:102968895-102968917 AAAAAAAGACAGCACTGGCTGGG - Intronic
1073527615 10:104199684-104199706 TAAGAAAGACTTCAGTGAGAAGG + Intronic
1074620434 10:115113836-115113858 TAAACAAGACTGCATTGACATGG + Intronic
1075390808 10:122090058-122090080 TGAAAAAGAAGGCACTGATATGG - Intronic
1076232115 10:128829240-128829262 TAAAAAAGATTCCATTCACATGG + Intergenic
1077617086 11:3683910-3683932 TAAAAATGACAGCACTGGCCAGG + Intronic
1078324917 11:10371877-10371899 TAAAAAAGACTGAATTGACATGG - Intronic
1078644322 11:13125832-13125854 TCAAAAAGACTCCATTGACATGG + Intergenic
1078644640 11:13129184-13129206 TCAAAAAGGCTGCACTGACATGG - Intergenic
1078842710 11:15093370-15093392 AAAAAAAGACTTCATTGACATGG - Intergenic
1079353956 11:19714780-19714802 TAAAAGAGATTGCACGGCCAGGG - Intronic
1079360053 11:19762905-19762927 TAAAAAAGACTTCCCTGGCTGGG - Intronic
1079595015 11:22233522-22233544 CAAGTAAGACTGCATTGACATGG - Intronic
1079955687 11:26861697-26861719 TAAGAAAGAATGCAGTAACATGG + Intergenic
1080981156 11:37407958-37407980 TAACAAAGACTGCATTGACATGG + Intergenic
1081064968 11:38530658-38530680 TAAAAATGATTTCATTGACATGG + Intergenic
1081422937 11:42893609-42893631 TAAAAAAGACTGAATTGACATGG + Intergenic
1081466729 11:43326155-43326177 TAAAAAAGACTGCATTGACATGG + Intronic
1082679186 11:56147700-56147722 TAAAAAAGAATGTATTGACATGG - Intergenic
1082948328 11:58784799-58784821 AAAAAAGGACTGCATTGACATGG - Intergenic
1084836552 11:71806037-71806059 AATAGAAGACTGCATTGACACGG + Intergenic
1085425261 11:76399025-76399047 TATAAAAGTCTGCAGTGACAAGG - Intronic
1085824564 11:79830997-79831019 TCAAAAAGACTGCTTTGATATGG + Intergenic
1086019822 11:82214145-82214167 GTAAAAAGACTGCATCGACATGG + Intergenic
1086502362 11:87466434-87466456 CTACAAAGACTGCACAGACAGGG - Intergenic
1086864832 11:91968126-91968148 AAAAAAAGACTGCATTGACCTGG + Intergenic
1087121362 11:94577742-94577764 TAAAAAAGACTGCACTGATGTGG - Intronic
1088863914 11:113828024-113828046 TAAAAAAGACTCAACAGTCAGGG + Intronic
1090424909 11:126600911-126600933 TAAAATAGAATGCTCTGATATGG - Intronic
1090698397 11:129271847-129271869 TAATCAAGACTGCAGTGACCTGG - Intronic
1090841803 11:130496574-130496596 TAAAAAAGACTGCACTGATGTGG - Intergenic
1091581559 12:1793581-1793603 CCAAAAAGTCAGCACTGACATGG - Exonic
1092163402 12:6328357-6328379 TAAAAATGACTGCCCTGGCTGGG + Exonic
1092402689 12:8190068-8190090 AATAGAAGACTGCATTGACAAGG - Intergenic
1092882973 12:12902143-12902165 TAAACAAGTCTGCACTGAAAGGG - Intronic
1092954637 12:13538402-13538424 AAACAAAGACTCCAATGACAAGG - Exonic
1093276441 12:17134278-17134300 TAAAAAAGAAACCACTGAGAAGG + Intergenic
1093442023 12:19210081-19210103 TGAAAAAGACTACATTGACATGG + Intronic
1093983257 12:25498590-25498612 TATAAAAGACTGAAGTCACAAGG + Intronic
1094129127 12:27055792-27055814 TAAAAAAGACTGCATTGACATGG - Intronic
1094296361 12:28911138-28911160 TAAAAAAGACAGCATTAACATGG + Intergenic
1094315669 12:29135924-29135946 TAAAAAGGACTGGACTGGCCGGG - Intergenic
1094370102 12:29728701-29728723 TAAAAAGCACTGCTCTGGCAAGG + Intronic
1094662748 12:32486472-32486494 TAAAAAAGACTGAGATGACAAGG - Intronic
1094675367 12:32614746-32614768 TAAAAACTACTGCATTGCCATGG + Intronic
1095322607 12:40847262-40847284 TAAAAAAGACTGCATTTACCTGG + Intronic
1095354070 12:41250559-41250581 TAAAAAAGATAGCATTGGCATGG - Intronic
1095357820 12:41297018-41297040 TAAAAAAGACTACACTGATGTGG + Intronic
1095578288 12:43764545-43764567 TAAAAAAGACTTCATTGATGTGG - Intronic
1096254520 12:50054838-50054860 AAAAAAAAACTGCAATGCCATGG - Intergenic
1096511060 12:52128927-52128949 CAAAAAAGACTGAATTGATAAGG + Intergenic
1097280797 12:57844836-57844858 TAAATAAGCCTGCCCTGAGAAGG - Intronic
1097412681 12:59274381-59274403 TAAAGAAAACTGCATTGACATGG - Intergenic
1097498141 12:60369118-60369140 TAAAAAGGGCTACATTGACATGG - Intergenic
1097538427 12:60903439-60903461 TAAAAAAGAGCACATTGACATGG + Intergenic
1097674363 12:62582582-62582604 TAAAAAAGACAGCATTGACATGG + Intronic
1097985546 12:65779673-65779695 TAAGAAACACTGAACTGACCAGG + Intergenic
1098305869 12:69102088-69102110 TGAAAAAGACTGCATAGACATGG + Intergenic
1098371305 12:69763084-69763106 TAAAAAAGACTGCATTGACATGG - Intronic
1098547205 12:71724885-71724907 TAAAAAAGCCTGCATCAACATGG - Intergenic
1099175470 12:79416852-79416874 TAAAAATGATTGCACTTTCAAGG + Intronic
1099223632 12:79943032-79943054 TAAAAAAGGATGCAGGGACATGG - Intergenic
1099565490 12:84239472-84239494 TAAAAACGACTGCATTGACATGG + Intergenic
1099765558 12:86978631-86978653 TAAAAAAGACTGCATTGACATGG - Intergenic
1099939757 12:89172030-89172052 CAATAAAGACTGCCTTGACATGG - Intergenic
1100282746 12:93133896-93133918 TAAAAAAGATTACATTGATATGG + Intergenic
1100693840 12:97068473-97068495 TAAAAAAGATTGCATTGACAAGG - Intergenic
1100730931 12:97468021-97468043 TTATAAAGAATGCACTGCCAGGG + Intergenic
1102387627 12:112523376-112523398 TAAAAAAGACTGCATTGACAGGG + Intergenic
1103218426 12:119222373-119222395 TCAAAAAGATTACACTGATATGG - Intergenic
1104064301 12:125294096-125294118 CAAAAGAGACTTCAGTGACAAGG - Intronic
1104279497 12:127361759-127361781 TTGAAAAGACTGCATTGACATGG - Intergenic
1106114184 13:26802613-26802635 TAAAACAGAAAGCACTGATAGGG - Intergenic
1106677430 13:31975889-31975911 TAAAGAAGACTGCATTAACATGG + Intergenic
1107118261 13:36770366-36770388 AAAAAAAGACTTCATTGACATGG - Intergenic
1107143009 13:37024410-37024432 TACCGAAGACTGAACTGACACGG + Exonic
1107144158 13:37039759-37039781 TAGAAAAGATTGCATTGATATGG + Intronic
1107251554 13:38369606-38369628 TAAAAAAGACTACATTGACATGG - Intergenic
1107329348 13:39282048-39282070 TTAGAAAAACTGCTCTGACAGGG - Intergenic
1107594495 13:41948590-41948612 TTAAAAAGACTATGCTGACAAGG + Intronic
1108206757 13:48097873-48097895 TAAAAAAGACAGCATTGACACGG - Intergenic
1108215848 13:48183654-48183676 TAAAAAGGATTGCATTGATATGG + Intergenic
1108367324 13:49728992-49729014 TGAAAAAGACTGCGCTGACATGG + Intronic
1108774935 13:53754225-53754247 TAAAATAGACTGCATTGACATGG - Intergenic
1108897730 13:55354758-55354780 TTAAAAAGACTACATTGACATGG + Intergenic
1109079523 13:57880635-57880657 TAAAAAAGACTGCATTAACATGG - Intergenic
1109535338 13:63710385-63710407 CAGAAAAGACTGCATTGACATGG - Intergenic
1109888461 13:68575003-68575025 TAAAAAAGACTGCATCGACATGG + Intergenic
1109947449 13:69455791-69455813 ATAAAAATACTGCATTGACATGG - Intergenic
1110368382 13:74713358-74713380 AAAAAAAGAGTCAACTGACATGG - Intergenic
1110769127 13:79316990-79317012 TAAAAAAGAGTAAACTGAGATGG + Intronic
1110874559 13:80492208-80492230 TAAATAGGGCTGCAATGACATGG + Intergenic
1111176015 13:84597302-84597324 TAAAAAAGACTACATTTACATGG + Intergenic
1111261691 13:85748928-85748950 TAAAAAAGACTGTAATGAATTGG + Intergenic
1112880684 13:104102982-104103004 TAGAAAAGACTTCTCTGAGATGG - Intergenic
1112949964 13:104981798-104981820 TAGAAAAGACTGCATTGACATGG - Intergenic
1113044162 13:106136649-106136671 TAACTAAGACTGCATTGACATGG - Intergenic
1113149663 13:107249020-107249042 TAAAAAAAACAGTAATGACATGG + Intronic
1113529220 13:111008207-111008229 TAAAAAAGACTGCACTGACATGG - Intergenic
1114353137 14:21876616-21876638 TAAAAAAGACTGCATTGACTTGG + Intergenic
1114367898 14:22049952-22049974 TAAACAAACCTGCATTGACATGG + Intergenic
1114581686 14:23766469-23766491 TGTAAAAGACTGTATTGACATGG + Intergenic
1115262166 14:31465415-31465437 TAAAACAGACTGGCCTGACTTGG - Intergenic
1115823076 14:37233536-37233558 TAAAAATGACCGCACTGACATGG - Intronic
1116210805 14:41940940-41940962 GTAAAAATACTGCATTGACATGG - Intergenic
1116426929 14:44801946-44801968 GTAAAAAGACTGCATTGACGTGG + Intergenic
1116820621 14:49623112-49623134 TGAAAATGACTGTTCTGACAGGG - Exonic
1116877979 14:50133031-50133053 TAAAAGAGACTGCAATGATATGG + Intronic
1117031194 14:51672509-51672531 GTAAAAAGACTGCATTGACATGG + Intronic
1117138066 14:52757865-52757887 TAACAAAGGCTGCACTGAAGAGG - Exonic
1118101412 14:62608293-62608315 TAAAAAGGACTGATCTGAAAAGG - Intergenic
1118404417 14:65409771-65409793 AAGAAAACAATGCACTGACAAGG + Intergenic
1118467846 14:66047064-66047086 AAAAAAAGACTGTATTGACATGG - Intergenic
1118830724 14:69429130-69429152 TAAAAAAGACTGCATTGACATGG + Intronic
1118864905 14:69695162-69695184 TAAAACAGGCTGCAGTGAGAGGG - Intronic
1119728379 14:76935968-76935990 AAAAAAAGACTGCAAGGCCAAGG - Intergenic
1119881300 14:78101847-78101869 TAAAAAAGCCTCCACTGCTAAGG - Intergenic
1120847739 14:89140741-89140763 TAAAAAAGACTGCACTAACAAGG - Intronic
1121018165 14:90561287-90561309 TAATCAAGACTGAACTGGCAAGG + Intronic
1122554127 14:102567824-102567846 AAAAAAAAACTGCACATACAAGG - Intergenic
1124207509 15:27734343-27734365 TAAGAAAGAATGCATTGAAAAGG + Intergenic
1125142300 15:36422639-36422661 TGAAAAAGACTGCATTGACATGG - Intergenic
1126000185 15:44202041-44202063 TGTAAAAGACTGCATTGATATGG - Intergenic
1126039939 15:44580481-44580503 TAAAAAAAACTGAACTGGCCAGG + Intronic
1126500278 15:49337824-49337846 TAAAAAACATTGCAGGGACATGG - Intronic
1126813012 15:52427478-52427500 TAGACAAGACTTCACTGAGAAGG + Intronic
1126917417 15:53481655-53481677 TAAAAAAGATTGTACTGACCTGG + Intergenic
1128510224 15:68309574-68309596 AAAAAAGGACTGTATTGACATGG - Intronic
1128633021 15:69284409-69284431 AAAAAAAGAGTGCACAGGCAAGG - Intergenic
1129086387 15:73097148-73097170 TAAAAAAGACTGCACTGAGATGG + Intronic
1129086588 15:73100272-73100294 TAAATAGGACTGAACTGAGATGG - Intronic
1129516903 15:76162581-76162603 TTCAAAATACTGCACAGACAAGG + Intronic
1129550550 15:76444273-76444295 TAAAAAAGATTGCACTGACATGG + Intronic
1130127836 15:81108859-81108881 TAAAAAAGACAGCATTGACATGG - Intronic
1131618769 15:94044909-94044931 TTTAAAAGACTGCATTGACATGG - Intergenic
1131954644 15:97719910-97719932 TAAAAATGATTGCCTTGACATGG - Intergenic
1132479233 16:158674-158696 TCAAAAAGACTGCATTGATACGG - Intronic
1133690006 16:8204409-8204431 TGAAAAAGACTTCAATGACGTGG - Intergenic
1133722053 16:8503730-8503752 TAAAAAAGACTACATTGAGATGG - Intergenic
1136017782 16:27415792-27415814 TAAAAAAGCCTGCATTGACATGG + Intronic
1136253218 16:29020695-29020717 TAAAAAAGAATGCACTGGGCCGG - Intergenic
1136924467 16:34359135-34359157 TTAAAAAAACTGTACAGACAGGG + Intergenic
1136980106 16:35052671-35052693 TTAAAAAAACTGTACAGACAGGG - Intergenic
1137459114 16:48642206-48642228 TAAAAAAAACTGCATTGACATGG + Intergenic
1137903890 16:52299333-52299355 TAAAGAAGACTGCACTGATGCGG + Intergenic
1138300645 16:55926479-55926501 TAAAAATGACTTCACTGACATGG - Intronic
1138771646 16:59671711-59671733 TAAAAAAGACTCTTTTGACATGG + Intergenic
1138803699 16:60066579-60066601 TATAAAAGACGTCATTGACATGG + Intergenic
1138848539 16:60597482-60597504 AAGAAATGACTGCACAGACAGGG + Intergenic
1139156033 16:64443478-64443500 TAAAACACACTGCACTCACAGGG - Intergenic
1139238803 16:65369227-65369249 TAAAAAAGATTGCATTGAGGTGG + Intergenic
1141039413 16:80659293-80659315 TAAAGGAGACTACACAGACATGG + Intronic
1141043451 16:80692175-80692197 AAAAGAAGACTTCACTGACGGGG + Intronic
1141945670 16:87307902-87307924 AAAAAAAGACTGCATTGATGTGG - Intronic
1143123827 17:4627981-4628003 TAAAAAAGGCTGCACCTTCACGG - Intergenic
1143173888 17:4945650-4945672 TAAAAAAGATTCTACTAACAAGG - Exonic
1143426314 17:6841901-6841923 TAAAAAAGGCTGCACCTTCACGG + Intergenic
1144103902 17:11969193-11969215 GAGGAAAGACTGGACTGACATGG - Intronic
1144326634 17:14188593-14188615 TAAAAAAGAATGCTTTGACATGG - Intronic
1144453575 17:15400952-15400974 AAAAAAAGACTACACTAACATGG - Intergenic
1144475513 17:15585457-15585479 TAAAAAAGAATGCTTTGACATGG - Intronic
1146102299 17:29994901-29994923 CAAAAAATACTGCATTGAAATGG - Intronic
1146210631 17:30939931-30939953 TAAAAAAGACTGCATTGGCATGG - Intronic
1147552955 17:41457620-41457642 TAAATAAGACAACACAGACATGG - Intergenic
1149195359 17:54113205-54113227 TAAAAAAGACTGTGTTGACATGG + Intergenic
1149278589 17:55073922-55073944 TAAAAAAGTTTGCACTGTCCAGG - Intronic
1149307186 17:55359452-55359474 TAAAAAAGACTGCACTGACATGG - Intergenic
1149321625 17:55487457-55487479 CAGGAAAGACTGCACTGAGAAGG + Intergenic
1149526004 17:57356163-57356185 TAAAAAAGACTGGCCAGGCACGG - Intronic
1149617665 17:58014974-58014996 TGAAAAAGAGTACATTGACATGG + Intergenic
1150191361 17:63243911-63243933 TAAAAAAGACTTAATTGACATGG - Intronic
1150742743 17:67792609-67792631 AAAAAAAGACTACATTGACATGG + Intergenic
1150891976 17:69162680-69162702 TAAAAGATACTTCAATGACAAGG + Intronic
1151015998 17:70553504-70553526 GAAAAAACACTGCATTGACATGG - Intergenic
1152178101 17:78800954-78800976 AAAAAAATACTGCCCTAACATGG - Intronic
1153284034 18:3440995-3441017 TAAATCAGACTGAACTGACATGG - Intronic
1153438743 18:5093727-5093749 AACAAAACACTGCATTGACAAGG - Intergenic
1153560800 18:6370148-6370170 AAAAAAAGAAAGCACTGACCTGG + Intronic
1154964358 18:21341845-21341867 TAAGCAAGGCTGCACTGACATGG - Intronic
1155266225 18:24096925-24096947 TAAAAAAGACTGCACTGACATGG - Intronic
1155447426 18:25927022-25927044 TTAAAAAGACTGTACTGGCTGGG + Intergenic
1155707995 18:28839528-28839550 AAAAAAAGACTACATTGATATGG + Intergenic
1156095553 18:33527201-33527223 TAAAAAGGAATGCAGGGACATGG - Intergenic
1156215126 18:34990193-34990215 TAAGAAAGACTGCAACGAAAGGG - Intronic
1156255308 18:35389851-35389873 TAAAAAAGACTGCATTGACATGG + Intergenic
1156275989 18:35582820-35582842 TAAAGAGGACTGGACTAACAAGG - Intronic
1156888365 18:42161833-42161855 TGAAAAAGACTGCATTGGCCTGG - Intergenic
1157752521 18:50192765-50192787 TAAAAGAGACTGCATTGACATGG + Intronic
1157768481 18:50323889-50323911 TAAAAAAGACTGCATGGACATGG + Intergenic
1158402130 18:57130774-57130796 TAAAAATGACTATAGTGACATGG - Intergenic
1158585651 18:58731427-58731449 TAAAAAGGAGTGCACAGATAGGG - Intronic
1158585654 18:58731455-58731477 AAAATAAGACTGCACACACAGGG - Intronic
1158711443 18:59841523-59841545 CCAAAAATACTGCAATGACAGGG + Intergenic
1159198362 18:65148687-65148709 TATAAAAGTCTGCATTGACGTGG - Intergenic
1159320792 18:66845335-66845357 TAAAAATGGCAGCACTGATATGG - Intergenic
1159325008 18:66903183-66903205 CAAAAAAGAATGCACTGTTATGG - Intergenic
1159343111 18:67162783-67162805 AGAAAAAGACTGCACTGACATGG - Intergenic
1159349307 18:67251152-67251174 AAAAAAAGACTTCTCTGATATGG + Intergenic
1159727879 18:71985276-71985298 TAAAAAATACTGCATTGATATGG + Intergenic
1160305163 18:77726492-77726514 TAGAAAAGACAGCATTGACATGG + Intergenic
1160829605 19:1097388-1097410 TAAGAAAGCCTGCACAGACCGGG - Intergenic
1164505354 19:28856130-28856152 AAAAGAAGACTGCAAAGACATGG - Intergenic
1164846980 19:31440677-31440699 TAAAAAAGAATACAGAGACAGGG + Intergenic
1165613129 19:37174225-37174247 AAAAAAAAACTCCACTGAGAAGG + Intronic
1167161465 19:47770096-47770118 GAAAAAAGACCTCACTGAGAAGG + Intergenic
1168565984 19:57424157-57424179 TAAAAAAGATTGCATAGACAAGG - Intronic
1202695893 1_KI270712v1_random:125913-125935 TGTAAAAGACTGCATTGATATGG + Intergenic
925443049 2:3905034-3905056 TAAAAAAGAAAGCACTGGCCGGG + Intergenic
926531363 2:14050203-14050225 TAAAACAGATTGCATTGACTTGG + Intergenic
926587330 2:14701513-14701535 TTAAAAAGATTGCAATGAAATGG + Intergenic
926653031 2:15367360-15367382 TAAGAAACACAGCACTGCCAGGG + Intronic
926993796 2:18711445-18711467 AAAAAAAAACTGCATTGACAAGG - Intergenic
927120921 2:19962021-19962043 TAAAAAAGACTGCATTGACATGG + Intronic
927266433 2:21157769-21157791 TAAAAATGACTGCATTGATGTGG + Intergenic
927338288 2:21950870-21950892 TAAAAAAGACTGCAATTACAGGG - Intergenic
927343201 2:22006288-22006310 TAGAAAAGAATGCATTGACAAGG - Intergenic
927362919 2:22257439-22257461 TAAAAAAGACTACATTGACATGG + Intergenic
928972352 2:37043660-37043682 CAAAAAAGACTTCATTGACATGG + Intronic
929360695 2:41086080-41086102 AAAAAAAGACTACATTGACATGG + Intergenic
929389389 2:41451767-41451789 TAAAAAAGAATGCATTGATATGG + Intergenic
929421976 2:41800513-41800535 TAAAAAATATTGAATTGACATGG + Intergenic
930081759 2:47455665-47455687 GTAAAGAGACTGCATTGACATGG - Intronic
930421872 2:51164436-51164458 TAGAAAAGACTGCCTTGACAGGG - Intergenic
930605614 2:53490224-53490246 TGAAAAAGACAGAACAGACAAGG + Intergenic
930678864 2:54233962-54233984 TGAAAAAGACTGCACTGACATGG - Intronic
930686541 2:54314016-54314038 TAAAATAGATTGCACTGAGAAGG - Intergenic
931562924 2:63582593-63582615 TAAAAAAGACTACACTTGCAAGG + Intronic
931575603 2:63714986-63715008 AAAAAAAGAATGCTGTGACATGG + Intronic
932095342 2:68842639-68842661 TAAAAAAGACTGCAATGACATGG - Intergenic
932297919 2:70642167-70642189 TAAGAACCACTGCATTGACAGGG - Intronic
932532908 2:72556456-72556478 TACAAAAGACTACGTTGACATGG + Intronic
932534327 2:72576345-72576367 TAAAAAAAAATAGACTGACATGG + Intronic
932569471 2:72931014-72931036 TTACAAAGACTGCAATAACAGGG - Intronic
933643541 2:84789915-84789937 AAAAAAAGACTGCATTGACATGG + Intronic
934277057 2:91582958-91582980 TGTAAAAGACTGCATTGATATGG + Intergenic
935281706 2:101523370-101523392 TAAAAATGACTGTATTGACATGG - Intergenic
935286963 2:101573491-101573513 TAAAAAAGATTGTGTTGACATGG + Intergenic
935801843 2:106705456-106705478 AAAAATAAACTGCATTGACATGG - Intergenic
935831421 2:107004859-107004881 TAGCAAAGACTCCACAGACAAGG + Intergenic
935923808 2:108044775-108044797 TAAAAAAGACAGCACAGACATGG - Intergenic
936845180 2:116822126-116822148 TAAAAAAGAGTACAGTGGCAAGG - Intergenic
937343572 2:121108142-121108164 TAACAAAGACTTCACTCTCACGG - Intergenic
937505249 2:122529347-122529369 TAAAAGTCACTGCACTGACTTGG - Intergenic
937820181 2:126301815-126301837 TAAAAGTGACTGCACTGACATGG + Intergenic
937861236 2:126712199-126712221 TAAAAAAGACTGCATTGACATGG + Intergenic
938111627 2:128571132-128571154 TAAAAAAGTCTGTACTGATATGG - Intergenic
938468458 2:131537422-131537444 AAAAAAAAAATGGACTGACATGG - Intergenic
938784753 2:134616480-134616502 TAAAGAAGACTGCATTGATATGG + Intronic
939088630 2:137752346-137752368 TAAAAAAGACTGCATTGACATGG - Intergenic
939984849 2:148819766-148819788 TCAAAAAGACTGCATTGACATGG + Intergenic
940369289 2:152882176-152882198 GTAAAAAGACTGCAGTGACATGG - Intergenic
940561288 2:155300688-155300710 TAAAAAAAACTGTAGTGACCAGG - Intergenic
941129919 2:161635106-161635128 AAAGAGAGACTGCATTGACATGG - Intronic
941318438 2:164024393-164024415 TTAAAAAGACTGCATTGGCATGG - Intergenic
941343467 2:164337469-164337491 TTAAAAAGCATCCACTGACAAGG - Intergenic
941364423 2:164592506-164592528 TAAACAAGCCAGCTCTGACATGG + Intronic
941619988 2:167766541-167766563 TAAAAAATATTGCATTGGCATGG - Intergenic
941964942 2:171291674-171291696 AAAAAAAGACTGCCTTGACGTGG + Intergenic
942384779 2:175430960-175430982 TAAAAAAGTCTGGACTGATTTGG + Intergenic
942601951 2:177650459-177650481 TAGAAAAGACAGCCCTGATAGGG - Intronic
942844300 2:180404361-180404383 TAAAAAAGACTGCATTGACCTGG + Intergenic
943249727 2:185503379-185503401 TAAAAAAGATTGCATTTACATGG - Intergenic
943357478 2:186875192-186875214 AAAAAAAGACTGCATCGATATGG - Intergenic
943376461 2:187083536-187083558 CAGAAAAGAATTCACTGACATGG + Intergenic
943668004 2:190630633-190630655 TGAAAAAGACTACATTGACCTGG + Intergenic
943706335 2:191038829-191038851 TAGAAGAGACTGCATGGACAAGG + Intronic
943914556 2:193613238-193613260 TAAAAAAGACTGCATAGACAAGG - Intergenic
944019636 2:195086671-195086693 AAAAAAAGAGTGAAGTGACATGG - Intergenic
944028879 2:195207998-195208020 TAAAAAAGAATGCACTATCAAGG - Intergenic
944382156 2:199123627-199123649 TAAAAAAGACTGCATTGACGTGG - Intergenic
944421405 2:199534747-199534769 TGAAAAAGACTCCTCTGATAAGG - Intergenic
945144266 2:206720375-206720397 TCAAAAGGACTGCACTGACATGG + Intergenic
945554313 2:211260703-211260725 GACAGAAGACTGCACTGACTAGG - Intergenic
945602215 2:211882247-211882269 TGAAAGAGACTGCATTGACATGG + Intronic
945841606 2:214893679-214893701 TAAAAAAGACTGCACTGACATGG - Intergenic
945906270 2:215596946-215596968 GAAAAAGGACTCCATTGACACGG + Intergenic
946151524 2:217775921-217775943 GTAAAAAGACTGCATTGACATGG - Intergenic
946261183 2:218492530-218492552 TAAAACAGACTGCAGAAACATGG + Intronic
946630394 2:221661214-221661236 TAAATAAGAATGTATTGACAGGG + Intergenic
946662908 2:222020091-222020113 TAAAAAAGTTTGCATTAACATGG + Intergenic
947032212 2:225809499-225809521 TAAAAAAGACAGCATTGATATGG - Intergenic
948592984 2:239063185-239063207 AAAAAAAGACTGCAGGGCCACGG - Intronic
948594498 2:239070905-239070927 CAACAGAGACTGCATTGACATGG - Intronic
1169033970 20:2434685-2434707 AAAAAAAGACTGTGTTGACATGG + Intergenic
1169348255 20:4847018-4847040 GAAAAAAAACTGCACTAAAAAGG + Intergenic
1169381472 20:5111313-5111335 TAAAAAAGACAAAACTGACCAGG + Intronic
1170001923 20:11624361-11624383 TAAAAACAACTGTACTGAGAGGG - Intergenic
1171777576 20:29383459-29383481 AAAAAAAGACTCCTCTGATAGGG - Intergenic
1171923872 20:31172920-31172942 TCAAAAAGAATGCAATGAAATGG + Intergenic
1173635226 20:44550372-44550394 TAAAAAAGACTGCATTAATATGG - Intronic
1173997662 20:47351937-47351959 AAAAAAACTCTGCAATGACAGGG + Intronic
1174274207 20:49391810-49391832 TCACAAAGACTGCTGTGACAGGG - Intronic
1174893335 20:54421971-54421993 TAAAAAAGATTGCATTGATATGG - Intergenic
1175589302 20:60174948-60174970 GAAAAAGGACTGAACTGACATGG - Intergenic
1176055367 20:63142888-63142910 GTAAAAAGACTGCATTGAGATGG - Intergenic
1177594409 21:23217074-23217096 AAAAAAAGACTAGAATGACAAGG + Intergenic
1177685123 21:24426153-24426175 AAAAACAGACTGCATTGACATGG - Intergenic
1178145158 21:29730985-29731007 AGAAAAAGAATGCATTGACATGG - Intronic
1178243516 21:30929842-30929864 AAAAAAAGGCTGCATTGACATGG - Intergenic
1178576796 21:33799931-33799953 TAAGAAAGACTCCAGTGAGAGGG + Intronic
1178590814 21:33908244-33908266 TTAAATAGACTGCACTGACAAGG + Intronic
1179614419 21:42572598-42572620 TAAAACAGGATGCACTGAAAGGG - Intronic
1180032150 21:45219555-45219577 TAAGAAAGACTGCACTGACATGG - Intronic
1182205530 22:28621022-28621044 TAAAAAAGACTGTTTCGACATGG + Intronic
1182262524 22:29084732-29084754 TAAGAAAAACTGAACTTACAGGG - Intronic
1182583637 22:31330124-31330146 TAAAAAAGTCTGAATTGGCATGG + Intronic
1182740914 22:32566944-32566966 GAGAAAAGACTCCACTGAGATGG + Intronic
1184831059 22:46987819-46987841 AAAAGAAGACTCCACTGACATGG - Intronic
1185264220 22:49890447-49890469 TTAAAAAGGCTGCACTGACATGG - Intergenic
949918966 3:8986598-8986620 AAAAAAATACTGAACTGACTGGG - Intronic
951324838 3:21288863-21288885 TAAATATGACTGAGCTGACATGG - Intergenic
951716243 3:25649995-25650017 GTAAAAAGACTGCATTGGCATGG - Intronic
951880057 3:27472104-27472126 TAACAAAGAAAGCACTGGCATGG + Intronic
952135849 3:30418168-30418190 CAAAAAAGACAGCACAGACTGGG + Intergenic
952602294 3:35099944-35099966 TAAAAAAGATTTTACTGACCTGG - Intergenic
953224573 3:41005595-41005617 TAAAAAAGGCTGCATTGCCATGG + Intergenic
954735488 3:52704161-52704183 AAAAAAAGACCGCACTGGCCGGG + Intronic
956091212 3:65668897-65668919 AAAAAAAGACAACATTGACATGG - Intronic
956210764 3:66799145-66799167 AAAAAAAGAATGCCCTGCCAAGG - Intergenic
957762882 3:84582377-84582399 TAAAAAAGAATGCATTGACATGG + Intergenic
957763047 3:84584482-84584504 TAGAAAAGACTTAACTGAGAAGG - Intergenic
958467029 3:94471577-94471599 TAAAAAAGCCTGCACATACGGGG + Intergenic
958779198 3:98521705-98521727 TAAAACAGACAACACTGAAATGG + Exonic
958870514 3:99553292-99553314 TAAAAAAGTCTCCAGTGACATGG - Intergenic
959007139 3:101032785-101032807 AAAAAAAGACTGCATTGTCTTGG + Intergenic
959072599 3:101716598-101716620 GAAAAAAGAATGCAATGTCAGGG + Intergenic
959426322 3:106193273-106193295 TAAAAGTGATTTCACTGACAAGG + Intergenic
959531504 3:107439357-107439379 TAAAAATGGCTTCACTGAGAGGG + Intergenic
959669567 3:108960858-108960880 TAAAAAAGACTGCATTGACATGG + Intronic
959739336 3:109698011-109698033 TAAAAGAGACTGCATTGACACGG - Intergenic
959819762 3:110719230-110719252 TAAAATAGAATGGATTGACAAGG - Intergenic
959962597 3:112316007-112316029 TAAAAAAAATTGCATAGACAAGG + Intergenic
960014828 3:112875124-112875146 TAAAAAAGAAGGCACTAATAAGG - Intergenic
960049386 3:113225581-113225603 TATATAATACTGCACTTACATGG - Intronic
960617071 3:119605792-119605814 TAAAAAACACTGAACAGAAAAGG - Intronic
960792070 3:121443573-121443595 TAAAAAAAACTGCACAGCAAAGG - Intronic
961421489 3:126808622-126808644 CCAAAAAGACTACATTGACATGG - Intronic
961928992 3:130513967-130513989 TAAAAAAGACTGCACTGACATGG + Intergenic
962515981 3:136152530-136152552 TAACACAGACTACACTGGCACGG - Exonic
963349573 3:144136001-144136023 TAAGAAAGACTGAAGTGAAAAGG + Intergenic
963838491 3:150080629-150080651 TAAATAGGGCTGAACTGACATGG + Intergenic
964257179 3:154789009-154789031 TTAAAAAGATTGTATTGACATGG + Intergenic
964306205 3:155342945-155342967 TATGAAAAAATGCACTGACATGG + Intergenic
964918783 3:161870667-161870689 GAAAAAAGACTGTGCTGATAAGG - Intergenic
964954809 3:162340246-162340268 TAAAAAAGAATGAATTAACATGG - Intergenic
966085929 3:176067226-176067248 GAAACAAGACTGCAGTGACGAGG + Intergenic
967581219 3:191157275-191157297 TAAAATAGACTGTATTGACATGG - Intergenic
969777956 4:9373562-9373584 AATAGAAGACTGCATTGACACGG + Intergenic
970466786 4:16332061-16332083 TAAAAAAGGTTGCATAGACATGG + Intergenic
970628297 4:17913821-17913843 TAAAAAAAATTGCATTGACATGG + Intronic
971399089 4:26258725-26258747 TAAAAAAGACTGCATCGATAGGG - Intronic
971745781 4:30578309-30578331 TTAAAGAAACTTCACTGACACGG - Intergenic
971860232 4:32092460-32092482 GTTAAAAGACTGCATTGACATGG - Intergenic
972141139 4:35960816-35960838 CAAAAGAGACTACATTGACATGG + Intronic
972253245 4:37327706-37327728 TATAAAAGACTACACTTAAAAGG - Intronic
972448274 4:39168373-39168395 TAAAAAAGACTGCATTGACTTGG + Intergenic
972695037 4:41436972-41436994 TAACAAAGAGTGCAATGAAAGGG - Intronic
972734458 4:41827105-41827127 TAAAAAAGACTGTACTGACATGG - Intergenic
973172269 4:47160513-47160535 TAAAACTGAATGCACTGAAAAGG - Intronic
974679558 4:65143680-65143702 TAAAAAAGACTGCATTTGCATGG - Intergenic
976283622 4:83349447-83349469 TTAAAAAGACTGCATTGACATGG + Intergenic
976586020 4:86798049-86798071 TAAAAAAGACTGCATTGATATGG - Intronic
976836322 4:89378662-89378684 TAAAAAAGCCTGCATCAACATGG + Intergenic
977057813 4:92215561-92215583 TAAAAGAGCCTACACTGACTTGG + Intergenic
977483703 4:97614237-97614259 TAGAGAATACTGCAATGACATGG - Intronic
977529821 4:98187209-98187231 TAATAAAAGCTGCAATGACAAGG - Intergenic
977733003 4:100378136-100378158 TGAAAAAGACTGCATTGACATGG + Intergenic
978160334 4:105539297-105539319 TTAAAAAGACTGCATTGACATGG - Intergenic
978332537 4:107630055-107630077 CAAAAAAGACTACATTGACATGG + Intronic
978490962 4:109311611-109311633 TAAAAAAGACTGCATTGACATGG + Intergenic
979359850 4:119748741-119748763 TAAAAAAGACTGCATTGACATGG - Intergenic
979563888 4:122132397-122132419 TAAAAAATACTGCATTGACTTGG + Intergenic
979574885 4:122278280-122278302 TGAAAAAGACTGCATTGTCATGG - Intronic
980218820 4:129887209-129887231 GTAAAAAAACTGCATTGACATGG + Intergenic
980820545 4:138010449-138010471 TAAAAAAGACTGCATTGACATGG - Intergenic
981689325 4:147489527-147489549 TGAAAAAGATTGTACTGAAACGG + Intronic
982263682 4:153518889-153518911 TATCAATGCCTGCACTGACATGG - Intronic
982470574 4:155785062-155785084 TAAAATAAACTAGACTGACAGGG + Intronic
983130772 4:164016496-164016518 TAAAAAAGAATGCAATAAAATGG + Intronic
983167095 4:164491095-164491117 TAAGAAAGACTGCATTGACATGG - Intergenic
983813967 4:172099459-172099481 TAAAAAAGGCTACATTGACATGG - Intronic
984061728 4:174996919-174996941 TAAAAAAGATTGCCTTGACATGG - Intergenic
984152815 4:176155496-176155518 TAAAAAAGATTGTATTGACATGG - Intronic
984421491 4:179528096-179528118 TTAAAATGACTACATTGACATGG - Intergenic
984981859 4:185289771-185289793 TAAAAAAGATTACAGTGGCAAGG - Intronic
985945008 5:3174729-3174751 AATAAAAGACTGCATTGCCAGGG + Intergenic
986137654 5:4997805-4997827 TAAAAACTTCTGCACAGACAAGG - Intergenic
986252004 5:6068652-6068674 TAAGAAAGACTGCATTGACATGG + Intergenic
987058238 5:14216784-14216806 TAAAAACAACTGTACTGACCAGG - Intronic
988004885 5:25396721-25396743 AAAAAAATACTGCATTCACATGG + Intergenic
988386760 5:30575114-30575136 GAAAAAAGACTGAAATGACATGG + Intergenic
988495496 5:31742116-31742138 AATAGAAGACTGCAATGACAGGG - Intronic
988556914 5:32244967-32244989 TAAAATAGACTGCAATGACATGG - Intronic
988828331 5:34962969-34962991 GAAAAAAGACTGCATTGACATGG - Intergenic
988901369 5:35736176-35736198 TAAAAAAGACTGCATTGACTTGG - Intronic
989114873 5:37942604-37942626 GAAAAAAGAATGAACAGACATGG - Intergenic
990590618 5:57259567-57259589 TAAAAAAGACAGCACTGACACGG - Intronic
990659045 5:57992172-57992194 TGTAAGATACTGCACTGACATGG - Intergenic
990709951 5:58569427-58569449 TAAAAATGATTGCATTAACATGG + Intergenic
991062754 5:62396125-62396147 AAAAAAAACCTGCAGTGACATGG - Intronic
991182319 5:63767024-63767046 TAAAGAAGACTGCATTGGCATGG - Intergenic
991236070 5:64398836-64398858 TAAAAAAGAATGCAGGGACATGG + Intergenic
991999538 5:72422104-72422126 TAAATTAGACTTCATTGACATGG - Intergenic
992475093 5:77094260-77094282 TAAGAAAGACTGCATTGACATGG - Intergenic
992684341 5:79185062-79185084 TAGAGAAGACTGCACTGTAATGG - Intronic
992967596 5:82019265-82019287 TTAAAAAGACTGCCCTGAAGAGG - Intronic
993299525 5:86190259-86190281 TAGAAAAGACTGCACTGGCAAGG + Intergenic
993922503 5:93824599-93824621 TAAAAAAGACTGCATTGACATGG - Intronic
994530812 5:100968176-100968198 TAAAGGTAACTGCACTGACATGG - Intergenic
994940217 5:106313980-106314002 TAAAAAAGACTCAGTTGACATGG - Intergenic
995375571 5:111470613-111470635 TAAAAAAGACTGCATTGACATGG - Intronic
995823991 5:116272194-116272216 ACAAAAAGACTGCACTGACATGG - Intronic
996138512 5:119874776-119874798 TAAAAAATACTACATTGACTTGG + Intergenic
996491282 5:124100653-124100675 AAAAAAAACTTGCACTGACAAGG + Intergenic
996598982 5:125239294-125239316 TAAAAGAGAGTGCATTGACAAGG - Intergenic
996675445 5:126169533-126169555 TTTAAAATACTGCATTGACATGG + Intergenic
996977794 5:129456124-129456146 TAAAAAAGACTGCATTGACATGG + Intergenic
997276086 5:132592321-132592343 TAAAAAAGACTACACTGACATGG - Intronic
997496351 5:134330171-134330193 TAAAAAGGACTACATTGACATGG - Intronic
997914612 5:137912094-137912116 TAAACAATGCTGCAGTGACATGG + Intronic
998346104 5:141465310-141465332 TAAAAAATACTGCATTGACATGG - Intronic
998597378 5:143547005-143547027 AAAAAAAGACTGCATTGATGTGG - Intergenic
998789946 5:145755531-145755553 TAAAAAAGACTGCATTGACCTGG + Intronic
998835597 5:146200246-146200268 TAAAAAAGACTGCATTGACATGG + Intergenic
1000111210 5:158109722-158109744 TAAAAAAAAATGCAATGCCATGG - Intergenic
1000490094 5:161902073-161902095 TAAAAAATACTTCATTTACATGG - Intergenic
1000908127 5:166988418-166988440 TCAAAAAGACTGCATTCAGAAGG - Intergenic
1001138632 5:169124145-169124167 TAAAAAAGATGGCATTGATATGG + Intronic
1002985870 6:2190657-2190679 CAAAAAAGACTGCACTCTCTTGG + Intronic
1003160385 6:3629370-3629392 TAAAAGGGACTGCACTGTCACGG - Intergenic
1003225076 6:4196902-4196924 TAAGAAAGACTGCATTGACATGG + Intergenic
1004225561 6:13781402-13781424 TAAAAAAGACTGCATTGATATGG + Intergenic
1004357751 6:14944833-14944855 TAAAACAAACTGCACTCACCTGG + Intergenic
1004946839 6:20624383-20624405 AAAAAAAGACAGCACAGAAAGGG - Intronic
1005438971 6:25844629-25844651 TAAAAAAGGCTGAAGGGACAAGG + Intronic
1007533670 6:42564917-42564939 AAAAAAAGATAGCACTGAAACGG - Intronic
1007889132 6:45270257-45270279 AAAAAAAGACTGCACTGACATGG - Intronic
1007974551 6:46087157-46087179 TAAAATAGACAGCACTGAGGTGG - Intergenic
1008312651 6:49995713-49995735 TAAAAAGGACTGCATTGATACGG - Intergenic
1008720630 6:54346089-54346111 TAAAAAAGTCTGTACTAAAATGG + Intronic
1009503325 6:64444221-64444243 GTAAAAAGGCTGCATTGACATGG + Intronic
1010099474 6:72087284-72087306 TAAAAAATACTGCATTGGCATGG - Intronic
1010126612 6:72439987-72440009 AAAAAAAGATGGCATTGACATGG + Intergenic
1010147785 6:72691962-72691984 TAAAACAATCTGTACTGACATGG - Intronic
1010706873 6:79125015-79125037 TAAAGAAGACTGCATTGGCATGG + Intergenic
1010907627 6:81511267-81511289 TGAAAAAGACTGCATTGACACGG - Intronic
1011214087 6:84986719-84986741 TAAGAAAGACTGAACTGATTCGG - Intergenic
1011863975 6:91797619-91797641 TAAAACACACTGCAGTGATAAGG - Intergenic
1012020076 6:93907173-93907195 GTAAAAAGACTGCATTCACATGG - Intergenic
1012943717 6:105443801-105443823 TATAAAAGACTGCATTGACATGG - Intergenic
1013176876 6:107685377-107685399 TATAAAAGACTTCATTGACATGG + Intergenic
1013392035 6:109695244-109695266 TAAAAAAGACTGCACCAATATGG - Intronic
1013460526 6:110371039-110371061 TAAAATAGACTGCCTTGACATGG + Intergenic
1013468770 6:110441878-110441900 TAAATAAGACTGCATTGACATGG + Intronic
1013885306 6:114957972-114957994 GAAAAAAGGCTGCAGTGTCAAGG + Intergenic
1013914738 6:115321946-115321968 TAAAAAAGACTTCATTAACATGG + Intergenic
1015145846 6:129985870-129985892 TAAAAAATACTGCACTGATACGG + Intergenic
1015419489 6:132989686-132989708 TAAAAAAGACTGCATTGACATGG + Intergenic
1015872276 6:137789467-137789489 TAAAAAAGAATAAACTGGCAGGG + Intergenic
1015900554 6:138061183-138061205 TAAAAAAGATTGTCTTGACATGG + Intergenic
1016148977 6:140714735-140714757 TAAAAAAGATGACATTGACATGG - Intergenic
1016218485 6:141634035-141634057 TAAAAAAGACTACAATGACATGG - Intergenic
1016588146 6:145712925-145712947 AAAACAAGACTGCATTGACATGG + Intronic
1017299434 6:152838819-152838841 TAAAAAAGGCTGCATTGATGTGG - Intergenic
1017313135 6:152997915-152997937 TAAAAAAGACTACATTGACATGG + Intronic
1017325695 6:153139363-153139385 CAAAAAAGACCTCACTGAGAAGG + Intergenic
1017344055 6:153358589-153358611 TTAAAAGGACTGCATTGACATGG + Intergenic
1018257580 6:161937140-161937162 TAAAAAAGAATGTACTGATGTGG + Intronic
1018591486 6:165429361-165429383 TAAGATAGACTGCACTGGCTAGG + Intronic
1019818607 7:3220888-3220910 TTAAATATACTGCATTGACATGG + Intergenic
1020845637 7:13278522-13278544 CAAAAAAGAGCGCATTGACATGG + Intergenic
1021283720 7:18752752-18752774 TGAAAAACAATGCACTGACCTGG - Intronic
1021291679 7:18852745-18852767 TTAGAGAAACTGCACTGACAGGG + Intronic
1021296775 7:18917862-18917884 TCAAAATGACTGCACTGAATAGG - Intronic
1021649150 7:22816092-22816114 TAAAAAAGATGACACTGAAAAGG + Intronic
1022513544 7:30960073-30960095 TAAAAAAGACTGCATTGACATGG + Intronic
1022882509 7:34602709-34602731 TAAGAAAGGCTGCATTAACATGG - Intergenic
1023222832 7:37937929-37937951 TAAAAAAGACTGCATTGACATGG - Intronic
1023364443 7:39449776-39449798 TAAAAAAAACTGAACTACCAAGG + Intronic
1024220287 7:47281732-47281754 GAAAAAAGACAACTCTGACAAGG + Intronic
1026180734 7:68037761-68037783 TAAAAAAGATTACATTGACATGG - Intergenic
1026515726 7:71069716-71069738 TTAAAAAGACGGCAATAACATGG + Intergenic
1027712072 7:81616901-81616923 TAAAAAAGATTGTACTGACATGG - Intergenic
1027712157 7:81618118-81618140 TGAAAAAGACTACACTGACATGG - Intergenic
1027801704 7:82760414-82760436 TAAAATAAACTCCACAGACAGGG + Intronic
1028296726 7:89142019-89142041 TAAAAAAGATAGCATTGACATGG - Intronic
1029173294 7:98645863-98645885 TAAAAAAGACTGGCCGGGCACGG - Intergenic
1029952211 7:104598852-104598874 TAAAAAGGATTGTATTGACAGGG + Intronic
1030010762 7:105164503-105164525 TAAAAAAGATTTCACTGACATGG + Intronic
1030054569 7:105571873-105571895 TAAAAAAGACTGCATTGACATGG + Intronic
1031344857 7:120652367-120652389 TAAGATAGACTGCACTGGCCAGG - Intronic
1031467229 7:122127446-122127468 TAAAAAAAACTGACCTAACAGGG - Intronic
1032484494 7:132274751-132274773 AAAAAAAGGATGCACTGAGAAGG - Intronic
1032625671 7:133589159-133589181 TAAAAAAGATGGCACTGACACGG - Intronic
1033287170 7:140051327-140051349 GAAAAAAGACTGGATTGACATGG - Intronic
1033506360 7:142006161-142006183 TAAAAAAGACTGCATTACAAAGG - Intronic
1034481761 7:151326614-151326636 TGAAAAAGACTGCATTGACATGG - Intergenic
1035834043 8:2728898-2728920 TAAAAAAGACTGCATTGATTTGG - Intergenic
1036275412 8:7347529-7347551 AATAGAAGACTGCATTGACACGG + Intergenic
1036345945 8:7962830-7962852 AAAAGAAGACTGCATTGACACGG - Intergenic
1036751426 8:11445857-11445879 TAAAAAAGAATGAATTGATATGG + Intronic
1036841268 8:12123582-12123604 AATAGAAGACTGCATTGACACGG - Intergenic
1036863078 8:12369835-12369857 AAAAGAAGACTGCATTGACACGG - Intergenic
1037362822 8:18091885-18091907 TAATAAAGACTGCATTGACATGG - Intergenic
1037391761 8:18400297-18400319 TAACAAATACAGCACTGGCATGG + Exonic
1039402844 8:37286037-37286059 TGAAAAAGACTGCATTGACATGG + Intergenic
1039802604 8:40972874-40972896 CAAAAAAGACTGCATTGACATGG + Intergenic
1040692741 8:49959326-49959348 TAAATAGGACTCCACTGACTTGG + Intronic
1041160728 8:55040794-55040816 TAAAAAAGACTGCATTGACATGG - Intergenic
1041249151 8:55918043-55918065 TAAGCAAGGCTGCACTGAGAAGG + Intronic
1041309365 8:56498871-56498893 TCAAAAAGACTACATTGACATGG - Intergenic
1041589699 8:59563237-59563259 TAAAAAGGACTTCATTGACATGG + Intergenic
1041769800 8:61460414-61460436 TAAAAAAGACTACATTGACATGG - Intronic
1041802255 8:61813063-61813085 TATTAAAGACAGCACTGGCAGGG - Intergenic
1041913030 8:63109897-63109919 TAAAAAAGACTACATTCACATGG + Intergenic
1041991482 8:63997530-63997552 TAAAAAAGACTACATTGACATGG + Intergenic
1042623030 8:70727034-70727056 TAAAAAAGACTGCATTGACATGG + Intronic
1042767137 8:72334879-72334901 TAAAAGTGACTGCACTGGCCGGG - Intergenic
1042767614 8:72342894-72342916 TTTAAAAGATTGCACTGACATGG + Intergenic
1043115084 8:76240820-76240842 TTAAAAAGACTACATTGACATGG - Intergenic
1043959675 8:86402586-86402608 TAAGAAAGACTGCACAGGCTGGG - Intronic
1044057832 8:87594412-87594434 TAAAAAGGACTCCATTAACATGG - Intronic
1044232112 8:89790549-89790571 AAAAAAATACTGCAGTGTCATGG - Exonic
1044889599 8:96819373-96819395 TAAAAAAGACTGCAATGATATGG - Intronic
1044926323 8:97212053-97212075 TAAGAAAGTCTGCATGGACATGG - Intergenic
1045413889 8:101947537-101947559 TAAAAAAGACTGCATTGACATGG + Intronic
1045831957 8:106472693-106472715 GAAAAAAGACTGGAGTGACACGG - Intronic
1045895522 8:107211408-107211430 TAAAAAAGACTGCATTGGCATGG + Intergenic
1046305938 8:112366802-112366824 TAAAAAAGATGGCATTGACATGG + Intronic
1046341002 8:112854212-112854234 TATGAATGACTACACTGACAAGG - Intronic
1046843803 8:118892059-118892081 TAAAAAAGATTGCATTGAAATGG + Intergenic
1048121996 8:131592029-131592051 TTAAAAAGATTGCATTGACATGG - Intergenic
1048489046 8:134874908-134874930 GTTAAAAGACTGCATTGACATGG - Intergenic
1049134845 8:140887128-140887150 TAATAATAACTGGACTGACAAGG + Intronic
1049396050 8:142401414-142401436 GAAAAATGACTGCACTGTCAGGG + Intronic
1050050495 9:1596093-1596115 GATAAAAGACTACACAGACAAGG - Intergenic
1051227495 9:14916883-14916905 TTAAAAAGACTGCATTGATATGG + Intergenic
1052284578 9:26770447-26770469 AAAAAAAGACTATATTGACATGG - Intergenic
1052654734 9:31342713-31342735 TAAAAAAGATTGCATTGACATGG - Intergenic
1052817268 9:33111429-33111451 TAGAAATGACTGCATTGAGAGGG - Exonic
1053187469 9:36029734-36029756 TAAAGAAGATTGCACAGAGATGG - Intergenic
1053192368 9:36083332-36083354 AAAAAGAGAAGGCACTGACATGG - Intronic
1055605337 9:77963943-77963965 TAAAAAAGACTGCCTTGACATGG + Intronic
1055795637 9:79972269-79972291 TAAAGAAGACTTCTCTGAGAAGG + Intergenic
1056526994 9:87452749-87452771 GAGAAAAGATTCCACTGACAAGG - Intergenic
1056572960 9:87832190-87832212 TAAAAAAGACTGCCTTGGCAGGG + Intergenic
1056775448 9:89508897-89508919 AAAAAAAGAATGCCATGACAGGG - Intergenic
1056811685 9:89769843-89769865 TAAAAAAGACTGCATTGACATGG + Intergenic
1057229865 9:93314662-93314684 TAAAAAAGACTCCATGGCCATGG - Intronic
1057573377 9:96220380-96220402 TAAAAAGGAATGCACTGGCCGGG + Intergenic
1058227848 9:102388879-102388901 TAAAAAAGAGTGTACAGGCAGGG + Intergenic
1058331354 9:103764872-103764894 TAGAAAAGACTGCATTGGCATGG - Intergenic
1058343899 9:103935104-103935126 TAGATAAGTCTGCACTGACAAGG - Intergenic
1203624692 Un_KI270750v1:3037-3059 TAAAAAAGACTACCTTGACATGG - Intergenic
1186166134 X:6828019-6828041 TAAAAATGTATGCACTAACAGGG + Intergenic
1186457875 X:9724649-9724671 TAAAAAAGACTGCACTGACATGG + Intergenic
1186628723 X:11324646-11324668 TAAAAAAGATTGCAATGACATGG + Intronic
1186691637 X:11983953-11983975 TAAAAAAGACTACACTGGCATGG - Intergenic
1187503714 X:19861613-19861635 TGAAAAAGACTGCATTGACATGG - Intronic
1188028349 X:25234926-25234948 TAAATAAGACTGCATTGACCCGG + Intergenic
1188120254 X:26297316-26297338 AAAAAAAGACTGCATTCACCTGG + Intergenic
1188151163 X:26677637-26677659 TTTAAAAGAATGCATTGACATGG - Intergenic
1188153808 X:26715770-26715792 TAAAAAAGATTGCATTAATATGG - Intergenic
1188266071 X:28076384-28076406 TAAAAAAGACTGTATTAATATGG + Intergenic
1188910949 X:35846949-35846971 TAAAAAAGACTGCATTGTAATGG - Intergenic
1188913632 X:35882153-35882175 TCCAAAAGACTGCACAGACTTGG - Intergenic
1188943861 X:36272651-36272673 TAATAAAGACTGCTTTGACATGG + Intronic
1189660307 X:43289821-43289843 AAAACAAGACTGCATTGATATGG - Intergenic
1189766450 X:44377347-44377369 AAAAGAAGACTGCACTGAGGAGG + Intergenic
1189834671 X:45007413-45007435 TAAAAAAGACTGCATTGACATGG + Intronic
1189951346 X:46234405-46234427 TAAAAATGACTGTACTGTCCAGG + Intergenic
1190034958 X:47013592-47013614 CAAAAAAGACTGCACTGACATGG - Intronic
1190908758 X:54753238-54753260 TATAAAATACTGCATTAACATGG + Intronic
1192030120 X:67501749-67501771 TAAACAAGACTCCACTGTCTTGG - Intergenic
1192531146 X:71887363-71887385 TACAAAAGACTGCATTGACATGG + Intergenic
1192594413 X:72391389-72391411 TATAAATTACTGCACTGTCAAGG - Intronic
1193132614 X:77933306-77933328 TAAAAAAAACTGTAGAGACAGGG + Intronic
1193435546 X:81470950-81470972 TAAAAGAGCCTGCATTGCCAAGG - Intergenic
1193565577 X:83072387-83072409 AAAAAAAGACTATATTGACATGG - Intergenic
1194548371 X:95267150-95267172 AAGAAAAGACTACATTGACATGG + Intergenic
1194950297 X:100118029-100118051 TAAAAAAAATTGCAAAGACAGGG + Intergenic
1195865833 X:109431923-109431945 GAAAAAAAACTGCACTGGCCAGG + Intronic
1197323697 X:125065523-125065545 TAAAAAAGACTGCATTGACATGG + Intergenic
1197574409 X:128192476-128192498 TAAAAAAGACTTCACAGATATGG - Intergenic
1198668550 X:139052382-139052404 TAAAAAAGACTGCAGTGACATGG - Intronic
1198783541 X:140261929-140261951 TGAATAAGACTACACTGAAAAGG + Intergenic
1199690495 X:150305663-150305685 TAAAGGAGGCTGAACTGACAGGG - Intergenic
1199949154 X:152692431-152692453 GTAAAAGGACTGCACTGACGTGG - Intergenic
1199960522 X:152776018-152776040 GTAAAAGGACTGCACTGACGTGG + Intergenic
1200768226 Y:7099310-7099332 TAGAAAAGACTGCATTGACATGG + Intergenic
1201360477 Y:13142034-13142056 TAATAAAAACAGCACAGACATGG + Intergenic