ID: 1113529223

View in Genome Browser
Species Human (GRCh38)
Location 13:111008230-111008252
Sequence CATTATTAACTGGGAAAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113529217_1113529223 30 Left 1113529217 13:111008177-111008199 CCTAAAGAACTAAGTGTCCTGGG No data
Right 1113529223 13:111008230-111008252 CATTATTAACTGGGAAAAAATGG No data
1113529220_1113529223 0 Left 1113529220 13:111008207-111008229 CCATGTCAGTGCAGTCTTTTTTA 0: 7
1: 45
2: 91
3: 130
4: 386
Right 1113529223 13:111008230-111008252 CATTATTAACTGGGAAAAAATGG No data
1113529219_1113529223 13 Left 1113529219 13:111008194-111008216 CCTGGGAATTTAACCATGTCAGT 0: 11
1: 59
2: 138
3: 144
4: 244
Right 1113529223 13:111008230-111008252 CATTATTAACTGGGAAAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113529223 Original CRISPR CATTATTAACTGGGAAAAAA TGG Intergenic
No off target data available for this crispr