ID: 1113529751

View in Genome Browser
Species Human (GRCh38)
Location 13:111014228-111014250
Sequence ATAGTTCACCTCTGCTCTAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113529750_1113529751 20 Left 1113529750 13:111014185-111014207 CCATTCAATATGTTTTTGAGTTT No data
Right 1113529751 13:111014228-111014250 ATAGTTCACCTCTGCTCTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113529751 Original CRISPR ATAGTTCACCTCTGCTCTAT AGG Intergenic
No off target data available for this crispr