ID: 1113534720

View in Genome Browser
Species Human (GRCh38)
Location 13:111056598-111056620
Sequence TGGCAAATAGCAGCAGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113534720_1113534727 23 Left 1113534720 13:111056598-111056620 CCATCCACTGCTGCTATTTGCCA No data
Right 1113534727 13:111056644-111056666 TCCATCTCTCCAGATCCGGCAGG No data
1113534720_1113534726 19 Left 1113534720 13:111056598-111056620 CCATCCACTGCTGCTATTTGCCA No data
Right 1113534726 13:111056640-111056662 GACTTCCATCTCTCCAGATCCGG No data
1113534720_1113534729 24 Left 1113534720 13:111056598-111056620 CCATCCACTGCTGCTATTTGCCA No data
Right 1113534729 13:111056645-111056667 CCATCTCTCCAGATCCGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113534720 Original CRISPR TGGCAAATAGCAGCAGTGGA TGG (reversed) Intergenic
No off target data available for this crispr