ID: 1113537860

View in Genome Browser
Species Human (GRCh38)
Location 13:111082377-111082399
Sequence CAGGGCAGCCAGGAGGACGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113537860_1113537869 17 Left 1113537860 13:111082377-111082399 CCAGCGTCCTCCTGGCTGCCCTG No data
Right 1113537869 13:111082417-111082439 GCTGCAGGCATCCACTTGCGGGG No data
1113537860_1113537871 19 Left 1113537860 13:111082377-111082399 CCAGCGTCCTCCTGGCTGCCCTG No data
Right 1113537871 13:111082419-111082441 TGCAGGCATCCACTTGCGGGGGG No data
1113537860_1113537873 29 Left 1113537860 13:111082377-111082399 CCAGCGTCCTCCTGGCTGCCCTG No data
Right 1113537873 13:111082429-111082451 CACTTGCGGGGGGTGTCATCTGG No data
1113537860_1113537867 15 Left 1113537860 13:111082377-111082399 CCAGCGTCCTCCTGGCTGCCCTG No data
Right 1113537867 13:111082415-111082437 ATGCTGCAGGCATCCACTTGCGG No data
1113537860_1113537868 16 Left 1113537860 13:111082377-111082399 CCAGCGTCCTCCTGGCTGCCCTG No data
Right 1113537868 13:111082416-111082438 TGCTGCAGGCATCCACTTGCGGG No data
1113537860_1113537865 2 Left 1113537860 13:111082377-111082399 CCAGCGTCCTCCTGGCTGCCCTG No data
Right 1113537865 13:111082402-111082424 TGAAGCTGTCCTAATGCTGCAGG No data
1113537860_1113537870 18 Left 1113537860 13:111082377-111082399 CCAGCGTCCTCCTGGCTGCCCTG No data
Right 1113537870 13:111082418-111082440 CTGCAGGCATCCACTTGCGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113537860 Original CRISPR CAGGGCAGCCAGGAGGACGC TGG (reversed) Intergenic
No off target data available for this crispr