ID: 1113539479

View in Genome Browser
Species Human (GRCh38)
Location 13:111095165-111095187
Sequence GTGGACTGGCCAGCACCCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113539479_1113539494 18 Left 1113539479 13:111095165-111095187 CCAGGGGGTGCTGGCCAGTCCAC No data
Right 1113539494 13:111095206-111095228 GAGGCTGCCGGTTGCTGGTGGGG No data
1113539479_1113539483 -10 Left 1113539479 13:111095165-111095187 CCAGGGGGTGCTGGCCAGTCCAC No data
Right 1113539483 13:111095178-111095200 GCCAGTCCACGGGGACAGCCTGG No data
1113539479_1113539497 28 Left 1113539479 13:111095165-111095187 CCAGGGGGTGCTGGCCAGTCCAC No data
Right 1113539497 13:111095216-111095238 GTTGCTGGTGGGGCCTCCGGAGG No data
1113539479_1113539492 16 Left 1113539479 13:111095165-111095187 CCAGGGGGTGCTGGCCAGTCCAC No data
Right 1113539492 13:111095204-111095226 AGGAGGCTGCCGGTTGCTGGTGG No data
1113539479_1113539487 -4 Left 1113539479 13:111095165-111095187 CCAGGGGGTGCTGGCCAGTCCAC No data
Right 1113539487 13:111095184-111095206 CCACGGGGACAGCCTGGGAGAGG No data
1113539479_1113539496 25 Left 1113539479 13:111095165-111095187 CCAGGGGGTGCTGGCCAGTCCAC No data
Right 1113539496 13:111095213-111095235 CCGGTTGCTGGTGGGGCCTCCGG No data
1113539479_1113539485 -9 Left 1113539479 13:111095165-111095187 CCAGGGGGTGCTGGCCAGTCCAC No data
Right 1113539485 13:111095179-111095201 CCAGTCCACGGGGACAGCCTGGG No data
1113539479_1113539493 17 Left 1113539479 13:111095165-111095187 CCAGGGGGTGCTGGCCAGTCCAC No data
Right 1113539493 13:111095205-111095227 GGAGGCTGCCGGTTGCTGGTGGG No data
1113539479_1113539488 -1 Left 1113539479 13:111095165-111095187 CCAGGGGGTGCTGGCCAGTCCAC No data
Right 1113539488 13:111095187-111095209 CGGGGACAGCCTGGGAGAGGAGG No data
1113539479_1113539491 13 Left 1113539479 13:111095165-111095187 CCAGGGGGTGCTGGCCAGTCCAC No data
Right 1113539491 13:111095201-111095223 GAGAGGAGGCTGCCGGTTGCTGG No data
1113539479_1113539489 6 Left 1113539479 13:111095165-111095187 CCAGGGGGTGCTGGCCAGTCCAC No data
Right 1113539489 13:111095194-111095216 AGCCTGGGAGAGGAGGCTGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113539479 Original CRISPR GTGGACTGGCCAGCACCCCC TGG (reversed) Intergenic
No off target data available for this crispr