ID: 1113539483

View in Genome Browser
Species Human (GRCh38)
Location 13:111095178-111095200
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113539468_1113539483 29 Left 1113539468 13:111095126-111095148 CCCAGGCTCGACAGGGAGGGACT No data
Right 1113539483 13:111095178-111095200 GCCAGTCCACGGGGACAGCCTGG No data
1113539469_1113539483 28 Left 1113539469 13:111095127-111095149 CCAGGCTCGACAGGGAGGGACTG No data
Right 1113539483 13:111095178-111095200 GCCAGTCCACGGGGACAGCCTGG No data
1113539478_1113539483 -9 Left 1113539478 13:111095164-111095186 CCCAGGGGGTGCTGGCCAGTCCA No data
Right 1113539483 13:111095178-111095200 GCCAGTCCACGGGGACAGCCTGG No data
1113539475_1113539483 5 Left 1113539475 13:111095150-111095172 CCAGGCTGCTGGAGCCCAGGGGG No data
Right 1113539483 13:111095178-111095200 GCCAGTCCACGGGGACAGCCTGG No data
1113539479_1113539483 -10 Left 1113539479 13:111095165-111095187 CCAGGGGGTGCTGGCCAGTCCAC No data
Right 1113539483 13:111095178-111095200 GCCAGTCCACGGGGACAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113539483 Original CRISPR GCCAGTCCACGGGGACAGCC TGG Intergenic
No off target data available for this crispr