ID: 1113539487

View in Genome Browser
Species Human (GRCh38)
Location 13:111095184-111095206
Sequence CCACGGGGACAGCCTGGGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113539478_1113539487 -3 Left 1113539478 13:111095164-111095186 CCCAGGGGGTGCTGGCCAGTCCA No data
Right 1113539487 13:111095184-111095206 CCACGGGGACAGCCTGGGAGAGG No data
1113539479_1113539487 -4 Left 1113539479 13:111095165-111095187 CCAGGGGGTGCTGGCCAGTCCAC No data
Right 1113539487 13:111095184-111095206 CCACGGGGACAGCCTGGGAGAGG No data
1113539475_1113539487 11 Left 1113539475 13:111095150-111095172 CCAGGCTGCTGGAGCCCAGGGGG No data
Right 1113539487 13:111095184-111095206 CCACGGGGACAGCCTGGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113539487 Original CRISPR CCACGGGGACAGCCTGGGAG AGG Intergenic
No off target data available for this crispr