ID: 1113539489

View in Genome Browser
Species Human (GRCh38)
Location 13:111095194-111095216
Sequence AGCCTGGGAGAGGAGGCTGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113539475_1113539489 21 Left 1113539475 13:111095150-111095172 CCAGGCTGCTGGAGCCCAGGGGG No data
Right 1113539489 13:111095194-111095216 AGCCTGGGAGAGGAGGCTGCCGG No data
1113539484_1113539489 -8 Left 1113539484 13:111095179-111095201 CCAGTCCACGGGGACAGCCTGGG No data
Right 1113539489 13:111095194-111095216 AGCCTGGGAGAGGAGGCTGCCGG No data
1113539478_1113539489 7 Left 1113539478 13:111095164-111095186 CCCAGGGGGTGCTGGCCAGTCCA No data
Right 1113539489 13:111095194-111095216 AGCCTGGGAGAGGAGGCTGCCGG No data
1113539479_1113539489 6 Left 1113539479 13:111095165-111095187 CCAGGGGGTGCTGGCCAGTCCAC No data
Right 1113539489 13:111095194-111095216 AGCCTGGGAGAGGAGGCTGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113539489 Original CRISPR AGCCTGGGAGAGGAGGCTGC CGG Intergenic
No off target data available for this crispr