ID: 1113539494

View in Genome Browser
Species Human (GRCh38)
Location 13:111095206-111095228
Sequence GAGGCTGCCGGTTGCTGGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113539478_1113539494 19 Left 1113539478 13:111095164-111095186 CCCAGGGGGTGCTGGCCAGTCCA No data
Right 1113539494 13:111095206-111095228 GAGGCTGCCGGTTGCTGGTGGGG No data
1113539479_1113539494 18 Left 1113539479 13:111095165-111095187 CCAGGGGGTGCTGGCCAGTCCAC No data
Right 1113539494 13:111095206-111095228 GAGGCTGCCGGTTGCTGGTGGGG No data
1113539486_1113539494 -1 Left 1113539486 13:111095184-111095206 CCACGGGGACAGCCTGGGAGAGG No data
Right 1113539494 13:111095206-111095228 GAGGCTGCCGGTTGCTGGTGGGG No data
1113539484_1113539494 4 Left 1113539484 13:111095179-111095201 CCAGTCCACGGGGACAGCCTGGG No data
Right 1113539494 13:111095206-111095228 GAGGCTGCCGGTTGCTGGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113539494 Original CRISPR GAGGCTGCCGGTTGCTGGTG GGG Intergenic
No off target data available for this crispr