ID: 1113539641

View in Genome Browser
Species Human (GRCh38)
Location 13:111096209-111096231
Sequence CCCCTCCACCAGAAGTTGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113539634_1113539641 13 Left 1113539634 13:111096173-111096195 CCTTCATCTCTAACCAGTTTCCT No data
Right 1113539641 13:111096209-111096231 CCCCTCCACCAGAAGTTGTTTGG No data
1113539637_1113539641 0 Left 1113539637 13:111096186-111096208 CCAGTTTCCTGAGCTAAGGGAAC No data
Right 1113539641 13:111096209-111096231 CCCCTCCACCAGAAGTTGTTTGG No data
1113539638_1113539641 -7 Left 1113539638 13:111096193-111096215 CCTGAGCTAAGGGAACCCCCTCC No data
Right 1113539641 13:111096209-111096231 CCCCTCCACCAGAAGTTGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113539641 Original CRISPR CCCCTCCACCAGAAGTTGTT TGG Intergenic
No off target data available for this crispr