ID: 1113541284

View in Genome Browser
Species Human (GRCh38)
Location 13:111111813-111111835
Sequence CAGCCAGATGGCACGGCCTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 139}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113541277_1113541284 -4 Left 1113541277 13:111111794-111111816 CCCAAGACACATCTCTCCCCAGC 0: 1
1: 0
2: 3
3: 13
4: 289
Right 1113541284 13:111111813-111111835 CAGCCAGATGGCACGGCCTTAGG 0: 1
1: 0
2: 0
3: 7
4: 139
1113541278_1113541284 -5 Left 1113541278 13:111111795-111111817 CCAAGACACATCTCTCCCCAGCC 0: 1
1: 0
2: 5
3: 45
4: 358
Right 1113541284 13:111111813-111111835 CAGCCAGATGGCACGGCCTTAGG 0: 1
1: 0
2: 0
3: 7
4: 139
1113541276_1113541284 9 Left 1113541276 13:111111781-111111803 CCAGGGGGAGAATCCCAAGACAC 0: 1
1: 0
2: 0
3: 10
4: 122
Right 1113541284 13:111111813-111111835 CAGCCAGATGGCACGGCCTTAGG 0: 1
1: 0
2: 0
3: 7
4: 139
1113541271_1113541284 26 Left 1113541271 13:111111764-111111786 CCTTGGAAAGCAGATGCCCAGGG 0: 1
1: 0
2: 1
3: 41
4: 295
Right 1113541284 13:111111813-111111835 CAGCCAGATGGCACGGCCTTAGG 0: 1
1: 0
2: 0
3: 7
4: 139
1113541275_1113541284 10 Left 1113541275 13:111111780-111111802 CCCAGGGGGAGAATCCCAAGACA 0: 1
1: 0
2: 1
3: 17
4: 170
Right 1113541284 13:111111813-111111835 CAGCCAGATGGCACGGCCTTAGG 0: 1
1: 0
2: 0
3: 7
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113541284 Original CRISPR CAGCCAGATGGCACGGCCTT AGG Intergenic
900755128 1:4429286-4429308 CAGCCAGATGGGAGGTGCTTAGG - Intergenic
901033463 1:6322074-6322096 CAGCCAGTTCGCACGACCTGTGG - Intronic
901323868 1:8355743-8355765 CAGCCAGAGGGCAGAGCCTCTGG + Intronic
903534943 1:24060649-24060671 GAGGCACATGGCACGGCCTCCGG - Intronic
904972615 1:34430873-34430895 CAGCCAGATTCCAGGCCCTTAGG + Intergenic
912572918 1:110637644-110637666 CAGCCTGATGAGACAGCCTTTGG + Intergenic
913085448 1:115432502-115432524 TGGCCAGATGGCTCGGTCTTTGG - Intergenic
915537130 1:156543561-156543583 CAGGAAGATGGCACTCCCTTGGG + Intronic
918386853 1:184017431-184017453 CAGCCAGACGGCAGAGCCTTTGG + Intronic
921069827 1:211649613-211649635 CAGCCAGAGGGCAGGGCAGTAGG + Intergenic
922810568 1:228413399-228413421 CAGCCAGAGGGCAGGGGCGTAGG - Intronic
924729309 1:246697247-246697269 CAGAAAGAAGGCACTGCCTTCGG - Intergenic
1070447814 10:76524774-76524796 CAGCGAGATGGCACTGCCACTGG - Intronic
1071519162 10:86318420-86318442 CAGGCAGAGGGCAGGACCTTCGG - Intronic
1074865032 10:117539949-117539971 CAGCCAGATGTCCCTGCCTGGGG + Intergenic
1077141059 11:1025110-1025132 GAGACAGATGGCACGGCCCCTGG - Intronic
1077268001 11:1661466-1661488 CAGCCAGATGCCACGGGATGTGG - Intergenic
1077272918 11:1690266-1690288 CAGCCAGATGCCACGGGATGTGG + Intergenic
1077372679 11:2190851-2190873 CAGGCAGCTGGCACGGGCTCGGG - Intergenic
1077935512 11:6781623-6781645 CAGACAGTTGGCAGGGGCTTGGG + Intergenic
1078962734 11:16297815-16297837 CAGCCAGTTTGCACAGCCTCAGG + Intronic
1083730266 11:64648955-64648977 CAGCCAGATGCCATTGTCTTGGG - Intronic
1084698642 11:70771407-70771429 CATCCAGATGCCACTGCCCTGGG - Intronic
1084943439 11:72626359-72626381 CAGACAGATGGCAGGGCCTCAGG + Intronic
1086926833 11:92649719-92649741 AAGCCAGATGGGTCTGCCTTAGG + Intronic
1088805779 11:113350792-113350814 CAGCCAGCTGGCACGGGCCGGGG + Intronic
1088873035 11:113909139-113909161 CAGCCAGCTGGTGGGGCCTTTGG - Intronic
1089739703 11:120573908-120573930 AAGGCTGATGGCAGGGCCTTCGG + Intronic
1089773129 11:120817338-120817360 CAGCCAGACTGCACTGCCCTGGG + Intronic
1090274848 11:125411960-125411982 CAGACAGAGGGCGCGGCCTCGGG + Intronic
1090784067 11:130033010-130033032 CAGCCAAACGGCACGGCCGCAGG - Intergenic
1091566541 12:1652919-1652941 CTGACAGATATCACGGCCTTAGG + Intergenic
1095956799 12:47811353-47811375 CAGACAGATGGCATGGTCCTGGG + Intronic
1096409687 12:51368231-51368253 CAGGGAAATGGCAAGGCCTTGGG - Intronic
1097754522 12:63394523-63394545 CAGGTAGATGGCACAGCCCTGGG + Intergenic
1098103392 12:67042995-67043017 CAGGCAGATGGCACCACCCTGGG - Intergenic
1100771523 12:97928146-97928168 CAGCCAGACAGCACACCCTTGGG - Intergenic
1100774323 12:97957728-97957750 CAGCAAAATGTCAGGGCCTTTGG - Intergenic
1101834183 12:108283682-108283704 CAGCAAGATGGCAGGGACTTTGG - Intergenic
1102487872 12:113270398-113270420 CAGCCAGAAGGCACCACCTATGG - Intronic
1102865365 12:116369922-116369944 CAGGCAGATGGAACAGCCTGTGG + Intergenic
1104441624 12:128797884-128797906 CAGCCAGGGGGCACAGCCTGGGG + Intronic
1104822659 12:131687232-131687254 CAGCCCGACTGCAGGGCCTTTGG - Intergenic
1106194693 13:27483279-27483301 CTGCAAGCTGGCAAGGCCTTGGG - Intergenic
1113541284 13:111111813-111111835 CAGCCAGATGGCACGGCCTTAGG + Intergenic
1123880093 15:24670671-24670693 CAGTCAGATGGGACAGCCATGGG + Intergenic
1130059690 15:80560523-80560545 CACACAGAAGGCACGACCTTAGG - Intronic
1130094341 15:80844823-80844845 AAGCCAGGTGGCCCAGCCTTGGG + Intronic
1130230408 15:82092618-82092640 CAGGCAGATGGACTGGCCTTTGG + Intergenic
1135490668 16:22906530-22906552 CAGCCACAGGGCAGAGCCTTGGG + Intronic
1136632701 16:31498298-31498320 AAGCCAGATGGCACAACCCTCGG + Intronic
1141029247 16:80573483-80573505 GAGCCAGCTGGGACTGCCTTGGG + Intergenic
1141648351 16:85379210-85379232 CTGCCAGATGGCACTGCATGCGG - Intergenic
1142169210 16:88611727-88611749 AGGGCAGATGTCACGGCCTTGGG - Intronic
1142236572 16:88925234-88925256 CAGGCAGATGGGCCGGGCTTGGG + Intronic
1142283082 16:89159680-89159702 CGGCCAGAGGGGACGACCTTGGG - Intergenic
1143460922 17:7102895-7102917 CAGCCAGTTGCCAGGGGCTTGGG + Intronic
1143980095 17:10861483-10861505 CCGCCAGATGGAAAGGCCGTTGG + Intergenic
1145265843 17:21379272-21379294 CAGCCATATGCCAAGGCCTCCGG - Intronic
1146974974 17:37103451-37103473 TAGCCAGATTGCAGGGCCTCAGG + Intronic
1148155176 17:45419965-45419987 CAGTCAGTTGGCAAGGCTTTGGG + Intronic
1149869538 17:60169448-60169470 CACCCAGATGGTACCCCCTTGGG - Intronic
1151968952 17:77447454-77447476 CAGCCAGATCCCATGGCCTGTGG + Intronic
1152081322 17:78189134-78189156 CAGCCTCATGGCAAGGCCTGAGG - Intronic
1152259780 17:79260678-79260700 CAGCCAGCTTGCCCGGCCTTGGG + Intronic
1153948574 18:10038077-10038099 AAGCCAGATTGCAGGGCCTCGGG - Intergenic
1156353528 18:36321971-36321993 CAGCCAGGTGGCCCTGCCTCTGG - Intronic
1161493434 19:4575202-4575224 AAGAAAGATGGCCCGGCCTTTGG + Intergenic
1162472641 19:10881631-10881653 CAGCCAGATGGCAGGTCTTGGGG + Intronic
1165113145 19:33513669-33513691 AAGCCAGCTGGCACGGGGTTGGG - Intronic
926053406 2:9759022-9759044 CAGCCAGAAGGCATGGGCATGGG - Intergenic
928379164 2:30803055-30803077 CAGTCGGATGGCATGGCCCTGGG - Intronic
930021549 2:47004800-47004822 CAGCCACAGGGCAGGGACTTAGG - Intronic
932817254 2:74871868-74871890 CAGCAAGATGGGCTGGCCTTTGG + Intronic
934993670 2:98938159-98938181 CAGCCACTTGGCAGGGCCCTGGG - Intergenic
935739957 2:106138636-106138658 GAACCAGATGGAATGGCCTTTGG - Intronic
938239001 2:129728573-129728595 AAGGCAGATGGTAGGGCCTTGGG + Intergenic
942965096 2:181882760-181882782 CAGTCACATGGGATGGCCTTTGG - Intergenic
946190328 2:218004383-218004405 CAGCGGCATGGCATGGCCTTGGG - Intergenic
947503715 2:230690993-230691015 CAGCCAGCAGGCACTGCCTGGGG + Intergenic
947954712 2:234178759-234178781 CAGCCAGAAGCCACAGCATTAGG - Intergenic
948488892 2:238298745-238298767 CAGCCAGAGAGCAAGGCATTGGG + Intergenic
1169258831 20:4120485-4120507 CAGCCAGATTCCAGGGGCTTGGG + Intergenic
1173584926 20:44175437-44175459 GAGCCAGAGAGCAAGGCCTTGGG - Intronic
1173591674 20:44229652-44229674 CACCAGGATGCCACGGCCTTTGG - Intergenic
1173663600 20:44750651-44750673 CAGCCAGAGGCCACGGCTCTCGG - Exonic
1174042772 20:47711509-47711531 CAGCCAGATGGCCCGTCGTGGGG - Intronic
1180651068 22:17377538-17377560 CAGGCACATGCCACTGCCTTTGG + Intronic
1181165322 22:20980091-20980113 CTTCCGGATGGCACGGCCTGAGG - Exonic
1181775310 22:25154921-25154943 CAGCCAGAAGGAACAGCCTGGGG - Intronic
1182566736 22:31205767-31205789 AAGCCAGGTGGCAGGGCCTTGGG + Exonic
1185172156 22:49300374-49300396 CAGACGGATGGCGTGGCCTTTGG - Intergenic
949466807 3:4352765-4352787 CAGACAGATGGCCCTGCCATGGG - Intronic
952377320 3:32778598-32778620 CAGGCAGATGGCAGTGCATTGGG - Intergenic
952527172 3:34222794-34222816 CAGCAAGATGGCAAGGTCTGAGG + Intergenic
953335063 3:42087472-42087494 CAGCCACATGGGAGGGTCTTGGG + Intronic
953666718 3:44930806-44930828 CAGCCTGATGGCCTGGCCGTGGG + Intronic
953706508 3:45235058-45235080 CAGAGAGATGGCTGGGCCTTTGG - Intergenic
957277177 3:78105630-78105652 CAGCCAGATATCAAGGCCATTGG - Intergenic
958043168 3:88250022-88250044 CAGCCAGTTGGCCTGGCTTTGGG + Intergenic
959709662 3:109372563-109372585 CAGCCAAATGGCACATTCTTAGG - Intergenic
964796984 3:160509224-160509246 CAACCAGATGGCTAGGACTTAGG - Intronic
967228050 3:187312128-187312150 GAGAGAGATGGCATGGCCTTGGG - Intergenic
969680821 4:8642439-8642461 AAGCCAGATTGCAGGGCCTGGGG - Intergenic
969897273 4:10317169-10317191 CAGCCTGATGGCACCTCCTCAGG + Intergenic
970486332 4:16528572-16528594 CAACCTGAGGGCAGGGCCTTCGG + Intronic
977770204 4:100849050-100849072 CAGCTAGATGGCAGGCCCTGTGG + Intronic
979558424 4:122076631-122076653 AAGCCAGGTGGCAGGGCCTGGGG - Intergenic
985485800 5:147507-147529 CACCCTGATGTCACTGCCTTAGG - Intronic
987194684 5:15514555-15514577 CATACAGATAGCAAGGCCTTGGG + Intronic
987328358 5:16832934-16832956 CAGCCACATTGCAAGTCCTTGGG + Intronic
987773044 5:22330962-22330984 CAAGCTGATGGAACGGCCTTTGG + Intronic
988267572 5:28972053-28972075 CAGAAAGATGGAATGGCCTTTGG - Intergenic
992615630 5:78543587-78543609 CAGCCAGAAGGCCAGGCCTGGGG - Intronic
997597837 5:135119023-135119045 CAGCCAGAGGGCAGGGCATGTGG + Intronic
997885935 5:137630044-137630066 CAGCCAAAGGCCAGGGCCTTTGG + Intronic
998565662 5:143213846-143213868 CAGCCAGATGGCAAGACATGAGG - Intronic
1006378154 6:33683207-33683229 CAGCAAGATGGCCCGGCCCTTGG - Exonic
1010723650 6:79310366-79310388 AAGCCATATGGCAAGACCTTTGG - Intergenic
1016364295 6:143298904-143298926 CAGACAGATGTCACAGCCTTGGG - Intronic
1016934105 6:149436207-149436229 AAGCCAGATGGCAGAGCTTTGGG - Intergenic
1017522521 6:155214302-155214324 CAGGCACATGGCACATCCTTTGG + Intronic
1018825363 6:167404700-167404722 CACCCAGATGCCACAGCCCTAGG - Intergenic
1019061660 6:169261835-169261857 GAGAGAGATGGAACGGCCTTCGG - Intergenic
1020204799 7:6105591-6105613 CAGCCAGGTGGCTAGGCCTGGGG - Intronic
1023875547 7:44284465-44284487 CTGGCAGATGGCACGCCCTGGGG + Intronic
1026234164 7:68511363-68511385 CAGCCAGCTGGCAAGGCGGTGGG - Intergenic
1029526037 7:101094602-101094624 CAGCCAGGAGGCAGGGCCATTGG + Intergenic
1032187682 7:129741249-129741271 CTGCCAGATGGCAGGGACCTTGG - Intronic
1035064868 7:156097092-156097114 AAGGCAGATGGCACTGCCGTGGG + Intergenic
1035823864 8:2623676-2623698 CCGCCAGATGGCACTGCGCTGGG - Intergenic
1040481360 8:47831080-47831102 CAGCCGGAGGGCAGGACCTTGGG - Intronic
1043940125 8:86187756-86187778 CAGCAACTTGGCAGGGCCTTTGG + Intergenic
1044472416 8:92585180-92585202 CATCCAGATGCCACAGCCTAAGG - Intergenic
1047255846 8:123212910-123212932 CAGCCAGAGGGGAGAGCCTTGGG + Intergenic
1048857139 8:138695008-138695030 CAGGCAGAGGGAACAGCCTTTGG - Intronic
1052143987 9:25025326-25025348 CAGTCAGAAGGCACGGGCGTCGG + Intergenic
1058467473 9:105244294-105244316 CAGCGAGTTGGCCCGGTCTTTGG + Intergenic
1061264456 9:129497213-129497235 AAGCCAGCTGGCAGGGCCTGGGG + Intergenic
1061584176 9:131555446-131555468 CAGGCAGATGGCTTGGGCTTAGG + Intergenic
1061811555 9:133165091-133165113 CAGCCAGTAGGCACAGCCATAGG - Intergenic
1186159185 X:6758856-6758878 CAGCCGTGTGGCACAGCCTTCGG + Intergenic
1189848347 X:45156584-45156606 CAGGCAGATGGCTCTGCATTTGG + Intronic
1190056815 X:47185964-47185986 TAGCCAGATGGCATGCCCTGTGG + Intronic
1192186511 X:68950558-68950580 CTGCCAGAAGGCACTGACTTAGG - Intergenic
1195728305 X:107939724-107939746 CAGTTAGGTGGCACAGCCTTGGG - Intergenic
1198127424 X:133659667-133659689 CAGCCAGGTGCCAGGGACTTTGG - Intronic