ID: 1113542255

View in Genome Browser
Species Human (GRCh38)
Location 13:111118030-111118052
Sequence CTTCGCTTGACCTCTGCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 119}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113542255 Original CRISPR CTTCGCTTGACCTCTGCTGC AGG Intronic
900794709 1:4700928-4700950 CTTAGCTGAGCCTCTGCTGCTGG - Intronic
901056296 1:6450067-6450089 CTTAGCTTCAGCCCTGCTGCAGG - Intronic
902041431 1:13495415-13495437 CTTTGCATGTCCTCTGCTGCAGG + Intronic
902152250 1:14452820-14452842 CCTTTCTTGAGCTCTGCTGCTGG + Intergenic
903594793 1:24485752-24485774 CTTCCTTTTACCTATGCTGCAGG - Intergenic
903753565 1:25645346-25645368 CTTCTCTTGGGCTGTGCTGCAGG + Intronic
906545049 1:46614664-46614686 CTGGGCTTGACCTCTGACGCTGG + Intronic
908602954 1:65761187-65761209 ATTCGCTGGTCCTCTGCTCCCGG + Intergenic
913700936 1:121373928-121373950 CTTGGCTTGACCTCTGGGGGTGG + Intronic
914041487 1:144054395-144054417 CTTGGCTTGACCTCTGGGGGTGG + Intergenic
914136602 1:144906095-144906117 CTTGGCTTGACCTCTGGGGGTGG - Intronic
920488355 1:206392646-206392668 CTTGGCTTGACCTCTGGGGGTGG + Intronic
920838214 1:209531787-209531809 CTCCGCCTGAGCTCTGCAGCGGG - Intergenic
922823580 1:228501739-228501761 CTGCCCTTGCACTCTGCTGCTGG - Intergenic
924067593 1:240241472-240241494 GTTCACTTGTCCTCTGCTGTAGG - Intronic
1064156441 10:12906838-12906860 CCGAGCTTGACCTTTGCTGCTGG + Intronic
1066497972 10:35960708-35960730 CTTCGCTGACCCTCTGTTGCAGG - Intergenic
1070614344 10:77957959-77957981 CTTTCCTTGGCCTCTGCTGTGGG - Intergenic
1073374541 10:103021642-103021664 CTTCCCTTGACTCCTGCTGTAGG + Intronic
1075217105 10:120545582-120545604 CCTCACTTGTCCTCTTCTGCTGG + Intronic
1075555779 10:123430730-123430752 CCTGGCTTGACCTCTGTAGCGGG + Intergenic
1076565455 10:131395544-131395566 CCTCCCTGGACCTCAGCTGCAGG - Intergenic
1076732968 10:132447380-132447402 CTACGGGTGACCCCTGCTGCTGG - Intronic
1076735178 10:132455784-132455806 CCTGGCTTTCCCTCTGCTGCTGG - Intergenic
1083956945 11:65989121-65989143 CTTAGGGTGACCTCTGCTGGTGG + Intergenic
1085265780 11:75237110-75237132 CTTCGCTGGGCCTTTTCTGCTGG - Intergenic
1089461081 11:118654139-118654161 ATTCGCGTGACCTCTCCTGTAGG + Intronic
1090597099 11:128331594-128331616 CTTCCCTTAACATCTGCTGAAGG + Intergenic
1091120998 11:133057482-133057504 CTTCCCTTGCCTTCTGCTTCTGG + Intronic
1092403266 12:8196015-8196037 CTTGTCATGAGCTCTGCTGCTGG - Intergenic
1096071863 12:48780004-48780026 CCTCTCTTCACCCCTGCTGCTGG - Intronic
1096411161 12:51378055-51378077 CTTTCCTTGACCTCCTCTGCTGG + Intronic
1096769281 12:53923872-53923894 TTTGGCATCACCTCTGCTGCTGG + Intergenic
1099601795 12:84748970-84748992 CTTGGCTTGAACTCTGCTGAGGG - Intergenic
1108546336 13:51499034-51499056 CTTCTCTTATTCTCTGCTGCTGG - Intergenic
1111354289 13:87079270-87079292 CTGCACTGGACTTCTGCTGCAGG + Intergenic
1113542255 13:111118030-111118052 CTTCGCTTGACCTCTGCTGCAGG + Intronic
1118295485 14:64564758-64564780 TTTTCCTTGACTTCTGCTGCAGG - Exonic
1121109493 14:91303101-91303123 CTTCCCTGGACCTCCCCTGCAGG - Intronic
1122359302 14:101150211-101150233 CTTCTCCTGCCCTCCGCTGCAGG + Intergenic
1122882006 14:104694396-104694418 CGTCTCTTGACCTCTGCTCCAGG - Intronic
1126624068 15:50669129-50669151 CTGCGCCTGACCTCAGCTGTGGG - Intronic
1127900709 15:63338939-63338961 CTGCTCTTGCCCTCAGCTGCTGG - Exonic
1128387890 15:67163656-67163678 CTTCCCTGAACCTCTGCTGCTGG + Intronic
1130919132 15:88329334-88329356 ATTCTCTGCACCTCTGCTGCTGG - Intergenic
1131525988 15:93153079-93153101 CTTGGCTTGTTCTCTGCTCCTGG + Intergenic
1134271238 16:12735068-12735090 CTTCCCTAGCTCTCTGCTGCTGG - Intronic
1141169205 16:81680569-81680591 CCTCACCTGACCTCTGCTGCTGG - Intronic
1141259435 16:82439400-82439422 CTTGATTTGGCCTCTGCTGCTGG - Intergenic
1141383042 16:83592920-83592942 CATCGCTCGACCTCTGCAGTGGG + Intronic
1142267494 16:89071201-89071223 CATCTCTTCTCCTCTGCTGCTGG + Intergenic
1143541527 17:7572408-7572430 CTTCCCTTTACTTCTGCTCCCGG - Exonic
1143877180 17:10000875-10000897 CTTCGCTTGCTTTCTGCTCCTGG - Intronic
1144584454 17:16479680-16479702 TTTCGCTACAGCTCTGCTGCTGG - Intronic
1146565022 17:33905466-33905488 CATAGCTTGTCCTCTGCTGCTGG + Intronic
1152032776 17:77854297-77854319 CCTCCCCTGGCCTCTGCTGCAGG + Intergenic
1154412393 18:14148463-14148485 CCTCTCTTGGCCTCTGCTTCGGG + Intergenic
1159921856 18:74233684-74233706 CTTCTCTTGTCCTCTGCTCCTGG + Intergenic
1160166769 18:76520150-76520172 CTTAGCTTGATCTCTGTTTCTGG + Intergenic
1160473059 18:79156373-79156395 CTGCGCCTAACCTCTCCTGCAGG + Intronic
1167592434 19:50411360-50411382 CTTGGCCTGGCCTCTGCTTCAGG - Intronic
927428643 2:23008138-23008160 CACCTCTTGTCCTCTGCTGCTGG + Intergenic
930622772 2:53661448-53661470 CTTGGCTTGAGCTTGGCTGCAGG + Intronic
933500506 2:83104920-83104942 CTTCCCTTGATATCTGCTGATGG - Intergenic
936055246 2:109257579-109257601 CTTCCCTTGACCACTGGAGCAGG + Intronic
941754042 2:169165499-169165521 CTTCACATGATCTCTGCAGCTGG + Intronic
948532063 2:238615367-238615389 CATCCCATGACCTTTGCTGCAGG + Intergenic
1170533560 20:17317927-17317949 ATTCTCTTCATCTCTGCTGCAGG - Intronic
1173208717 20:41015227-41015249 CCTCCCTTGACCTCATCTGCTGG - Intergenic
1174954910 20:55086831-55086853 CTTCTCTTCACCTCTACAGCAGG - Intergenic
1176860610 21:14009794-14009816 CCTCTCTTGGCCTCTGCTTCGGG - Intergenic
1177727364 21:24986862-24986884 CTTCCCTTAATCTCTGCTTCAGG + Intergenic
1180267334 22:10544005-10544027 CTTCCTTTGAACTTTGCTGCTGG - Intergenic
1180793419 22:18589888-18589910 CTTTGCTTGCCCTCTGCTTGGGG + Intergenic
1180890624 22:19285665-19285687 CTTCTCTTGAGGCCTGCTGCTGG - Intronic
1181228320 22:21405424-21405446 CTTTGCTTGCCCTCTGCTTGGGG - Intergenic
1181250330 22:21529426-21529448 CTTTGCTTGCCCTCTGCTTGGGG + Intergenic
1181977124 22:26737972-26737994 CTTCCCCAGCCCTCTGCTGCTGG - Intergenic
1182005009 22:26952700-26952722 CTTCGCCAGTCCCCTGCTGCGGG - Intergenic
1183357105 22:37365441-37365463 CTTCCCTGGAGCCCTGCTGCGGG + Intergenic
1185164879 22:49255400-49255422 CTTCGCTGGGGGTCTGCTGCCGG - Intergenic
950424723 3:12919006-12919028 CTCCGCATGACCCCTGATGCAGG - Intronic
950520629 3:13495776-13495798 TTTCCCTTGACCTCTGCATCTGG + Intronic
953460492 3:43078203-43078225 CATCCCTTGTTCTCTGCTGCAGG - Intergenic
954508136 3:51097113-51097135 CAGCGCTTGAGCTCTGCTGAGGG - Intronic
955701393 3:61685451-61685473 CTTCCCTTTACTTCTGCTACAGG - Intronic
959784811 3:110283245-110283267 CTTCCCTCTACCCCTGCTGCAGG + Intergenic
961323978 3:126098883-126098905 CTTCTCTTGACAGCTGCTCCAGG + Intronic
961480135 3:127174245-127174267 CTGCACTGCACCTCTGCTGCTGG + Intergenic
962826219 3:139102658-139102680 CTTCTCTTTCCCACTGCTGCTGG - Intronic
963106708 3:141653713-141653735 CTTCCCTGGAACTCTGCTGGGGG + Intergenic
963366569 3:144343139-144343161 CTTGGCTGGATTTCTGCTGCAGG + Intergenic
964808805 3:160640411-160640433 CTGCCCTATACCTCTGCTGCAGG + Intergenic
964904894 3:161707709-161707731 CAGCGCTTGAGCTCTGCTGAGGG + Intergenic
967470302 3:189853106-189853128 CTTCTCATCACCTCTACTGCTGG + Intronic
968170158 3:196503618-196503640 TTCCGCTTTACCGCTGCTGCGGG + Exonic
969202408 4:5616410-5616432 CTACGTTTGACCTCATCTGCTGG - Intronic
969658265 4:8510357-8510379 CTTCGATGGAGCTCTGCTTCTGG + Intergenic
971801955 4:31304281-31304303 CTTCTTTTGATCTCTGTTGCTGG + Intergenic
975408489 4:74020363-74020385 CTTGGCTTTACCTCTAGTGCTGG + Intergenic
975681360 4:76879799-76879821 CTTCTCTTGACCTTTGTTTCTGG - Intergenic
976188230 4:82464320-82464342 CTTGGCTTGACCTCTAGTGTTGG - Intergenic
981403631 4:144341960-144341982 ACTGGCTTGACTTCTGCTGCTGG - Intergenic
990992757 5:61701470-61701492 CTTCTCTTGACCGCACCTGCCGG + Intronic
991040535 5:62170369-62170391 CTTTGTTTCACCTCTCCTGCAGG + Intergenic
996684540 5:126266165-126266187 CTGCGCTTGACTTGTGCTACTGG - Intergenic
999038333 5:148378845-148378867 CTTTGCTTGCTCTCTCCTGCAGG - Intergenic
1012705062 6:102514799-102514821 CTTTGTTTGACCTCTGCTTCTGG + Intergenic
1015954091 6:138582618-138582640 CTTCCCTTTAACTCTGCTGAGGG + Intronic
1016842016 6:148534169-148534191 CTGCCCTTGACCTCAGCTGTGGG + Intronic
1018915211 6:168128750-168128772 CTAGGCCTGACATCTGCTGCAGG - Intergenic
1021498540 7:21303723-21303745 GATCGCTTGACCTCAGCAGCTGG + Intergenic
1022256660 7:28665151-28665173 CCTAGCTTGACCTCTGCTGCTGG + Intronic
1029224286 7:99013849-99013871 CCTCTCTGGACCTCTGCCGCAGG + Intergenic
1029662334 7:101970965-101970987 CTTCCCTTTCCTTCTGCTGCAGG - Intronic
1032574504 7:133038647-133038669 CTTAGCTTAACCTCAGCTGATGG - Intronic
1034399703 7:150854215-150854237 CTTGTCTTGCCCTCTGGTGCTGG - Intronic
1036272892 8:7323581-7323603 CTTGTCATGAGCTCTGCTGCTGG + Intergenic
1036348458 8:7986767-7986789 CTTGTCATGAGCTCTGCTGCTGG - Intergenic
1036865100 8:12389551-12389573 CTTGTCATGAGCTCTGCTGCTGG - Intergenic
1037456937 8:19073176-19073198 GTTTGCTTGGCCTTTGCTGCAGG - Intronic
1046805754 8:118477354-118477376 TTGCGCTCGACCTCTGCGGCCGG + Intronic
1049155861 8:141066376-141066398 CTTGGACTGAACTCTGCTGCCGG + Intergenic
1057739117 9:97696856-97696878 CTTCGCTGCACCTCGGCTGCTGG - Intronic
1057946418 9:99333509-99333531 ATTCTCTTGAGCTCTGCTGGGGG + Intergenic
1061214482 9:129213196-129213218 CCTCCCTTGACCTCTTCTCCAGG + Intergenic
1062301888 9:135878208-135878230 CCTCCCTTCACCTCTGCTCCAGG - Intronic
1185610533 X:1391723-1391745 CGTCACGTGACCGCTGCTGCAGG - Intronic
1189386381 X:40540094-40540116 CTTCTCTTGAGATCTGCTTCTGG + Intergenic
1200779999 Y:7206105-7206127 CTCCTCCTGACCTCTTCTGCAGG + Intergenic