ID: 1113542973

View in Genome Browser
Species Human (GRCh38)
Location 13:111123236-111123258
Sequence CTACCTCCGAGGAGACCCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 121}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113542967_1113542973 22 Left 1113542967 13:111123191-111123213 CCTTGGAAAGGCTTGCACTTTTC 0: 1
1: 0
2: 4
3: 14
4: 154
Right 1113542973 13:111123236-111123258 CTACCTCCGAGGAGACCCCAGGG 0: 1
1: 0
2: 0
3: 10
4: 121
1113542965_1113542973 28 Left 1113542965 13:111123185-111123207 CCCAGGCCTTGGAAAGGCTTGCA 0: 1
1: 0
2: 1
3: 16
4: 228
Right 1113542973 13:111123236-111123258 CTACCTCCGAGGAGACCCCAGGG 0: 1
1: 0
2: 0
3: 10
4: 121
1113542966_1113542973 27 Left 1113542966 13:111123186-111123208 CCAGGCCTTGGAAAGGCTTGCAC 0: 1
1: 0
2: 2
3: 9
4: 130
Right 1113542973 13:111123236-111123258 CTACCTCCGAGGAGACCCCAGGG 0: 1
1: 0
2: 0
3: 10
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113542973 Original CRISPR CTACCTCCGAGGAGACCCCA GGG Intronic
900100457 1:960118-960140 CCTCCTCCGAGGAGCCCCCCAGG - Intergenic
900458567 1:2789444-2789466 CTACCTCGAAGGAGACCCGCAGG + Intronic
904206236 1:28856996-28857018 CTACCACCGAGGACACCCAGGGG + Intronic
904276003 1:29384675-29384697 CTACCTCTGAGGAGCCCCTGTGG - Intergenic
905148506 1:35907174-35907196 GTCCTTCCCAGGAGACCCCAGGG - Intronic
905832015 1:41077195-41077217 CTACCTCAGAGGCCACCCCTTGG - Intronic
906173512 1:43748064-43748086 CTACCACCCAGGAAATCCCAAGG + Intronic
906274345 1:44505257-44505279 CTCCCTCCCAGGCAACCCCAAGG + Intronic
907707497 1:56845488-56845510 TTCCCTCCGGGGAGTCCCCAAGG + Intergenic
911051170 1:93672738-93672760 CTAACCCCCAGGATACCCCAAGG + Intronic
912707933 1:111928717-111928739 CTAGCTCACAGGAGACCTCAGGG + Intronic
914213961 1:145607892-145607914 CTCCCGCCGCGGAGGCCCCAGGG - Intergenic
915737059 1:158091652-158091674 CTCCCTCAGAGCAGAGCCCAAGG - Intronic
916599221 1:166276087-166276109 CTCCCTCCAAGAGGACCCCAGGG - Intergenic
920977502 1:210799886-210799908 GTACCTCCAAGGAGAGCACAGGG - Intronic
924602887 1:245507035-245507057 ATACCTCCCAGGAGGCCCGAGGG + Intronic
1063375873 10:5553861-5553883 CTACCTCCCAGGTGACTCCAAGG + Intergenic
1068934753 10:62624827-62624849 CTATCTCAGAGCAGGCCCCAAGG + Intronic
1073096702 10:100984339-100984361 CTACCTCTGAGGAGCACCGATGG - Exonic
1073593653 10:104779535-104779557 CTTCCTCCGTGGAGTCCCCCTGG - Intronic
1076707671 10:132310502-132310524 CTACCTCCCATGAGGCACCAGGG - Intronic
1078266042 11:9757029-9757051 CCACCTCCCAGTAGACCCCAAGG + Intergenic
1079003398 11:16776007-16776029 TTCCCTTCCAGGAGACCCCAGGG - Intergenic
1079343796 11:19634322-19634344 CCACCTTCAAGTAGACCCCAGGG - Intronic
1083326260 11:61874465-61874487 CCACCTCCAAGGTGACCACAAGG + Intronic
1084106881 11:66986145-66986167 CCACCTCCTGGGAGGCCCCAGGG - Intergenic
1084714520 11:70865165-70865187 CTTCCTCCTTGGAGATCCCATGG + Intronic
1085445704 11:76599341-76599363 CTCCTTCCCAGCAGACCCCAGGG + Intergenic
1085705807 11:78786202-78786224 CTGGTGCCGAGGAGACCCCAAGG + Intronic
1091223270 11:133943437-133943459 CTCCCTCCAGGGAGACCCCGAGG + Intronic
1104516622 12:129432910-129432932 CTACCTGCAAGGTGACCCAAGGG - Intronic
1105048596 12:133027887-133027909 ATAGCTCAGAGGAGACCGCAGGG - Intergenic
1109547703 13:63848883-63848905 CTACCTCATAGGAGACCTCAGGG - Intergenic
1110457417 13:75705127-75705149 CAACCTCAGAGGAAGCCCCAAGG + Intronic
1113542973 13:111123236-111123258 CTACCTCCGAGGAGACCCCAGGG + Intronic
1114166776 14:20226640-20226662 TTAACTCTGAGGAAACCCCATGG - Intergenic
1116860361 14:49990608-49990630 GCAGCTCCAAGGAGACCCCATGG - Intronic
1119378243 14:74212177-74212199 CTCCCTCGAAGGAGAGCCCAAGG - Intergenic
1122346174 14:101061883-101061905 CTACCTCCGAGAAGCCCCCCAGG - Intergenic
1123933152 15:25181569-25181591 CTACCCTGGAGGTGACCCCATGG - Intergenic
1123948472 15:25250271-25250293 CTACCCTGGAGGTGACCCCATGG - Intergenic
1126675101 15:51154183-51154205 CTACTTCTGGGGAGACCTCAGGG + Intergenic
1128888288 15:71308190-71308212 TTACCTCCCAGGAGCCTCCAAGG + Intronic
1132842749 16:1986228-1986250 CCTCCTCAGTGGAGACCCCAAGG + Exonic
1132855259 16:2042108-2042130 CCACCTGCAAGGAGACCCCAGGG - Intronic
1133225311 16:4337942-4337964 CTTCCTGAGAGGAGCCCCCAGGG + Exonic
1133975641 16:10598298-10598320 CAACCTCCGGGGAGTGCCCAGGG + Intergenic
1136778766 16:32884905-32884927 CTTACCTCGAGGAGACCCCAAGG + Intergenic
1136891851 16:33976613-33976635 CTTACTTCGAGGAGACCCCAAGG - Intergenic
1137551430 16:49440214-49440236 CTACCTCCCAGGACACCCAACGG + Intergenic
1139751680 16:69112791-69112813 CTGCCTCCAGGCAGACCCCAGGG - Intronic
1203081181 16_KI270728v1_random:1146994-1147016 CTTACCTCGAGGAGACCCCAAGG + Intergenic
1143552053 17:7636367-7636389 CCAGCTCCGAGGAGATTCCAGGG - Intergenic
1144955988 17:19019155-19019177 CTGGCTCCGCAGAGACCCCAGGG + Intronic
1147308200 17:39578178-39578200 CTATTTCCCAGGAGACACCATGG - Intergenic
1147980868 17:44273070-44273092 CTTCCTCCCAGGACTCCCCAGGG - Intergenic
1148051202 17:44770649-44770671 CTGCCTCCCAGGACACCCCTGGG - Intronic
1148339940 17:46867447-46867469 CTCACTCCGAGGTGACCTCAGGG - Intronic
1148558957 17:48595091-48595113 CTTGCTCCTTGGAGACCCCAGGG - Intronic
1149285584 17:55160629-55160651 CTCCCTCCGTGGAGACAGCAGGG - Exonic
1151893269 17:76963699-76963721 CCACCTCTCAGGAGCCCCCAAGG + Intergenic
1152440957 17:80309383-80309405 CTCCCTCCCAGGAAAGCCCAAGG - Intronic
1152579815 17:81160871-81160893 CCACATCCGAGGAGACACCGAGG + Intronic
1156213024 18:34967568-34967590 CTATCTCCCAGGAAACTCCAAGG + Intergenic
1160270158 18:77376345-77376367 GCACCTCAGAAGAGACCCCACGG - Intergenic
1161000261 19:1907301-1907323 CTGCCTCCGAGGAGCCCTCCTGG + Intronic
1161073414 19:2273605-2273627 CTCCCACGGAGGAGACCCCCTGG + Intronic
1162852584 19:13442121-13442143 TTAGCGCCGAGTAGACCCCAAGG + Intronic
1163194012 19:15701911-15701933 CTACCTCACAGGGGACCTCATGG + Intergenic
1163323378 19:16587487-16587509 CTTCCTCTGAGGGGACCTCATGG + Intronic
1164411961 19:28013788-28013810 CTACTTCTGGGGAGGCCCCAGGG + Intergenic
1166746231 19:45143099-45143121 CTCCCTCCGAGCTGAGCCCAGGG - Intronic
927497979 2:23563428-23563450 CTGCCTCCCAGGAGCCCCCTTGG + Intronic
930970317 2:57386755-57386777 CTACTTTAGAGGACACCCCAAGG - Intergenic
934776332 2:96940048-96940070 GGACCACCCAGGAGACCCCAGGG - Intronic
935595489 2:104874159-104874181 CTTCCTCCCAGGAGACCCGCAGG - Intergenic
938125798 2:128670532-128670554 CTGCCTCCGCTGACACCCCAGGG - Intergenic
946229660 2:218283409-218283431 CTACCTCAGAGGGGACCACCAGG - Intronic
947525300 2:230873717-230873739 CTGCATCCAAGGAGGCCCCAAGG - Intronic
948536412 2:238650676-238650698 CCCCCTCCCAGGAGACACCAAGG + Intergenic
1168970060 20:1924914-1924936 CTCCCTCCGAGGACAGTCCAGGG - Intronic
1169272381 20:4210566-4210588 CCACCAACCAGGAGACCCCAGGG - Intergenic
1169632565 20:7649184-7649206 CTACTTCCTAGGAGGCCACATGG - Intergenic
1171978109 20:31608302-31608324 GTGCCTCCGAGGACACTCCAAGG - Intergenic
1174129107 20:48329227-48329249 GTACTTCTCAGGAGACCCCAGGG + Intergenic
1174850088 20:53985422-53985444 TTACATCCCAGGAGACCCAAGGG - Exonic
1175790768 20:61738590-61738612 GTGCCTCCGAGGAATCCCCAAGG - Intronic
1178422901 21:32456371-32456393 CAACCACAGAGCAGACCCCAGGG - Intronic
1181591298 22:23886619-23886641 TCACCTCCGAGGAGGCCCAAAGG + Intronic
1183987280 22:41576516-41576538 CTGCCACCCAGGAGGCCCCAGGG - Exonic
1184188161 22:42878161-42878183 CTGCCTCAGAGGAGACCCTGGGG - Intronic
1185109851 22:48894864-48894886 CTCCCTCCAAGAAGATCCCAGGG + Intergenic
950396384 3:12737251-12737273 CTTCCTCCTAGAAGTCCCCATGG + Intronic
952492092 3:33882544-33882566 CTGCCTCCCAGAAGACCCCATGG - Intergenic
953664422 3:44915844-44915866 CTGCCCCCTAGGAGACTCCAGGG + Intronic
954445942 3:50546968-50546990 CTGCCTCTGGGGAGGCCCCAAGG - Intergenic
954517594 3:51192601-51192623 CTACATCACAGGAGACCTCACGG + Intronic
962520574 3:136195035-136195057 CTACGACCCCGGAGACCCCAAGG - Exonic
967867066 3:194198905-194198927 CAACCTCCCAGCAGACCCCCTGG + Intergenic
967911525 3:194546194-194546216 CTACCACCCAGGAAATCCCAAGG + Intergenic
968935494 4:3608053-3608075 CTCCCTCTGAGCAGAGCCCAGGG + Intergenic
972780013 4:42279287-42279309 CACCCTCCCAGGGGACCCCATGG - Intergenic
979652830 4:123156023-123156045 CTACCTCTGAGGAGGCCTCAGGG + Intronic
997354554 5:133253966-133253988 CTACCTCCAAGATGACCTCATGG + Intronic
998327857 5:141298039-141298061 CTACCTCCAAGAAGACACAAAGG + Intergenic
1002784987 6:393439-393461 CCGCCTCCGAGGCGAGCCCAGGG + Intronic
1003257900 6:4490037-4490059 CCCCCTCCCAGGAGTCCCCACGG - Intergenic
1017158211 6:151341485-151341507 CGACCTCCCAGGAAACCCCCGGG - Intronic
1022208020 7:28181063-28181085 CTCCCTGCGAGGAGAACTCAGGG + Intergenic
1024620358 7:51151849-51151871 CGTCCTCCTGGGAGACCCCACGG + Intronic
1032831582 7:135632628-135632650 CTTCTTCCAAGGAGATCCCAGGG + Intronic
1033276176 7:139973146-139973168 CGGCCTCCGAGGAGACCTCTGGG + Intronic
1033915603 7:146321534-146321556 CTACCTCCTAACAGACCCCTTGG + Intronic
1034929050 7:155146024-155146046 CTACCTCCTCGGGAACCCCATGG + Intergenic
1035295816 7:157866708-157866730 CTGCTTCTGAGGAGACCCCAGGG - Intronic
1039883882 8:41644683-41644705 CAACCTCAGAGTAGATCCCAAGG - Intergenic
1041196742 8:55408618-55408640 CCACCTGCCAGGAGACCTCAGGG - Intronic
1049208494 8:141374541-141374563 CTACCTCCCAGGGGAGCCCTGGG + Intergenic
1057744595 9:97741265-97741287 CAGCCTGCGAGGAGACGCCAGGG + Intergenic
1058279214 9:103090153-103090175 CTACTTCTGAGGAGGCCTCAGGG - Intergenic
1060485352 9:124042964-124042986 CTACCTCCTAGGTCACCACAGGG - Intergenic
1061204664 9:129156099-129156121 CAGGCTCCAAGGAGACCCCAAGG + Intergenic
1061359884 9:130134382-130134404 CTGGCTCTGAGGAGGCCCCATGG - Intronic
1061582482 9:131546239-131546261 CGACCTGGGAAGAGACCCCACGG + Intergenic
1062586168 9:137250999-137251021 CAGACTCCCAGGAGACCCCAGGG + Intergenic
1186524483 X:10236026-10236048 CTGGCTCTGAGGAGACCACAGGG - Exonic
1190265100 X:48823419-48823441 CTACGTCAGAGGAGGCTCCAGGG + Exonic
1192583008 X:72300248-72300270 CTACCTCCGTGGAGAACCAGAGG + Intronic
1193466546 X:81854217-81854239 CTGCTTCTGAGGAGGCCCCAGGG + Intergenic
1194335881 X:92645205-92645227 CTACCTCTCAGGGGACCTCATGG - Intergenic
1194839101 X:98716190-98716212 CTACTTCTGGGGAGACCTCAGGG - Intergenic
1200644318 Y:5761956-5761978 CTACCTCTCAGGGGACCTCATGG - Intergenic