ID: 1113543462

View in Genome Browser
Species Human (GRCh38)
Location 13:111127031-111127053
Sequence GTGGACTGATTAGGAAAAAC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 2, 1: 0, 2: 1, 3: 29, 4: 154}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113543462 Original CRISPR GTGGACTGATTAGGAAAAAC GGG Intronic
904248846 1:29207942-29207964 GAGGACTGTGTAGGAAAAAGGGG - Intronic
904925018 1:34040774-34040796 CTGGAATGATTAGGAAGAAGTGG - Intronic
907212102 1:52832703-52832725 CTGGACTCCTTGGGAAAAACAGG - Intergenic
909210435 1:72816213-72816235 CTAGACTTCTTAGGAAAAACAGG - Intergenic
909753042 1:79188493-79188515 GTGGAAAGCTTAAGAAAAACAGG + Intergenic
912663221 1:111553780-111553802 GTTGACTAAATAGGAAAAAAGGG - Intronic
915252355 1:154599733-154599755 GTGGACAGATTGAGGAAAACAGG - Intronic
915646527 1:157276695-157276717 GTGTATGGATTAGGAAATACTGG + Intergenic
917991877 1:180388324-180388346 CTGAACTGAATAGGAAGAACAGG + Intronic
918097400 1:181346541-181346563 CTGAATTGATTAGGAAGAACAGG - Intergenic
919235404 1:194835026-194835048 GTGAATTATTTAGGAAAAACTGG + Intergenic
922224042 1:223629835-223629857 ATGGAATGAATAGGAGAAACAGG - Intronic
924083217 1:240420889-240420911 TTGGATTTATTTGGAAAAACAGG + Intronic
924641257 1:245835753-245835775 ATGGGATCATTAGGAAAAACAGG + Intronic
1064207683 10:13337985-13338007 GTGGAGAGACTAGGAAAATCTGG - Intronic
1065330946 10:24598628-24598650 TTGGAATGAATAGGAAAAAAAGG - Intronic
1067900112 10:50231254-50231276 GTGGACTGGAAAGGTAAAACAGG - Intronic
1069002562 10:63282039-63282061 ATGAAACGATTAGGAAAAACTGG - Intronic
1072489729 10:95892755-95892777 CTGGACTGCTTAGGGCAAACCGG - Intronic
1073942024 10:108710471-108710493 GTGGACTGTGCAGGAAACACAGG - Intergenic
1075652590 10:124138815-124138837 GTGTACTCATTAGGAAGAAATGG - Intergenic
1077859047 11:6158816-6158838 CTGGACTACTTGGGAAAAACAGG - Intergenic
1078010027 11:7565780-7565802 GTGGCCTGATTGGGAACCACTGG + Intronic
1083577731 11:63804456-63804478 GTGGACAGAGGAGGAGAAACAGG + Intergenic
1088940591 11:114451358-114451380 GTGGACTGAGAAGGAGAAAGGGG - Intergenic
1089459904 11:118646494-118646516 TGGGGCTGATTAGGAAAAGCAGG + Intronic
1092061764 12:5556793-5556815 GTGGACTGAAGATTAAAAACTGG + Intronic
1093804394 12:23414349-23414371 TTGAACTAAATAGGAAAAACCGG + Intergenic
1094025296 12:25955475-25955497 GTGGGCTGTTTGGGAAATACTGG + Intergenic
1094431335 12:30373116-30373138 GGGGACTCCTTGGGAAAAACAGG - Intergenic
1097254313 12:57660820-57660842 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1098017743 12:66124351-66124373 ATGAACTGATTAGGAATGACTGG + Intronic
1098512635 12:71335899-71335921 TTGGACTAACTGGGAAAAACAGG - Intronic
1099708754 12:86192293-86192315 GGGCACTGATTAGGAAGAAATGG + Intronic
1101933999 12:109041061-109041083 GTTGACTGATGAGGAAACAGAGG - Intronic
1102771030 12:115476343-115476365 GTAGACTGATTTTGAAAATCAGG - Intergenic
1104574296 12:129952675-129952697 GTGAACTGACTTGGAAAAAAAGG + Intergenic
1105268933 13:18852262-18852284 GTGGGCTGATGAGGAGAAAAGGG + Intergenic
1106031175 13:26005330-26005352 CTAGACTGACTAGGAAAAAAAGG - Intronic
1108190639 13:47934928-47934950 GTGGGCTGATGAGGAAGAACTGG - Intergenic
1110098155 13:71558226-71558248 GTTGACTGATGAGGTAAATCAGG + Intronic
1111561707 13:89958631-89958653 TTGGAATGATTAGCAAAAACTGG + Intergenic
1112011631 13:95298464-95298486 CTGGACTGATTCAGTAAAACTGG - Intronic
1113543462 13:111127031-111127053 GTGGACTGATTAGGAAAAACGGG + Intronic
1113679131 13:112230220-112230242 GTGAACTGATTAGCAAAAATTGG - Intergenic
1116329647 14:43579147-43579169 CTGGACTCTTTGGGAAAAACAGG + Intergenic
1119305512 14:73604990-73605012 TGGGACTCATTGGGAAAAACAGG - Intergenic
1121776009 14:96591446-96591468 GTGCACAGATTAAGCAAAACTGG - Intergenic
1202830372 14_GL000009v2_random:21710-21732 GTGGACTGATGAGGAGAAAAGGG - Intergenic
1125171411 15:36770261-36770283 GTGGCTTGATCAGGAAAAAAAGG + Intronic
1125194133 15:37027386-37027408 GTGGAGTGATTGGGAATTACAGG - Intronic
1126310009 15:47304815-47304837 GTGGACTGATTATGTGAAATGGG + Intronic
1129015190 15:72461522-72461544 GGGTGCTGAATAGGAAAAACAGG + Intergenic
1131707758 15:95016646-95016668 GTGGACTGATCAGAAAGAAGAGG + Intergenic
1132360513 15:101209120-101209142 GTAGAGTGATTAGGAAAACCTGG - Intronic
1139822348 16:69730460-69730482 GTGGGTTGATTGGGAAACACAGG + Intergenic
1143721020 17:8809726-8809748 GTGGAATGGATAAGAAAAACAGG + Intronic
1148953614 17:51335687-51335709 GAGGGCTGACTAGGAAAAAATGG + Intergenic
1149501356 17:57155044-57155066 GTGGACTGATTGGGGCCAACTGG + Intergenic
1149636527 17:58175129-58175151 ATGGAGTGACTAGGAAAGACTGG - Intergenic
1154303565 18:13215331-13215353 GAGGACTGAGTAGGAAACACAGG + Intergenic
1158371628 18:56812831-56812853 GTGTACTGAGTGGGAAAAATCGG - Intronic
1158441104 18:57474990-57475012 GTGGCCTCAACAGGAAAAACTGG - Intronic
1159799074 18:72874424-72874446 GTGTGCTAATTAGTAAAAACTGG - Intergenic
1164452521 19:28379155-28379177 GTGGATTCATCAGGAACAACAGG + Intergenic
1167240682 19:48341412-48341434 GTGGACTGAATTGGAAACTCTGG - Intronic
1167520229 19:49950330-49950352 GTGGAATGAGTAGGTGAAACAGG - Intronic
1168438829 19:56345955-56345977 GGGGTTTGATAAGGAAAAACAGG + Intronic
1202642317 1_KI270706v1_random:106063-106085 GTGGACTGATGAGGAGAAAAGGG + Intergenic
925281601 2:2689216-2689238 GTAGAATGATTAGGAAGAACAGG - Intergenic
929626775 2:43416943-43416965 GTAAACTGATTTGGAAAAAAAGG - Intronic
931171843 2:59811889-59811911 TGGGAGTGATTAAGAAAAACTGG + Intergenic
931816316 2:65905308-65905330 CTAGACTGATCAGGAAAAAGAGG + Intergenic
932627690 2:73311758-73311780 TGGGAATGATTAGGAATAACTGG - Intergenic
932695922 2:73956488-73956510 GTGGAGTGAAGGGGAAAAACTGG + Intronic
932729669 2:74209841-74209863 GTTGACTGATGAGGCAAAATTGG + Intronic
932861768 2:75300587-75300609 GTAGACTTGTTAGGAAAAATAGG + Intergenic
934498157 2:94829496-94829518 ATGGACTGATGAGGAGAAAAGGG + Intergenic
935701691 2:105818045-105818067 ATGGACTGATTAAGAAAATGTGG + Intronic
936994579 2:118399400-118399422 GTGGTTTGATAAGGAGAAACTGG + Intergenic
938644985 2:133321119-133321141 GTGGACTGCTCAGGAATAAAGGG + Intronic
939191290 2:138919457-138919479 GTGGATTGCTTAGGAACAGCAGG + Intergenic
941579388 2:167275692-167275714 GTTGAATGATTAGGGAAAACAGG + Intergenic
942051524 2:172145358-172145380 GTGGGCTGACTAGGAACAAAGGG + Intergenic
946036044 2:216743120-216743142 GTTGAAGAATTAGGAAAAACTGG - Intergenic
1170535732 20:17338809-17338831 CTGGAATGATTAGGAGACACTGG + Intronic
1171889421 20:30696245-30696267 GTGGACTGATGAGGAGAAAAGGG + Intergenic
1176609559 21:8866548-8866570 GTGGACTGATGAGGAGAAAAGGG - Intergenic
1177121563 21:17143260-17143282 GTGGAGGGATTAGGGAAGACTGG - Intergenic
1178343630 21:31806633-31806655 GTGGACTGGGTAGGAAGGACTGG + Intergenic
1180359613 22:11875777-11875799 GTGGACTGATGAGGAGAAAAGGG - Intergenic
1181577722 22:23806004-23806026 ACGGAGTGGTTAGGAAAAACTGG + Intronic
949962827 3:9328420-9328442 CTGGACTCCTTGGGAAAAACAGG - Intronic
950602116 3:14044136-14044158 GTGTACGGATTAGGAACAATAGG + Intronic
950605716 3:14078215-14078237 CTGGACTCCTTGGGAAAAACAGG - Intronic
956257394 3:67298150-67298172 GGGGAGTGCTTAGGAAATACGGG + Intergenic
958850326 3:99317392-99317414 GAGGAGTGATTAGGAACATCTGG - Intergenic
959944923 3:112116054-112116076 GTAGACTGAGTAGGGAAAAAGGG + Intronic
960581047 3:119279250-119279272 CAGGACTGAGTAGGAAAACCAGG + Intergenic
960742524 3:120850787-120850809 GAGGACTGCTTAGGAAAAATGGG + Intergenic
963083866 3:141418940-141418962 ATAGACTGATCAGGAAAGACTGG + Intronic
963493214 3:146027322-146027344 TTGGACAGAGTAGGAATAACTGG + Intergenic
964586868 3:158316402-158316424 GTGGACTGATTAGAAAAAGCAGG - Intronic
965391625 3:168111163-168111185 GGGCATTGATTAGGAAAAACAGG - Intergenic
965464674 3:169013275-169013297 GAGGATTGCTTAGGAAATACTGG - Intergenic
965588456 3:170340511-170340533 CTGGACTCCTTGGGAAAAACAGG - Intergenic
966809374 3:183829667-183829689 ATGAACTGATTTGGAAGAACAGG - Exonic
1202736240 3_GL000221v1_random:1317-1339 GTGGACTGATGAGGAGAAAAGGG - Intergenic
969297164 4:6277013-6277035 GTGCCCTTATTTGGAAAAACAGG - Intronic
971536084 4:27753165-27753187 GTGAGATGATTAGGAAAAAATGG + Intergenic
974174339 4:58305829-58305851 GAGGACTGATCAAGAAAAATCGG - Intergenic
974905782 4:68054949-68054971 TTTGACTGATAAGGAAAAACAGG + Intronic
977720387 4:100233007-100233029 TTGGCTTGCTTAGGAAAAACCGG - Intergenic
980382057 4:132034836-132034858 GTGGGCTTATTAGCAAAAAAAGG + Intergenic
982557793 4:156890520-156890542 GAGGACTGTTCAGGAAAGACTGG - Intronic
983052796 4:163068575-163068597 GAGCACTGATTAGGAAGGACAGG + Intergenic
983486733 4:168341023-168341045 GTGGACTGATGAAGATAAAATGG - Intergenic
984181397 4:176487143-176487165 GTAGACTGATCAGGCAAAAAAGG + Intergenic
1202769683 4_GL000008v2_random:191953-191975 GTGGACTGATGAGGAGAAAAGGG + Intergenic
986080903 5:4393279-4393301 CTGGAGTGAGGAGGAAAAACAGG - Intergenic
990045462 5:51425096-51425118 GTGCTCTGATCAGTAAAAACGGG + Intergenic
990290593 5:54346761-54346783 CTGGACTTCTTGGGAAAAACAGG + Intergenic
991154882 5:63421421-63421443 GTGCACAAATTAGGAAAAAATGG - Intergenic
992666553 5:79015167-79015189 GTGGATTAACTAGGAAACACAGG - Intronic
993044445 5:82851638-82851660 TTGGAATGCTTAGAAAAAACTGG - Intergenic
994489665 5:100424882-100424904 TAGGACTTGTTAGGAAAAACAGG + Intergenic
996760811 5:126984217-126984239 GTGGACTGATGAGGAGGAAGGGG + Intronic
996767878 5:127053094-127053116 GTGGACTGATTAGGAAAAACAGG - Intronic
1004676888 6:17851538-17851560 GAGGAGTGATTCAGAAAAACAGG + Intronic
1004697248 6:18044995-18045017 GTGAACTGATAAGGAATAATAGG - Intergenic
1005064131 6:21801808-21801830 GTGGCCTCATTAGGAAATACGGG - Intergenic
1011144349 6:84196001-84196023 GTGATGTGATTAGGAAATACTGG - Intronic
1011844800 6:91550616-91550638 GTGGATTGAGTATGAAAAAGTGG + Intergenic
1015930276 6:138352356-138352378 GAGGACTGATTAAGAAAAAAAGG - Intergenic
1015958825 6:138626221-138626243 GTGGACTGATCAGGCAGGACTGG - Intronic
1016368387 6:143343291-143343313 ATGAACTGATTTGGAAGAACAGG + Intergenic
1016372851 6:143392625-143392647 GTGGCCTGATTTGGAAATAGGGG - Intergenic
1016652298 6:146476250-146476272 GTGCACTAAAAAGGAAAAACAGG + Intergenic
1016854464 6:148652668-148652690 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1016976737 6:149816061-149816083 GTGGAAAGATGAGGAAAAACAGG - Intergenic
1017404752 6:154107209-154107231 CTGGACTCCTTGGGAAAAACAGG - Intronic
1023118644 7:36887115-36887137 GTGTACAGATTAGGAAATAGAGG - Intronic
1023239880 7:38132891-38132913 CTGGACTGAGTAGGAAGAATAGG - Intergenic
1024419416 7:49145037-49145059 TTTGAGTGCTTAGGAAAAACAGG - Intergenic
1025768865 7:64484654-64484676 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1030437022 7:109535162-109535184 GTGGACAAATAAGGAAATACTGG - Intergenic
1031142277 7:117956517-117956539 GTGGACTTATTTGGAAAAAATGG - Intergenic
1031742892 7:125456450-125456472 CTGGACTTATTGGGAAAAACAGG - Intergenic
1032494156 7:132348482-132348504 GTGGAAAGGTTAGGAAACACTGG - Intronic
1036141665 8:6214823-6214845 AGGGATTTATTAGGAAAAACTGG - Intergenic
1039229890 8:35432656-35432678 GTGGAATGAGCTGGAAAAACGGG + Intronic
1041691251 8:60689803-60689825 TTGGACTGATAAGTGAAAACAGG - Intronic
1044032827 8:87259772-87259794 CTGGACTCCTTAGGAAAAACAGG - Intronic
1044964301 8:97560256-97560278 GAGAACTGATTGGGAAAACCAGG - Intergenic
1045741822 8:105369367-105369389 GTGTACTCAGTAGGAAAAAATGG + Intronic
1051969606 9:22872115-22872137 GTGCATTGATTAGGAAGAATAGG - Intergenic
1052013736 9:23441709-23441731 GTGAAGAGATTAGGAAAAAGGGG + Intergenic
1052663631 9:31467972-31467994 CTGGACTCCTTGGGAAAAACAGG - Intergenic
1053658997 9:40250937-40250959 GTGGACTGATGAGGAGAAAAGGG - Intronic
1053909369 9:42880310-42880332 GTGGACTGATGAGGAGAAAAGGG - Intergenic
1054360037 9:64103719-64103741 ATGGACTGATGAGGAGAAAAGGG - Intergenic
1054371120 9:64397237-64397259 GTGGACTGATGAGGAGAAAAGGG - Intronic
1054525601 9:66125285-66125307 GTGGACTGATGAGGAGAAAAGGG + Intronic
1054678748 9:67886956-67886978 GTGGACTGATGAGGAGAAAAGGG - Intronic
1055970845 9:81911319-81911341 CTGGACTCCTTGGGAAAAACAGG - Intergenic
1057038456 9:91830099-91830121 GTTGACTGATTTGAAAATACAGG - Intronic
1057620727 9:96632338-96632360 GTGGTCTGATAAGGAAAAGATGG - Intergenic
1059749375 9:117233371-117233393 CTTGACTGATGAGGAAAATCAGG - Intronic
1203694582 Un_GL000214v1:85676-85698 GTGGACTAATGAGGAGAAAAGGG + Intergenic
1203704967 Un_KI270742v1:31756-31778 GTGGACTGATAAGGAGAAAAGGG - Intergenic
1203559036 Un_KI270744v1:34055-34077 GTGGACTAATGAGGAGAAAAGGG + Intergenic
1203641691 Un_KI270751v1:18387-18409 GTGGACTAATGAGGAGAAAAGGG - Intergenic
1187474672 X:19600448-19600470 GTGAACTGAGAAGGCAAAACAGG + Intronic
1187653635 X:21442609-21442631 GTGGAATCATCATGAAAAACAGG - Intronic
1191692033 X:63950206-63950228 GGGGCCTGGTTGGGAAAAACAGG + Intergenic
1192684968 X:73294253-73294275 TTGGACTGAATAGGAAAGTCTGG - Intergenic
1193165860 X:78279712-78279734 GTGGACTGATAAAGAAAACATGG + Intronic
1193698365 X:84736699-84736721 GTGTCCTGAGTAGGATAAACTGG - Intergenic
1193880920 X:86919868-86919890 GTGGCCTGATTTTGACAAACAGG + Intergenic
1195751786 X:108167179-108167201 CTGGACTGAGTTGGAAAAATGGG - Intronic
1196010575 X:110883206-110883228 GTGGACTGAATAAAAAAAAGTGG - Intergenic
1196276696 X:113774331-113774353 GTGGACAGATCAGGAAAATGAGG - Intergenic
1196688096 X:118529735-118529757 GTGCACTGAATAGGAAGAAGTGG + Intronic
1198149955 X:133898415-133898437 AAGTACTGTTTAGGAAAAACGGG + Intronic
1198156416 X:133965224-133965246 GTGACCTTATTTGGAAAAACGGG + Intronic
1198731326 X:139733129-139733151 GAGGACTCTGTAGGAAAAACAGG - Intronic