ID: 1113543925

View in Genome Browser
Species Human (GRCh38)
Location 13:111131671-111131693
Sequence GGGCAGTGACCTGAGGTCAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 662
Summary {0: 1, 1: 1, 2: 4, 3: 71, 4: 585}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113543913_1113543925 24 Left 1113543913 13:111131624-111131646 CCTGAAGAGAGAAACTAAGGCAG 0: 1
1: 0
2: 1
3: 28
4: 298
Right 1113543925 13:111131671-111131693 GGGCAGTGACCTGAGGTCAGGGG 0: 1
1: 1
2: 4
3: 71
4: 585

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113543925 Original CRISPR GGGCAGTGACCTGAGGTCAG GGG Intronic
900196923 1:1381204-1381226 GAGCATTGACCTGAGGGTAGGGG - Intergenic
900294674 1:1942951-1942973 GGGTAGTGGTCAGAGGTCAGAGG - Intronic
900368666 1:2321819-2321841 GGGCTGTGGCCTGAGGTCAGAGG - Intronic
900464782 1:2820455-2820477 TGGCAGTGACCCCAAGTCAGCGG + Intergenic
900498611 1:2988547-2988569 GGGCGGTGTCCGGAGGACAGAGG - Intergenic
900602817 1:3510278-3510300 GGCCAGTGACCTCAGGCCAGAGG + Intronic
900964508 1:5948432-5948454 GGGCAGTGCCCCAAGGCCAGTGG - Intronic
901119922 1:6882955-6882977 TGGCAGTGAGCTGAGACCAGAGG - Intronic
901148930 1:7087463-7087485 GGGAAGTGACCCTGGGTCAGTGG + Intronic
901154044 1:7123657-7123679 GGGCAGTGACCAGGGCTCAGAGG - Intronic
901387504 1:8920861-8920883 GGCCAATCACCTGAGGTCAGTGG + Intergenic
901638342 1:10680637-10680659 CGGCTGGGCCCTGAGGTCAGCGG + Intronic
902061808 1:13650222-13650244 GGCAAATCACCTGAGGTCAGGGG - Intergenic
902104387 1:14021657-14021679 GGGCATTGACCTCAGGACAAAGG - Intergenic
902221177 1:14966893-14966915 GGGTGATCACCTGAGGTCAGGGG - Intronic
902390449 1:16101244-16101266 GGTGAATCACCTGAGGTCAGGGG + Intergenic
904259415 1:29279869-29279891 GGGCTGGTGCCTGAGGTCAGGGG + Intronic
904271258 1:29351597-29351619 GGGCTGTGAGCTGAGGGCACTGG - Intergenic
904425089 1:30417815-30417837 GGGCTGTGAGCTGAGGGCACTGG + Intergenic
904561360 1:31399643-31399665 GGGAGGGGACCTGAGGGCAGGGG + Intergenic
905153606 1:35953735-35953757 GGTGAATCACCTGAGGTCAGAGG - Intronic
905231263 1:36516144-36516166 AGGCAGTGCCTGGAGGTCAGGGG - Intergenic
905262827 1:36731417-36731439 GAGGAGAGCCCTGAGGTCAGAGG - Intergenic
905369588 1:37475889-37475911 GGGCAGCGACCTGAGACCAGTGG + Exonic
906070426 1:43012389-43012411 GGTGAATCACCTGAGGTCAGGGG + Intergenic
906225415 1:44117984-44118006 GGACAGTGACACGAGGACAGAGG - Intergenic
906409212 1:45565698-45565720 GGTGAATCACCTGAGGTCAGGGG - Intronic
906416120 1:45622375-45622397 GGCCAGTCACCAGAGGTCAAAGG - Intronic
906628690 1:47346727-47346749 AGGCAATCACCTGAGGTCTGAGG - Intronic
906903694 1:49865345-49865367 GGGCACTGACCTGATGCCAGAGG - Intronic
907257460 1:53190708-53190730 GGGAAGTGCCCTGAGGTGACAGG + Intergenic
908085648 1:60630661-60630683 GGGCATCTACCTGAGGTTAGGGG - Intergenic
908204821 1:61835627-61835649 GGGGAATCACTTGAGGTCAGGGG - Intronic
908256055 1:62304562-62304584 TGGAGGTCACCTGAGGTCAGTGG - Intronic
908782353 1:67702120-67702142 GAGCACTTACCTGAAGTCAGTGG - Exonic
908871269 1:68615805-68615827 GGCGGGTCACCTGAGGTCAGGGG + Intergenic
910635659 1:89405061-89405083 GGACAGAGACCTGAGGGAAGGGG - Intergenic
911086226 1:93979575-93979597 GGGAACTTGCCTGAGGTCAGAGG - Intergenic
911104508 1:94119305-94119327 GGAAAGTGACCTGAGGACAATGG + Intronic
912389198 1:109290240-109290262 GGGCTGTGAGCTGAGGCCAAAGG + Intergenic
912671810 1:111635796-111635818 GGGGGATCACCTGAGGTCAGAGG - Intronic
912758198 1:112342438-112342460 TGGCTGTGGCCAGAGGTCAGTGG - Intergenic
913595995 1:120377691-120377713 GGGCAGTAACTTGAAGTCAATGG + Intergenic
914091284 1:144501285-144501307 GGGCAGTAACTTGAAGTCAATGG - Intergenic
914307319 1:146432914-146432936 GGGCAGTAACTTGAAGTCAATGG + Intergenic
914594787 1:149140217-149140239 GGGCAGTAACTTGAAGTCAATGG - Intergenic
915230138 1:154439538-154439560 GGTGAATCACCTGAGGTCAGGGG - Intronic
915927666 1:160036136-160036158 GGTGAATCACCTGAGGTCAGGGG + Intergenic
916011219 1:160707649-160707671 GGGCAGAGGACTGAGGTAAGGGG + Intronic
916026317 1:160836675-160836697 GGGCGCTGACTTGAGGTCAAGGG - Intronic
916423858 1:164662098-164662120 GGCAGGTCACCTGAGGTCAGGGG + Intronic
916662355 1:166934540-166934562 GGGCAGGCTCCTGAGGGCAGAGG - Intronic
917793394 1:178514127-178514149 GGGAAGTGACCAGGAGTCAGGGG + Intronic
917864427 1:179179873-179179895 GGGGGATGACTTGAGGTCAGGGG + Intronic
917892701 1:179454866-179454888 GGTGGGTCACCTGAGGTCAGTGG + Intronic
917972845 1:180219710-180219732 GTGCACTTACCAGAGGTCAGGGG - Intergenic
917972903 1:180219963-180219985 GGCCTGTGATCTGAGGTCTGGGG - Intergenic
918187086 1:182137631-182137653 GGGAAGAGGCCTGAGGTCAGAGG - Intergenic
919120467 1:193334104-193334126 GGGTACTGGCCTGAAGTCAGGGG + Intergenic
919212030 1:194499115-194499137 GGTGGATGACCTGAGGTCAGGGG - Intergenic
919339378 1:196284003-196284025 GGCCGATCACCTGAGGTCAGGGG + Intronic
919682175 1:200446560-200446582 GGGGATTCACCTGAGGGCAGGGG + Intergenic
920022503 1:202966793-202966815 GGAGAGTGACCTGAGGCCGGCGG + Exonic
920522684 1:206640159-206640181 GGTGGATGACCTGAGGTCAGGGG - Intronic
920565610 1:206970296-206970318 GAGAAGTGACTTGAGGTGAGTGG - Exonic
921005901 1:211093509-211093531 GGAGAATCACCTGAGGTCAGGGG - Intronic
921468094 1:215515635-215515657 GGCGAATCACCTGAGGTCAGGGG + Intergenic
922035202 1:221840952-221840974 GGGCAGTGATCTGAGTGCTGAGG + Intergenic
922746223 1:228045668-228045690 GGGAAGTAACATGGGGTCAGGGG + Intronic
922842209 1:228651621-228651643 GGGCAGTCCCTTGAGGGCAGGGG - Intergenic
923210812 1:231802703-231802725 AGGCATTGACAGGAGGTCAGTGG + Intronic
1063691041 10:8287374-8287396 GGGGAATCACCTGAGGTCATCGG + Intergenic
1064625061 10:17253078-17253100 GGCGAATCACCTGAGGTCAGTGG + Intergenic
1064765128 10:18663067-18663089 TGGCAGTGAGCTGAGATCACAGG - Intronic
1065879764 10:30028556-30028578 GGACAGTGGCCTGATGTGAGAGG - Exonic
1066050051 10:31625590-31625612 TGCCAAAGACCTGAGGTCAGAGG + Intergenic
1066467971 10:35670240-35670262 AGGCAGTGCCCTAAGATCAGGGG - Intergenic
1067365908 10:45628532-45628554 GGTGAATCACCTGAGGTCAGGGG - Intronic
1067939950 10:50646893-50646915 GTCCAATCACCTGAGGTCAGGGG + Intergenic
1070031817 10:72684323-72684345 GGTGAATCACCTGAGGTCAGGGG - Intergenic
1070176707 10:73976702-73976724 GGTGAATCACCTGAGGTCAGGGG - Intergenic
1070696893 10:78570393-78570415 GAGCAGGGACCTGAGGAGAGTGG - Intergenic
1070697128 10:78571795-78571817 GGGCAGCCACCTGAGGACACAGG + Intergenic
1070761086 10:79024836-79024858 GGGGAGTGACCTGACAGCAGAGG + Intergenic
1070803145 10:79255169-79255191 GGGCAGTGTCGTGAGCTCAGTGG - Intronic
1071032605 10:81203276-81203298 GGCAGGTCACCTGAGGTCAGGGG + Intergenic
1072552833 10:96492396-96492418 GGTGGGTCACCTGAGGTCAGGGG + Intronic
1072633360 10:97162382-97162404 GGTGTGTCACCTGAGGTCAGGGG + Intronic
1073072052 10:100800739-100800761 GGGCCCTGACCTGGGGTGAGAGG + Intronic
1073382002 10:103085261-103085283 AGTCATTGACTTGAGGTCAGTGG + Exonic
1073716685 10:106115336-106115358 GAGCACTGACCTGATGCCAGTGG - Intergenic
1075040951 10:119106131-119106153 TTGCAGTGAGCTGAGATCAGAGG + Intronic
1075182791 10:120226959-120226981 AGGAGGTGACGTGAGGTCAGTGG + Intergenic
1075432880 10:122403915-122403937 GGCCAGTCACTTGAGGTCAGGGG - Intronic
1075782789 10:125027576-125027598 GGGCAGCGTCCTGTGGTCGGTGG + Exonic
1076000888 10:126912201-126912223 GGCGGGTCACCTGAGGTCAGGGG + Intronic
1076049621 10:127321875-127321897 GGCCAATCACCTGAGGTCAGGGG + Intronic
1077070984 11:672619-672641 GGTGAATCACCTGAGGTCAGGGG + Intronic
1077182622 11:1223427-1223449 GGGCCTTGCCCTGCGGTCAGGGG - Intronic
1077239412 11:1502770-1502792 GGCGTGTGACCTGAGCTCAGAGG - Intergenic
1077358039 11:2127665-2127687 TGGAAGTGACCTGGGGCCAGTGG + Intergenic
1077391367 11:2302061-2302083 GGGCAGTGAGCTGCGGTCTGAGG + Exonic
1077445456 11:2588576-2588598 GGACAGGGACCTGAGGCCTGGGG - Intronic
1077472577 11:2770919-2770941 GGGCAGTCCCCCGAGGGCAGAGG + Intronic
1077521408 11:3037549-3037571 GGGCAGAGACCTGGGTGCAGAGG - Intronic
1078660375 11:13280992-13281014 GAGGAGAAACCTGAGGTCAGAGG - Intronic
1079011173 11:16829548-16829570 GGTGAATCACCTGAGGTCAGGGG + Intronic
1079773758 11:24497319-24497341 CGTGAGTGACCTGAGGCCAGGGG + Intronic
1080083580 11:28251820-28251842 GGGCAGTGACTAGAGGTGGGAGG - Intronic
1080618646 11:33968049-33968071 GTGCAAAGACCTGAGGTCGGTGG - Intergenic
1080627616 11:34044826-34044848 GGGCAGATATCTGAGGTCAGGGG - Intergenic
1080646844 11:34193752-34193774 GGGCAGAGGCCTGGGCTCAGAGG - Intronic
1082086153 11:48051625-48051647 ATGCAATGCCCTGAGGTCAGTGG - Intronic
1083266745 11:61550427-61550449 GGGCAGGGGCCAGAGGGCAGGGG + Intronic
1083593824 11:63909797-63909819 GCCCAGGGGCCTGAGGTCAGGGG - Exonic
1083736649 11:64685395-64685417 GGGCAGGAACCTGAGGGCAGGGG - Intronic
1083925639 11:65804355-65804377 GGGCTGTGGCCTGAGGGCTGTGG - Intergenic
1084012500 11:66360459-66360481 GGGCACTGAGCTGGGCTCAGTGG - Intronic
1084478832 11:69405074-69405096 GGTGAATCACCTGAGGTCAGGGG - Intergenic
1084661595 11:70549608-70549630 GGGAAGTGACCCGAGGTCCCCGG + Intronic
1085037872 11:73310509-73310531 GGGATGTGACCCGAGGGCAGCGG + Exonic
1085460673 11:76691349-76691371 GGACAGTGAGCTGAGGGCACAGG + Intergenic
1087288310 11:96291349-96291371 GGTGAATCACCTGAGGTCAGGGG - Intronic
1087943872 11:104134985-104135007 GTCCAGTGCCCTGAGGCCAGTGG + Intronic
1088744473 11:112794086-112794108 GGGCAGGGATATGAGGTGAGTGG + Intergenic
1089129715 11:116202207-116202229 GGGGAGTGACCAGATGTCTGAGG + Intergenic
1089431926 11:118432191-118432213 GGCAAATCACCTGAGGTCAGGGG - Intergenic
1089684423 11:120137842-120137864 GGGCAGCGCCCTGAAGCCAGGGG - Exonic
1090038701 11:123271441-123271463 GGCAGATGACCTGAGGTCAGTGG + Intergenic
1090527470 11:127553166-127553188 GGTGGATGACCTGAGGTCAGGGG + Intergenic
1091406162 12:210830-210852 GGGCAGTGACCTGCTGAGAGGGG - Intronic
1091561141 12:1614572-1614594 CAGCAGTGACCAGAGGCCAGCGG + Intronic
1091829404 12:3538950-3538972 GGGGAGTGAGCTGGGGGCAGTGG - Intronic
1091998720 12:5016146-5016168 GGGCGGTCACAGGAGGTCAGTGG + Intergenic
1092153708 12:6268602-6268624 GGCCAGTCAGCTGAGGTCAGAGG + Intergenic
1092379036 12:7979839-7979861 GGCAGATGACCTGAGGTCAGGGG + Intergenic
1092379120 12:7980357-7980379 GGCAGATGACCTGAGGTCAGGGG + Intergenic
1092747382 12:11686750-11686772 GGCCAATCACTTGAGGTCAGGGG - Intronic
1092821521 12:12357454-12357476 GGGCAGTGAGCAGAGCTCCGAGG + Exonic
1093516215 12:19989764-19989786 GGTGAATTACCTGAGGTCAGGGG + Intergenic
1094138108 12:27150985-27151007 GGCCAATCACATGAGGTCAGGGG - Intergenic
1094647854 12:32344362-32344384 GGACAGGGACCTGAAGACAGAGG + Intronic
1095507185 12:42910194-42910216 GGCCACTGACCTGGGCTCAGTGG - Intergenic
1095894107 12:47263431-47263453 GGGGGATCACCTGAGGTCAGGGG - Intergenic
1095997505 12:48101058-48101080 GGCCGATCACCTGAGGTCAGGGG + Intronic
1096149572 12:49300315-49300337 GGTGAATCACCTGAGGTCAGGGG - Intergenic
1097820721 12:64126512-64126534 GGACACTGACCTAAAGTCAGAGG + Intronic
1098086233 12:66847083-66847105 AGGCAGTGGCTAGAGGTCAGTGG - Intergenic
1102480766 12:113221667-113221689 GGGCAGGGATCAGGGGTCAGAGG + Intronic
1102597851 12:114006489-114006511 GGCGAGTCACCTGAGGTCAGGGG - Intergenic
1103507280 12:121450086-121450108 GGGTGATCACCTGAGGTCAGGGG + Intronic
1103660059 12:122507150-122507172 GGCAAATCACCTGAGGTCAGGGG + Intronic
1104370775 12:128222150-128222172 GGCAGGTCACCTGAGGTCAGGGG - Intergenic
1104756038 12:131269806-131269828 GGGCAGTGAGCTGAGGGGAGCGG + Intergenic
1105012638 12:132765970-132765992 GGTGAATCACCTGAGGTCAGGGG + Intergenic
1105013025 12:132768373-132768395 GGGTGGTCACCTGAGGTCAGGGG - Intergenic
1105205763 13:18222131-18222153 GTGCAGAGAACTGAGGGCAGAGG + Intergenic
1105307779 13:19181274-19181296 GGGGAATCCCCTGAGGTCAGGGG - Intronic
1105484354 13:20812143-20812165 GGTGAATCACCTGAGGTCAGGGG + Intronic
1105714426 13:23047980-23048002 GGTGGGTCACCTGAGGTCAGGGG - Intergenic
1105899480 13:24743107-24743129 GGGCAGGAAGCTGTGGTCAGGGG - Intergenic
1106994713 13:35468173-35468195 GGCCAGTTCCCAGAGGTCAGAGG - Intronic
1107529358 13:41266932-41266954 TTGCAGTGAGCTGAGATCAGGGG + Intergenic
1111305727 13:86410101-86410123 GGGCACTGACCTGATGCCATAGG - Intergenic
1111831409 13:93334690-93334712 GGCGAATCACCTGAGGTCAGGGG - Intronic
1112035540 13:95493201-95493223 GGGAAGGTACCTGAGGTCACTGG - Intronic
1112954734 13:105043434-105043456 TGGCAGAGACCTGAGGACATTGG + Intergenic
1113543925 13:111131671-111131693 GGGCAGTGACCTGAGGTCAGGGG + Intronic
1113737607 13:112689836-112689858 GGGCAGAGGGCAGAGGTCAGAGG - Intergenic
1113886100 13:113659034-113659056 GGGCAGTGCACTGGGGTCACAGG + Intergenic
1114571908 14:23675800-23675822 GGGCAGGAATCTGAGCTCAGGGG + Intergenic
1115644023 14:35354706-35354728 GGCTAATCACCTGAGGTCAGGGG - Intergenic
1116586812 14:46716615-46716637 GGTCAGTGGGCTGGGGTCAGTGG - Intergenic
1117539434 14:56732391-56732413 GGTGGATGACCTGAGGTCAGGGG - Intergenic
1118147523 14:63156771-63156793 GGGTAGTTACCTGTGTTCAGGGG - Intergenic
1118237099 14:64017102-64017124 GGTGAATCACCTGAGGTCAGGGG + Intronic
1119150338 14:72353755-72353777 GGGGGATCACCTGAGGTCAGGGG + Intronic
1119336225 14:73835960-73835982 GATCAGTCACCTGAGGTCAGGGG + Intergenic
1119420705 14:74506247-74506269 GGGCAGTGGGCTGTAGTCAGGGG - Intronic
1119832860 14:77718934-77718956 AGGCGATCACCTGAGGTCAGGGG - Intronic
1120495942 14:85235569-85235591 GGCGAATCACCTGAGGTCAGGGG + Intergenic
1120821102 14:88912621-88912643 GTGCAGTGAGGTGAGGCCAGAGG + Intergenic
1122083421 14:99282899-99282921 GGTGGGTCACCTGAGGTCAGAGG + Intergenic
1122203748 14:100138015-100138037 GGGCAGTGACCTGTCCACAGAGG + Intronic
1122227471 14:100287992-100288014 GGTCAGAGACCAGAGGTCAAGGG + Intergenic
1122631712 14:103110254-103110276 TGGCAGGGAGCTGTGGTCAGTGG + Exonic
1123012358 14:105355652-105355674 GGGCAGCACCCAGAGGTCAGAGG + Intronic
1123161550 14:106282968-106282990 AGGCAGTGTCCTGTGGTGAGAGG - Intergenic
1123418735 15:20114073-20114095 GGGCAGTGTGCTGACCTCAGTGG - Intergenic
1123494352 15:20810460-20810482 GGCAGGTCACCTGAGGTCAGAGG - Intergenic
1123527953 15:21120612-21120634 GGGCAGTGTGCTGACCTCAGTGG - Intergenic
1123550850 15:21379551-21379573 GGCAGGTCACCTGAGGTCAGAGG - Intergenic
1126596119 15:50385893-50385915 GGCCGATCACCTGAGGTCAGAGG - Intergenic
1126702578 15:51381364-51381386 GGCCAGTTAACAGAGGTCAGAGG - Intronic
1127359253 15:58230514-58230536 TGGCAGGGACTTGAGCTCAGAGG + Intronic
1127361930 15:58251968-58251990 GGGCAGAGCTCTGAGGTCTGGGG - Intronic
1127437160 15:58969331-58969353 GGGAGATCACCTGAGGTCAGGGG + Intronic
1127665370 15:61140772-61140794 GGGCAGTGGCGGGGGGTCAGGGG + Intronic
1128114908 15:65099269-65099291 AGGGGGTGACCTGAGGTAAGTGG - Intronic
1129196551 15:73971363-73971385 GGTGAATCACCTGAGGTCAGGGG + Intergenic
1129680758 15:77657248-77657270 GGGCAGCTACCTGAGGTCAGGGG - Intronic
1129684216 15:77676109-77676131 GGACAGAGACCTGGGGTCTGGGG - Intronic
1129884860 15:79030922-79030944 GGGCCTTGACCAGAGGACAGGGG + Intronic
1130661631 15:85835371-85835393 GGGAAATCACCTGAGGTCAGGGG + Intergenic
1131234246 15:90682405-90682427 GGGCAGAGGCCAGAGGTGAGGGG - Intergenic
1132418967 15:101648120-101648142 GGTGAATCACCTGAGGTCAGAGG - Intronic
1202959190 15_KI270727v1_random:106795-106817 GGCAGGTCACCTGAGGTCAGAGG - Intergenic
1132508151 16:322851-322873 GGGCAGTGGCCTGGGGGAAGAGG + Intronic
1132648094 16:1008208-1008230 GGGCAGGGACCTGGGGCCCGTGG + Intergenic
1132657730 16:1048380-1048402 GGGCAGATCCCTGAGCTCAGGGG + Intergenic
1133292943 16:4734684-4734706 AGGCAGAGGCCTGAGGTGAGGGG + Exonic
1133908341 16:10041792-10041814 GGGCTTTGAACTGAGCTCAGCGG - Intronic
1135186825 16:20322749-20322771 GGGCATGGACCTGAGGTCAAGGG - Intronic
1135816953 16:25643393-25643415 GGTGAATCACCTGAGGTCAGGGG + Intergenic
1136171285 16:28491415-28491437 GGGAAGTGACCGGAGGAAAGGGG - Intronic
1136171469 16:28492241-28492263 GAGCCGTGACCTTAGATCAGTGG + Intronic
1136424795 16:30162534-30162556 GGGCAGTGACTGTGGGTCAGGGG + Intergenic
1136655789 16:31708448-31708470 AGGCAGGAAGCTGAGGTCAGGGG - Intergenic
1138115711 16:54358900-54358922 GGGCAGAGCTCTGAGGACAGTGG + Intergenic
1138241796 16:55433536-55433558 TGGCTTTGATCTGAGGTCAGTGG - Intronic
1138597373 16:58036208-58036230 AGGCAGTGAGCAGAGGCCAGGGG - Intronic
1138787541 16:59864871-59864893 GGCCAGAGACAGGAGGTCAGGGG + Intergenic
1138827965 16:60343738-60343760 GGGCAAAGGCCTGAGGACAGAGG + Intergenic
1138882251 16:61030815-61030837 GAGCACTGACCTGATGCCAGTGG + Intergenic
1138964917 16:62072635-62072657 GGTGGATGACCTGAGGTCAGGGG + Intergenic
1139356800 16:66371533-66371555 GGGCAGGTGCCTGTGGTCAGGGG + Intronic
1139654838 16:68381214-68381236 GAGCAGTGGCCTGGGGTTAGAGG - Intronic
1139684672 16:68593721-68593743 GGCGGGTCACCTGAGGTCAGGGG - Intergenic
1139908935 16:70384797-70384819 GGCCGATCACCTGAGGTCAGGGG + Intronic
1140056432 16:71529920-71529942 GGAGAATCACCTGAGGTCAGGGG + Intronic
1140396517 16:74631844-74631866 AGGCAATCAGCTGAGGTCAGGGG - Intronic
1141634088 16:85304466-85304488 GGGCAGTGCCCTCAGCTCTGTGG + Intergenic
1141703837 16:85654211-85654233 TGGCTGTGTCCTGTGGTCAGTGG + Intronic
1142212314 16:88814179-88814201 CGGCAGGGTCCTGAGGTCTGAGG + Exonic
1142632951 17:1237552-1237574 GGCGAATCACCTGAGGTCAGGGG - Intergenic
1143522546 17:7453342-7453364 GGCGAATCACCTGAGGTCAGGGG - Intronic
1143582069 17:7833449-7833471 CGGCATTGACCTGCGGTCTGGGG + Exonic
1143980455 17:10865058-10865080 GGGCTGTGTCCTAAGGTCAAGGG - Intergenic
1144263885 17:13549555-13549577 GGAAAGTGCCCTGAGGTCAGAGG - Intronic
1144367247 17:14556336-14556358 GGTGAATCACCTGAGGTCAGGGG + Intergenic
1144963231 17:19058706-19058728 AGGCAGTAACTTGAGATCAGGGG - Intergenic
1144971928 17:19115819-19115841 AGGCAGTAACTTGAGATCAGGGG + Intergenic
1145753925 17:27376209-27376231 AGGGAATCACCTGAGGTCAGGGG + Intergenic
1145889779 17:28406256-28406278 GGCCTGTGACCTGAGGCCACCGG + Intronic
1147365134 17:39954059-39954081 GGCCAATCACCTGAGGTCAGGGG + Intergenic
1147663594 17:42130704-42130726 GGGCAGGGAGGTGAGGTGAGGGG - Intronic
1148764508 17:50029266-50029288 GGGAGGTGACCAGAGGGCAGAGG - Intergenic
1149416712 17:56467452-56467474 GGCAGGTCACCTGAGGTCAGGGG + Intronic
1150190405 17:63232651-63232673 GGGCACTGACCCGATGTCAGCGG + Intronic
1150205339 17:63400876-63400898 GGGAGATCACCTGAGGTCAGGGG - Intronic
1150849780 17:68693658-68693680 GGTCAGTGACCTGAGGTTTAGGG - Intergenic
1151634716 17:75338153-75338175 GGCAAATCACCTGAGGTCAGAGG - Intronic
1151991227 17:77575903-77575925 GTGCTGTGGCCTGAGGGCAGGGG - Intergenic
1152357239 17:79813259-79813281 GGGCGGTTACCTGCGGGCAGAGG - Intergenic
1152437976 17:80287928-80287950 GGGCTGTGTCCTGAGGCCACGGG - Exonic
1152457720 17:80425715-80425737 GTGCAGTGACATGAGGACGGGGG + Intronic
1153256561 18:3177696-3177718 GGTGGATGACCTGAGGTCAGGGG - Intronic
1153300427 18:3587278-3587300 GGTGAATCACCTGAGGTCAGGGG - Intronic
1153749261 18:8211952-8211974 GGGCTGTGACCAGGTGTCAGGGG + Intronic
1154304222 18:13218520-13218542 GGGCAGGGACTGGAGGTCAGCGG + Intronic
1154451883 18:14484914-14484936 GGCAGGTCACCTGAGGTCAGAGG - Intergenic
1154502291 18:15002920-15002942 GGGCAGGGGCCTGAAGGCAGGGG + Intergenic
1155751297 18:29425300-29425322 GGTGAATCACCTGAGGTCAGGGG + Intergenic
1155777133 18:29778719-29778741 AGGCAGTAAACTGAGGTCATAGG + Intergenic
1156465220 18:37344397-37344419 GGGCAGAGACAGGGGGTCAGGGG + Intronic
1156797738 18:41068711-41068733 AGGCAGAGACGTGAAGTCAGTGG + Intergenic
1157477851 18:48034897-48034919 GGGCCTTGGCCTGAGGTCTGTGG + Intronic
1157923131 18:51734127-51734149 GGTCAGTAACTTCAGGTCAGTGG + Intergenic
1158652461 18:59300104-59300126 GGGGGATCACCTGAGGTCAGGGG + Intronic
1158676910 18:59528858-59528880 GGGCACTGACCTGATGCCAGTGG + Intronic
1160777490 19:862684-862706 GGGGCGTGGCCTGAGGTGAGTGG + Intronic
1161020866 19:2010862-2010884 GGGCAGACATCTGAGGTCAGGGG - Intronic
1161292495 19:3502574-3502596 GGACAGTGTCCTGAGCACAGAGG + Intergenic
1161545850 19:4879351-4879373 GGTGAATCACCTGAGGTCAGGGG + Intergenic
1161818045 19:6512057-6512079 GGTGAATCACCTGAGGTCAGGGG + Intergenic
1161854322 19:6754696-6754718 TGGGAGTGACCAGAGATCAGCGG - Exonic
1162382696 19:10340785-10340807 GGTCAGAGGCCTGAGGTCAGAGG - Intergenic
1162634925 19:11960429-11960451 GGGCAGAAAGCTGAGGTGAGAGG - Intronic
1162769812 19:12942496-12942518 GTGCAGAGAACTGAAGTCAGTGG + Intronic
1162991225 19:14303730-14303752 GGGGGATCACCTGAGGTCAGGGG - Intergenic
1163024535 19:14502754-14502776 GGGCTGTAACCTGAGGCCACAGG - Intergenic
1163036582 19:14572682-14572704 GGGGAATCACTTGAGGTCAGGGG - Intergenic
1163121049 19:15218071-15218093 GGCGAATCACCTGAGGTCAGGGG - Intergenic
1163503043 19:17687533-17687555 GGGCTGTGACTGGAGGTCTGGGG - Intronic
1163589831 19:18186432-18186454 GGGCAGATAACTGAGGTCAGGGG + Intergenic
1163860240 19:19738984-19739006 GGGCAGAGGGCTGAGGGCAGAGG - Intergenic
1163860244 19:19738998-19739020 GGGCAGAGAGCTGAGGGCAGAGG - Intergenic
1164059055 19:21649727-21649749 GGGCACTGAGCTGATGACAGTGG + Intergenic
1164067607 19:21733808-21733830 GGGCACTGAGCTGATGACAGTGG - Intronic
1164624413 19:29716634-29716656 GGAAAGTGAACTGAGGCCAGGGG + Intergenic
1165002030 19:32772130-32772152 GGGCAGTGATCTGAGGACTCAGG + Intronic
1165218461 19:34294900-34294922 GGCAAATCACCTGAGGTCAGGGG - Intronic
1165450393 19:35878981-35879003 GGGAAGAGACCAGAGGTCAGCGG + Intronic
1165655422 19:37528374-37528396 GGGCTGGAAACTGAGGTCAGTGG - Intronic
1165679388 19:37760970-37760992 GGTAGATGACCTGAGGTCAGGGG + Intronic
1165820647 19:38673166-38673188 GGGGGATCACCTGAGGTCAGGGG - Intronic
1165941125 19:39415268-39415290 GGGCAGACACCAGAGGGCAGTGG + Intronic
1166426369 19:42682330-42682352 GGGCTCTGTCCTGAGCTCAGTGG - Intronic
1166498327 19:43322128-43322150 GGGCTCTGTCCTGAGCTCAGTGG + Intergenic
1167005260 19:46772068-46772090 GGTAGGTCACCTGAGGTCAGGGG - Intronic
1167273734 19:48522188-48522210 GGCCAATCACCTGAGGTCAGGGG - Intergenic
1167288379 19:48611691-48611713 GGGGGATCACCTGAGGTCAGGGG - Intronic
1167320083 19:48792164-48792186 GGCTCGTCACCTGAGGTCAGGGG - Intergenic
1167447794 19:49548737-49548759 GATCAGTGAGCTGAGATCAGTGG - Intergenic
1167602190 19:50460786-50460808 GGGGAATCACCTGAGCTCAGAGG - Intronic
1167784665 19:51627419-51627441 GGGCAGGGGCCTGAGGGGAGGGG - Intronic
1167793274 19:51693438-51693460 GGCCAGTGGTCTGGGGTCAGAGG - Intergenic
1167889951 19:52531246-52531268 GGCGAATCACCTGAGGTCAGGGG + Intronic
1168238211 19:55076470-55076492 GGGCTGGGACCTGGGGTCCGGGG - Intronic
1168398398 19:56067818-56067840 GGCAGGTCACCTGAGGTCAGGGG + Intergenic
924998740 2:386898-386920 GGGCAGAGAGCAGAGGGCAGAGG - Intergenic
925350917 2:3200272-3200294 GGGCAGGGACCTGGGCACAGGGG - Intronic
925604678 2:5647038-5647060 GGGCAGTAACTTGAAGTCAATGG + Intergenic
925981219 2:9178959-9178981 AGGCAGGAACCTGAGGCCAGGGG - Intergenic
926147267 2:10404384-10404406 GGGCTGATACCTGAGCTCAGCGG - Intronic
926986522 2:18630705-18630727 GGGCAGAGACCATAGGACAGAGG - Intergenic
927593887 2:24380255-24380277 GGTCGGCCACCTGAGGTCAGGGG + Intergenic
928230836 2:29497508-29497530 AGAGAGTGAGCTGAGGTCAGTGG - Intronic
928720824 2:34118798-34118820 GGGCAGATTACTGAGGTCAGAGG - Intergenic
929630163 2:43451879-43451901 GGTCAATCACCTGAGGTCAGGGG + Intronic
929771562 2:44896617-44896639 AGGCAGAGAGCTGAGGGCAGGGG + Intergenic
929892715 2:45931940-45931962 GGTGGGTCACCTGAGGTCAGAGG - Intronic
930032905 2:47069286-47069308 GGGCAGGGACCAGCGGCCAGGGG - Intronic
930479470 2:51927727-51927749 GGGTGGTCACTTGAGGTCAGAGG - Intergenic
932405323 2:71509079-71509101 GGTGAATCACCTGAGGTCAGGGG - Intronic
932794305 2:74681389-74681411 GTGCAGTAACCTCAGGGCAGTGG - Exonic
933698359 2:85236943-85236965 CGACAGTGACCTGGGGTCTGAGG - Intronic
933900173 2:86844123-86844145 GGGCAGTGACATTAGGTCCTGGG - Intronic
934574197 2:95390184-95390206 GGGAAGTGACCTCAGGGCACAGG + Intergenic
935407586 2:102725161-102725183 AGGCACTGACTTGAAGTCAGTGG + Intronic
935780383 2:106505100-106505122 GGGCAGTGACATTAGGTCCTGGG + Intergenic
937318355 2:120946344-120946366 GGGCAGTGTACTGAGCTGAGCGG + Intronic
938583184 2:132666511-132666533 GGGCTGTGACCTGTGGCCAGAGG + Intronic
938793228 2:134695301-134695323 GGTGAATCACCTGAGGTCAGGGG - Intronic
939413433 2:141861702-141861724 GGTGGATGACCTGAGGTCAGGGG + Intronic
940038139 2:149330847-149330869 GGGCAGTCCCCTGGGGCCAGAGG + Intronic
940365736 2:152846650-152846672 GAGAAGGGACCTGAGGTCAAGGG + Intergenic
940510068 2:154602453-154602475 GGTGAATAACCTGAGGTCAGGGG - Intergenic
941046698 2:160683971-160683993 GGGAAGAGCCCTGAGCTCAGTGG - Intergenic
941237455 2:162993032-162993054 GTGAAGTGCCCTGAGGTCACTGG + Intergenic
941934342 2:170971571-170971593 GGTGAATCACCTGAGGTCAGGGG - Intergenic
942837229 2:180315058-180315080 GGCAGGTGACCTGAGATCAGGGG - Intergenic
943557325 2:189421627-189421649 GGGCACTGGCCTGGAGTCAGGGG - Intergenic
944206721 2:197164633-197164655 GGCCAGCGACCTGAGGTCCGGGG - Intronic
945084629 2:206118724-206118746 GGTGAATCACCTGAGGTCAGGGG + Intronic
946311474 2:218884445-218884467 GGCCAGTGTCCTGAGGCCAAGGG - Intronic
946336476 2:219040640-219040662 GTACAGTCCCCTGAGGTCAGAGG - Intronic
946362665 2:219228725-219228747 GGGTACAGACCTGAGGCCAGGGG + Intronic
946681331 2:222220130-222220152 CGGGACTGACCTGAGGTGAGAGG + Exonic
947587147 2:231363372-231363394 GGGCAGAGGTCTGGGGTCAGTGG + Intronic
947834616 2:233166450-233166472 GGGCAGAGAGCAGAGGTCAGGGG + Intronic
948371767 2:237494186-237494208 GGGCAGAGAGCAGAGGACAGAGG + Intronic
948711186 2:239826770-239826792 AGGCAGTGACCTGGGGTCCGGGG + Intergenic
948868242 2:240785973-240785995 GGCCAGTGTGCTGGGGTCAGGGG - Intronic
948868908 2:240788620-240788642 GGACACTGTCCTGAGGACAGTGG + Intronic
948899157 2:240947419-240947441 GTGCAGGGACCTCGGGTCAGTGG - Intronic
1169631905 20:7642417-7642439 GGTAAATCACCTGAGGTCAGGGG - Intergenic
1170538331 20:17363696-17363718 GGCCAGCGAGCTAAGGTCAGAGG + Intronic
1171381681 20:24738333-24738355 GGACAGAGACCTTAGGTCTGGGG + Intergenic
1171406380 20:24914862-24914884 GGGCAGGGAGCTGAGGCCTGAGG - Intergenic
1171406393 20:24914903-24914925 GGGCAGGGAGCTGAGGCCTGAGG - Intergenic
1171406402 20:24914933-24914955 AGGCCGAGACCTGAGGACAGGGG - Intergenic
1172112005 20:32552459-32552481 GGCGGATGACCTGAGGTCAGGGG + Intronic
1172252905 20:33492242-33492264 GGTGAATTACCTGAGGTCAGGGG - Intronic
1172362632 20:34324740-34324762 GTGAAGTGAGCTGAGGGCAGAGG + Intergenic
1172428735 20:34873424-34873446 GGGAAGGGATCTGAGGTCAGAGG - Intronic
1172569825 20:35961154-35961176 GGTGGGTCACCTGAGGTCAGAGG - Intronic
1172583507 20:36066058-36066080 GGGAAGAGATCTGAGGTCTGCGG - Intergenic
1173653109 20:44680068-44680090 TGGCAGTTACCTGGGGCCAGAGG - Intergenic
1173916305 20:46710730-46710752 GGGCAGGGCACTGAGGTCAAAGG + Intronic
1173980012 20:47216580-47216602 GTGAAATCACCTGAGGTCAGGGG + Intronic
1174202337 20:48815779-48815801 GGCAAATCACCTGAGGTCAGGGG + Intronic
1174241532 20:49139497-49139519 GGTGGGTCACCTGAGGTCAGAGG + Intronic
1174403173 20:50286902-50286924 GGGCAGTGACCAGGGCTCAGCGG + Intergenic
1174529330 20:51198674-51198696 AGGCAGTTAGCTGAGGACAGAGG - Intergenic
1174587574 20:51620920-51620942 GGAGAATCACCTGAGGTCAGGGG + Intronic
1175118977 20:56703727-56703749 GGGCAGTGAGGTGGGGCCAGTGG - Intergenic
1175426740 20:58872128-58872150 GGGCAGTGGTCAGAGCTCAGAGG - Intronic
1175697699 20:61114895-61114917 GGGCAGTGGGCAGAGGGCAGGGG + Intergenic
1175865417 20:62173482-62173504 GGCGGATGACCTGAGGTCAGGGG + Intronic
1176037525 20:63047121-63047143 TGCCAGTGGCCTGGGGTCAGAGG + Intergenic
1176197035 20:63842115-63842137 GGCAGGTCACCTGAGGTCAGAGG - Intergenic
1176220897 20:63969035-63969057 GGCCAGAGAGCTGAGGTCAGAGG + Intronic
1176416722 21:6479873-6479895 GGTGGGTCACCTGAGGTCAGGGG + Intergenic
1176444265 21:6805308-6805330 GGCAGGTCACCTGAGGTCAGAGG + Intergenic
1176822430 21:13670346-13670368 GGCAGGTCACCTGAGGTCAGAGG + Intergenic
1177156784 21:17508749-17508771 GGCAAATCACCTGAGGTCAGGGG + Intergenic
1178163428 21:29945092-29945114 GAGCAGTGAGCTGTAGTCAGTGG - Intergenic
1179493778 21:41758822-41758844 GGGAAGTGACCTTAGACCAGAGG - Intronic
1179580353 21:42339487-42339509 GGGCAGTTAACTGGAGTCAGGGG - Intergenic
1179619861 21:42606796-42606818 GGTGAATCACCTGAGGTCAGGGG + Intergenic
1179769020 21:43599268-43599290 TGGCAGTGACGTGAGGTCTCAGG - Intronic
1179791197 21:43757030-43757052 GGGCACAGAACTGAGGTCAGGGG - Exonic
1180747620 22:18101791-18101813 GGTCATTAACCTGAGGTCTGGGG + Exonic
1180760204 22:18196585-18196607 GTGCAGAGAACTGAGGGCAGAGG - Intergenic
1180770518 22:18380883-18380905 GTGCAGAGAACTGAGGGCAGAGG - Intergenic
1180775464 22:18428111-18428133 GTGCAGAGAACTGAGGGCAGAGG + Intergenic
1180808534 22:18739166-18739188 GTGCAGAGAACTGAGGGCAGAGG + Intergenic
1180828460 22:18883841-18883863 GTGCAGAGAACTGAGGGCAGAGG - Intergenic
1180989259 22:19924508-19924530 GGGCAGTGAGCTGAGGAGAAGGG - Intronic
1181071461 22:20344130-20344152 GTGCAGAGAACTGAGGGCAGAGG + Intergenic
1181194532 22:21173080-21173102 GTGCAGAGAACTGAGGGCAGAGG + Intergenic
1181214910 22:21319698-21319720 GTGCAGAGAACTGAGGGCAGAGG - Intergenic
1182183041 22:28371641-28371663 TTGCAGTGAGCTGAGATCAGTGG - Intronic
1182216951 22:28726877-28726899 GGGCAGTGAAAGGAGGCCAGTGG - Intronic
1182335982 22:29583652-29583674 GGGGAATCACCTGAGGTCAGGGG + Intergenic
1182437535 22:30340418-30340440 GGGCAGCCACCTGAGTTAAGAGG + Intronic
1182619798 22:31612879-31612901 AGGCAGCGGCCTGAGGTCCGGGG - Intronic
1183436244 22:37797113-37797135 GGGCAGAGAGCTGAAGGCAGGGG + Intergenic
1183470558 22:38003800-38003822 GGTGAATCACCTGAGGTCAGGGG - Intronic
1183504255 22:38200353-38200375 GGTGGGTGGCCTGAGGTCAGGGG + Intronic
1183530458 22:38350740-38350762 GGGCAGGGATCTGGGGACAGGGG - Intronic
1183967841 22:41453631-41453653 GGGGGATCACCTGAGGTCAGGGG + Intergenic
1184128300 22:42502535-42502557 CGGCAGTTGCCTGAGGTCAGAGG - Intergenic
1184137090 22:42555848-42555870 CGGCAGTTGCCTGAGGTCAGAGG - Intronic
1184502148 22:44880658-44880680 GGGCAGTTAGCTGTGGCCAGAGG - Intergenic
1184552749 22:45213281-45213303 GGGCAGAGGGCTGAGGGCAGAGG - Intronic
1184639093 22:45859551-45859573 GGGCCATGTCCTGAGGGCAGCGG - Intergenic
1184787769 22:46680128-46680150 AGGCAGTGCCTTGGGGTCAGGGG + Intergenic
1185099192 22:48828513-48828535 GGACAGAATCCTGAGGTCAGGGG + Intronic
1185127801 22:49021525-49021547 GGACTGTGCCCTGCGGTCAGCGG + Intergenic
1185397994 22:50602171-50602193 TGGGAGTGATCTGAGGACAGAGG - Intronic
1203232353 22_KI270731v1_random:122055-122077 GTGCAGAGAACTGAGGGCAGAGG - Intergenic
1203278557 22_KI270734v1_random:109830-109852 GTGCAGAGAACTGAGGGCAGAGG - Intergenic
949465985 3:4344275-4344297 GGGCACTGACCTGATGCCAATGG - Intronic
949504143 3:4710984-4711006 GGTGAATCACCTGAGGTCAGGGG + Intronic
949834623 3:8254519-8254541 GTGCAGCGAACTGAAGTCAGAGG - Intergenic
950390997 3:12696874-12696896 GGCAAATCACCTGAGGTCAGGGG - Intergenic
950462821 3:13135450-13135472 GGGCAAAGGCCTGGGGTCAGGGG + Intergenic
950626637 3:14252334-14252356 GGGCAGTGTGCTGTGGCCAGAGG + Intergenic
951223873 3:20098002-20098024 GGCCCATTACCTGAGGTCAGGGG + Intronic
951432794 3:22627906-22627928 GGGCACAGACCTGATGCCAGTGG + Intergenic
951764733 3:26185171-26185193 GGTCAGTAACCAGAGGACAGGGG - Intergenic
951945083 3:28126669-28126691 GGCGAATCACCTGAGGTCAGGGG - Intergenic
951957699 3:28275513-28275535 GGGCACCGACCTGATGCCAGTGG + Intronic
952277654 3:31892812-31892834 GGGCAGCAACCTCAGGCCAGTGG - Intronic
952330391 3:32359362-32359384 GGGTAGACACCAGAGGTCAGGGG + Intronic
952572371 3:34732264-34732286 GGGAACTGACCTGATGCCAGAGG - Intergenic
954034752 3:47845410-47845432 GGCAAATCACCTGAGGTCAGGGG - Intronic
954057649 3:48040924-48040946 TTGCAGATACCTGAGGTCAGGGG - Intronic
954078132 3:48196132-48196154 GGGCAGTGAACGGAGGCCACTGG + Intergenic
954117417 3:48474868-48474890 GGGAAGTGACCTGAGGCCTGAGG - Intronic
954149663 3:48651089-48651111 GGCCAGGGGCCTGAAGTCAGAGG + Intronic
954429541 3:50462997-50463019 GGCCACTGTCCTGAGGCCAGAGG - Intronic
954456026 3:50600325-50600347 AGCCAGTGACCTGGGGTAAGTGG - Intergenic
954590588 3:51778447-51778469 GGTTGGTGACCTGAGGACAGGGG + Intergenic
954642003 3:52106309-52106331 AGGCAGGGGCCTGAGGTCAAGGG - Intronic
954712563 3:52512351-52512373 GGGCAGTGGGGGGAGGTCAGCGG + Exonic
954743829 3:52775344-52775366 GTTCAGTGAGCTGATGTCAGGGG - Intergenic
954792390 3:53143018-53143040 GGGAAGAGAGCTGAGGACAGAGG - Intergenic
956756953 3:72398106-72398128 GGCAAATCACCTGAGGTCAGGGG + Intronic
958641414 3:96812915-96812937 GCACAGTGACAAGAGGTCAGGGG - Intergenic
959016426 3:101139242-101139264 GTGCAGTAACCTGGGATCAGTGG - Intergenic
959620851 3:108397327-108397349 GGGCAGAGACATGGGGGCAGGGG - Intronic
961049969 3:123737711-123737733 GGGCCCTGACTTGAGGTCTGTGG + Intronic
961734393 3:128992334-128992356 GGAGGATGACCTGAGGTCAGGGG + Intronic
961785019 3:129342440-129342462 GGCAAATCACCTGAGGTCAGAGG - Intergenic
962292028 3:134145394-134145416 GGGCACTGGCCCCAGGTCAGGGG + Intronic
962843830 3:139258431-139258453 GGGCAGGGACATGTGGGCAGAGG + Intronic
963683703 3:148411618-148411640 GGTGAATCACCTGAGGTCAGGGG - Intergenic
963842482 3:150121780-150121802 GGTGAATCACCTGAGGTCAGGGG + Intergenic
964871486 3:161318154-161318176 GGGAAGAGCCCTGAGGTCTGAGG + Intergenic
965342929 3:167512202-167512224 GTGCACTGACCTGATGCCAGTGG - Intronic
966071557 3:175885142-175885164 GGGCACTGACCTGATGCCAGCGG + Intergenic
966589810 3:181669672-181669694 GGTGAATCACCTGAGGTCAGGGG + Intergenic
967669164 3:192211650-192211672 GGTGGGTCACCTGAGGTCAGGGG - Intronic
968486610 4:866003-866025 GTGTAGGGACCAGAGGTCAGAGG - Intronic
968518987 4:1027301-1027323 GGACGGAGCCCTGAGGTCAGAGG - Intergenic
968568687 4:1328204-1328226 GTGCAGTGAGCTGAGGCCAGCGG + Intronic
968746676 4:2364097-2364119 GAGCTGTGACCTGAGGCCTGGGG - Intronic
968793208 4:2683517-2683539 AGGCGATCACCTGAGGTCAGGGG - Intronic
969116712 4:4874717-4874739 GGGCAGTGGCCTGAGGGAAGAGG + Intergenic
971731940 4:30395455-30395477 GGCGGGTCACCTGAGGTCAGGGG + Intergenic
971749569 4:30630005-30630027 GGGAAATAACCTGAGGTCAGGGG + Intergenic
972334199 4:38092503-38092525 GGGAGATCACCTGAGGTCAGGGG + Intronic
974003633 4:56534699-56534721 GGTGAATTACCTGAGGTCAGGGG + Intronic
974130442 4:57748119-57748141 GGACACTGACCTGATGCCAGTGG + Intergenic
975964532 4:79954781-79954803 GGGCAGAGGCCAGAGGTCAGAGG + Intronic
975991646 4:80264915-80264937 AGGCAATGCCCTGAGGTCTGTGG - Intergenic
976602264 4:86949338-86949360 GGGGGATCACCTGAGGTCAGGGG - Intronic
977732582 4:100371817-100371839 GGACACTGATCTGATGTCAGGGG + Intergenic
978161204 4:105550744-105550766 AGGCAGTGAACTGAGGTCACTGG - Intergenic
978516083 4:109569726-109569748 GGCCAATCACCTGAGGTCAGGGG - Intronic
978556281 4:109984146-109984168 GGGCAGTGACCTAAAGTGAAAGG - Intronic
979732744 4:124044938-124044960 GGGCACTGACCTGATGCCCGTGG + Intergenic
981546621 4:145900633-145900655 GGTGGGTCACCTGAGGTCAGGGG - Intronic
982205782 4:152996293-152996315 GGCCATGGATCTGAGGTCAGGGG - Intergenic
982508087 4:156245269-156245291 GGTGAATCACCTGAGGTCAGGGG - Intergenic
983445425 4:167844731-167844753 GGTGAATCACCTGAGGTCAGAGG - Intergenic
984854061 4:184177610-184177632 AGGCACTGACCTGACGCCAGTGG - Intronic
984991627 4:185386831-185386853 GGCCACTGAGCTGAGGACAGAGG + Intronic
985255288 4:188063867-188063889 GGCGGATGACCTGAGGTCAGGGG + Intergenic
985499873 5:236248-236270 GGGTGATCACCTGAGGTCAGGGG - Intronic
986092007 5:4518763-4518785 TGGCAGTGACATTAGTTCAGAGG - Intergenic
986142215 5:5041434-5041456 GGGCCGTGCCCTGGAGTCAGGGG + Intergenic
986249364 5:6042710-6042732 GTGCAGTGACCTCTGGTCACTGG - Intergenic
986340642 5:6786368-6786390 GGGCAGAGAGATGTGGTCAGAGG - Intergenic
987341800 5:16946104-16946126 GGTGAATAACCTGAGGTCAGAGG + Intergenic
989069003 5:37490716-37490738 TGGCAGTGACCTGAGGCAGGTGG + Intronic
989147639 5:38264541-38264563 GGGCAGTGGCCAGGGATCAGGGG + Intronic
989323656 5:40165430-40165452 GGGCATTGAGCTGAGATCTGTGG + Intergenic
990236242 5:53771420-53771442 GGGTACTGACCTGAAGTCTGGGG - Intergenic
991144808 5:63288275-63288297 TGTCAGTGAGCTGAGGTCACAGG + Intergenic
992238933 5:74745110-74745132 GGGCGATCACCTGAGGTCAGGGG + Intronic
992436898 5:76763157-76763179 AGGCAGAGAACTGAGGGCAGTGG - Intergenic
993979628 5:94530043-94530065 GGTGAATCACCTGAGGTCAGGGG + Intronic
994350762 5:98743053-98743075 GGTCACTGACCTGATGCCAGCGG - Intergenic
994446507 5:99880359-99880381 GGGCTCTCACCTCAGGTCAGAGG + Intergenic
994892916 5:105661301-105661323 GGAGAGTTACCTGAGGTCAGGGG + Intergenic
995052296 5:107719982-107720004 GGGCACTGGCCTGATGCCAGTGG - Intergenic
995852677 5:116562606-116562628 CGTCAGCCACCTGAGGTCAGAGG - Intronic
996029304 5:118687168-118687190 TTGCAGTGACCTGAGAGCAGAGG + Intergenic
996414710 5:123197852-123197874 GAGCTTTGCCCTGAGGTCAGTGG - Intergenic
997269388 5:132524007-132524029 GGCTAATCACCTGAGGTCAGGGG + Intergenic
997419463 5:133754747-133754769 GGGCAGTATCCTGAGCCCAGTGG + Intergenic
997823904 5:137089475-137089497 AGCCAGTGACCTGAGGGCAGTGG + Intronic
999250645 5:150180337-150180359 GGGCAGCGGACTGAGGTCAGTGG + Intronic
999323459 5:150628681-150628703 GGGGGATCACCTGAGGTCAGGGG + Intronic
999386236 5:151156373-151156395 GGGCACTGGCCTGGGGTCAGAGG - Intronic
1001075933 5:168628104-168628126 GGGCAGGGAGCTGAGGTTGGTGG + Intergenic
1001332450 5:170771999-170772021 GAGCAGTGGCCTTAGGTCAGGGG - Intronic
1001485874 5:172119272-172119294 GGAAAGTGACTCGAGGTCAGAGG + Intronic
1001617433 5:173054417-173054439 GGGCAGTTCCTTGGGGTCAGGGG - Intergenic
1001870279 5:175148411-175148433 GGTGGGTCACCTGAGGTCAGGGG - Intergenic
1001877656 5:175215285-175215307 GGTGAATCACCTGAGGTCAGGGG + Intergenic
1002594432 5:180313000-180313022 GGGGGATCACCTGAGGTCAGGGG - Intronic
1002640351 5:180627842-180627864 GGGCAGAGTCCTGAGGGCACTGG - Intronic
1003509886 6:6771001-6771023 GGGGGGTCACCTGAGGTCAGGGG + Intergenic
1004260405 6:14102794-14102816 GCTCAGTAACCTGAGGTCATGGG + Intergenic
1005041491 6:21604395-21604417 GGGCAGAGACTGAAGGTCAGGGG - Intergenic
1006175666 6:32119962-32119984 GGCAAGTGAGCAGAGGTCAGAGG + Intronic
1006303197 6:33204836-33204858 GGGCAGGGATCAGAGGTCACAGG - Intronic
1006377605 6:33680232-33680254 GGGCAGGAACCGGAGGCCAGGGG + Intronic
1006452768 6:34114652-34114674 GGGCAGTGTCCTCAGGGTAGAGG - Intronic
1006594030 6:35179557-35179579 AGGCAGACTCCTGAGGTCAGGGG + Intergenic
1006915063 6:37588568-37588590 GGGCAGTGAGCTGAGGGCTGGGG - Intergenic
1007391971 6:41554632-41554654 GGTGAATCACCTGAGGTCAGTGG + Intronic
1007395839 6:41577338-41577360 GGGAAGAGCCCTGGGGTCAGTGG - Intronic
1007976478 6:46106524-46106546 GAGCTTTGCCCTGAGGTCAGTGG + Intergenic
1010202731 6:73297124-73297146 GGCCTATCACCTGAGGTCAGGGG - Intronic
1011626947 6:89290651-89290673 GGGCAAGGACCTGTTGTCAGTGG - Intronic
1012926141 6:105269885-105269907 GGTGAATCACCTGAGGTCAGAGG + Intergenic
1013111452 6:107068421-107068443 GGGCAGGGACCAGAGGTTAGGGG - Exonic
1013141125 6:107336027-107336049 GGGGCATCACCTGAGGTCAGGGG + Intronic
1013511481 6:110848294-110848316 GGCGAGTCACTTGAGGTCAGGGG + Intronic
1014176601 6:118337971-118337993 GGGCGATCACCTGAGGTCAGGGG - Intergenic
1014977080 6:127900879-127900901 GGGTAGGGTCCTGAGGTCAAGGG + Exonic
1015303028 6:131675772-131675794 TTGCAGTGAGCTGAGATCAGGGG + Intronic
1015471382 6:133610623-133610645 GGACAGTTCCCTGATGTCAGGGG + Intergenic
1016675900 6:146767698-146767720 GGTGGGTCACCTGAGGTCAGGGG - Intronic
1016837335 6:148491493-148491515 GGTGAATCACCTGAGGTCAGAGG - Intronic
1017154014 6:151307076-151307098 GAGCAGTCACTTGAGGTGAGAGG + Intronic
1017757596 6:157542763-157542785 GGGAAGTGACCAGAGGCCATGGG - Intronic
1018475446 6:164135648-164135670 AGGCAGTGAGCTGTGGGCAGAGG - Intergenic
1018702505 6:166437990-166438012 GGGCAGTGGCATGAGCTCACAGG + Intronic
1019003673 6:168778128-168778150 GTGCAGAGTCCTGAGGCCAGAGG + Intergenic
1019571718 7:1715931-1715953 GGTCAGAGACCAGGGGTCAGAGG - Intronic
1020085612 7:5308738-5308760 TGGCAGGGACAGGAGGTCAGAGG + Intronic
1020178967 7:5906546-5906568 GGGGAATCACCTGAGGTCAGGGG - Intronic
1021030921 7:15734865-15734887 GGTGAATCACCTGAGGTCAGGGG + Intergenic
1021448906 7:20762827-20762849 GGGTGATCACCTGAGGTCAGGGG - Intronic
1021846390 7:24767096-24767118 GGGTGATCACCTGAGGTCAGGGG + Intergenic
1022237220 7:28473719-28473741 GGGCAGGGATCTGAGGTCAGTGG + Intronic
1022361667 7:29665728-29665750 GGTCAGGGAGCTGAGGTCACAGG + Intergenic
1023817493 7:43961874-43961896 GAGCAGAAACCTGAGGTCTGGGG - Intergenic
1024973311 7:55090397-55090419 GGGAAGGGGCCCGAGGTCAGGGG - Intronic
1025104810 7:56162229-56162251 GGGAAGTCAGCAGAGGTCAGAGG + Intergenic
1025230517 7:57201011-57201033 GGCCTGTGAACTGAGGTCAAGGG - Intergenic
1025663254 7:63568458-63568480 TGGCAGGGACAGGAGGTCAGAGG + Intergenic
1025752150 7:64303016-64303038 GGGGGATCACCTGAGGTCAGGGG + Intergenic
1025846064 7:65198992-65199014 GGTGGATGACCTGAGGTCAGGGG - Intergenic
1025928814 7:65979585-65979607 GGCCTGTGAGCTGAGGTCAGGGG - Intronic
1026165528 7:67905825-67905847 GGCGGGTCACCTGAGGTCAGGGG + Intergenic
1026327570 7:69323926-69323948 GGGAGATCACCTGAGGTCAGTGG + Intergenic
1026511154 7:71028274-71028296 GATAGGTGACCTGAGGTCAGGGG - Intergenic
1026735358 7:72945539-72945561 GGCCAGTGAGCAGAGGGCAGAGG - Intronic
1026969412 7:74458882-74458904 GGCCAATCACTTGAGGTCAGGGG - Intronic
1028793137 7:94875988-94876010 GGGGAATCACTTGAGGTCAGGGG + Intergenic
1029361792 7:100093441-100093463 GGGCAGTGGAACGAGGTCAGGGG + Intronic
1029742118 7:102496748-102496770 GAGCAGAAACCTGAGGTCTGGGG - Intronic
1029760107 7:102595913-102595935 GAGCAGAAACCTGAGGTCTGGGG - Intronic
1032173849 7:129608099-129608121 GGTGGGTCACCTGAGGTCAGGGG + Intergenic
1033341175 7:140493395-140493417 GGCGAATCACCTGAGGTCAGGGG + Intergenic
1033791580 7:144797223-144797245 GGGCACCGACCTGATGCCAGTGG - Intronic
1034875861 7:154724373-154724395 GGGAAGTGACCTGAGGTCTGGGG - Intronic
1035193919 7:157198758-157198780 GGGTAACCACCTGAGGTCAGGGG - Intronic
1035228291 7:157445517-157445539 GGGAAGGGACCTGGGGGCAGTGG + Intergenic
1036004330 8:4644632-4644654 AGGCCATCACCTGAGGTCAGAGG - Intronic
1036729644 8:11250921-11250943 GTGGAGTGAGCAGAGGTCAGTGG - Intergenic
1038095467 8:24304638-24304660 GGTGGGTCACCTGAGGTCAGGGG + Intronic
1038251261 8:25907191-25907213 GGTGAATCACCTGAGGTCAGGGG + Intronic
1038280708 8:26161615-26161637 GGGCAGTGACCACAAGTCACAGG + Intergenic
1039373640 8:37011913-37011935 GGGAAGAGAGCTGAGGTCGGAGG - Intergenic
1039592852 8:38764739-38764761 GGCAGGTCACCTGAGGTCAGGGG + Intronic
1039722793 8:40182480-40182502 GGCCAATCACTTGAGGTCAGGGG - Intergenic
1039817692 8:41109100-41109122 GGTCAATTACCTGAGGTCTGGGG + Intergenic
1040025657 8:42779489-42779511 GGTGAATCACCTGAGGTCAGGGG + Intronic
1042193805 8:66214545-66214567 GGGGAGTGAGCTAAGGTCAGGGG - Intergenic
1042857944 8:73286085-73286107 CAGCAGTGACCTGAAGGCAGAGG - Intergenic
1043807157 8:84685903-84685925 GGACAGTGAGCTGAAATCAGAGG + Intronic
1046317926 8:112531212-112531234 GAGCAGTGGCCTGAAATCAGGGG - Intronic
1046580139 8:116082277-116082299 GGTGAATCACCTGAGGTCAGGGG + Intergenic
1046789718 8:118307946-118307968 GGGCTGTGACCTTTGGTCAAGGG - Intronic
1048148430 8:131868483-131868505 GGACAAGGTCCTGAGGTCAGGGG - Intergenic
1048216413 8:132499628-132499650 GGGCTGTTACCTGAAGGCAGTGG - Intergenic
1048801252 8:138196022-138196044 GTTCAGGGACCTGAGGTCAGCGG - Intronic
1049007614 8:139865637-139865659 AGGCAGGGACCTAAGGTCAGAGG + Intronic
1049148742 8:141020744-141020766 GGTCGATCACCTGAGGTCAGGGG + Intergenic
1049604132 8:143521236-143521258 GGGCACTGGCCCGAGGTCACAGG + Intronic
1049725128 8:144142281-144142303 GGCCAGTGACCTCAGGGCCGAGG + Intergenic
1050258921 9:3820800-3820822 GGGCTGTGACCTAGGGCCAGTGG + Intergenic
1051586996 9:18737091-18737113 GGTGGGTCACCTGAGGTCAGAGG + Intronic
1051807588 9:21012839-21012861 GGCAGATGACCTGAGGTCAGGGG + Intronic
1052916733 9:33928919-33928941 GGGTAGTGACCTGTGGGCATGGG - Intronic
1052966968 9:34347573-34347595 GGCGGGTCACCTGAGGTCAGGGG - Intergenic
1053461554 9:38275280-38275302 GGGCAGTGGGCTGAGTTCACAGG + Intergenic
1054834368 9:69660938-69660960 GGTCAGTAAACTGAGGTCCGTGG + Intronic
1057053114 9:91940825-91940847 GGTGAATCACCTGAGGTCAGGGG - Intronic
1057147966 9:92771035-92771057 GGTGAATCACCTGAGGTCAGGGG + Intergenic
1057217588 9:93238002-93238024 GGGCAGTGAGCTGGGGCCATGGG + Intronic
1057241591 9:93416560-93416582 GGGCAGTGACCTTATGCCAGTGG + Intergenic
1057780026 9:98041907-98041929 GGGCAGATCACTGAGGTCAGGGG - Intergenic
1058110544 9:101027857-101027879 GCACAGTAACCTGAGGCCAGGGG - Intergenic
1059076008 9:111194666-111194688 GGTGAATTACCTGAGGTCAGGGG + Intergenic
1059693696 9:116710504-116710526 GGGGAATCACCTGAGGTCGGGGG + Intronic
1060005766 9:119998148-119998170 GGGCACAGATCTGAAGTCAGAGG - Intergenic
1060517554 9:124275564-124275586 AAGCAGTGTGCTGAGGTCAGAGG - Intronic
1061235421 9:129339461-129339483 GGCCAGTGCCCTGAGGACACTGG + Intergenic
1061302369 9:129712871-129712893 AGGCAGGGACCTGACGCCAGTGG + Intronic
1061377563 9:130235285-130235307 GGGCTCTGACCTGGGGTCTGGGG + Exonic
1061519661 9:131110726-131110748 GGCCGATCACCTGAGGTCAGGGG - Intronic
1061538657 9:131265610-131265632 GGGCAGTCACCTGAGGTCAGGGG - Intronic
1062533158 9:137010509-137010531 GGGCAGGGCCCTGAGCTCTGGGG - Intronic
1062645194 9:137544202-137544224 GGGCAGTGGCCCCAGGTCAGAGG - Intronic
1203524934 Un_GL000213v1:79219-79241 GGCAGGTCACCTGAGGTCAGAGG - Intergenic
1186030074 X:5358623-5358645 GGCCGATCACCTGAGGTCAGGGG + Intergenic
1186313060 X:8340902-8340924 GGCAAATCACCTGAGGTCAGGGG - Intergenic
1186349576 X:8729046-8729068 GGGCAGTGACCTGCTGTCGTCGG - Intronic
1186382392 X:9074540-9074562 GGGTTGTAATCTGAGGTCAGAGG - Intronic
1186868241 X:13742748-13742770 AGGCGATCACCTGAGGTCAGGGG - Intronic
1187247097 X:17562514-17562536 GTGCAGTGAACTGAGGTGAGAGG + Intronic
1187380957 X:18801755-18801777 GGTCGATCACCTGAGGTCAGGGG + Intronic
1187722407 X:22165153-22165175 GAGCAGTGTCCAGAGGTCACTGG + Intronic
1188416595 X:29942844-29942866 GGGGGATCACCTGAGGTCAGGGG - Intronic
1189396931 X:40631529-40631551 GGCGAATCACCTGAGGTCAGGGG - Intronic
1189996845 X:46647095-46647117 GGGCAGCCACATCAGGTCAGTGG + Intronic
1190735915 X:53256021-53256043 AGGCAGTGACCTGAGCACAGCGG - Exonic
1192421692 X:71037982-71038004 GGGGGATCACCTGAGGTCAGGGG + Intergenic
1192534989 X:71919661-71919683 AGGCAGTGAACAGATGTCAGTGG - Intergenic
1194505451 X:94728792-94728814 GGTGAATCACCTGAGGTCAGGGG + Intergenic
1195878263 X:109564730-109564752 GGGCTCTGCCCTGAGCTCAGTGG + Intergenic
1196599967 X:117590198-117590220 AGGCATTGACCTGATGCCAGTGG - Intergenic
1196918710 X:120564378-120564400 GGCCGATCACCTGAGGTCAGGGG + Intronic
1197250751 X:124214220-124214242 GGGCAGTCAGCTGGGGTTAGAGG + Intronic
1197423971 X:126272744-126272766 GGGCAGTGACCTAATGCCAGTGG + Intergenic
1198096505 X:133384946-133384968 TGGCTGTGACCTGAGGCCTGTGG - Intronic
1199442055 X:147879487-147879509 GGGCTCTACCCTGAGGTCAGTGG + Intergenic
1199995958 X:153026935-153026957 GGGAAGTGACGTGAGGGCAGTGG + Intergenic
1200091020 X:153635994-153636016 GGGCAGAGACCTGGTGTCACAGG + Intergenic
1200567071 Y:4780297-4780319 TGGCAGTGAGCAGGGGTCAGAGG - Intergenic
1201366557 Y:13212896-13212918 GGCAGGTCACCTGAGGTCAGGGG + Intergenic
1201950498 Y:19558466-19558488 GGTGGGTCACCTGAGGTCAGGGG + Intergenic