ID: 1113549909

View in Genome Browser
Species Human (GRCh38)
Location 13:111184792-111184814
Sequence GGGGCCGGTAACCCACACAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 61
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 57}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113549909_1113549923 20 Left 1113549909 13:111184792-111184814 CCTGTGTGTGGGTTACCGGCCCC 0: 1
1: 0
2: 1
3: 2
4: 57
Right 1113549923 13:111184835-111184857 TGTGTGTCTGGGAGCAGGTGGGG 0: 1
1: 1
2: 11
3: 95
4: 886
1113549909_1113549915 -4 Left 1113549909 13:111184792-111184814 CCTGTGTGTGGGTTACCGGCCCC 0: 1
1: 0
2: 1
3: 2
4: 57
Right 1113549915 13:111184811-111184833 CCCCGTGGGCTTCACTGTGCGGG 0: 1
1: 0
2: 1
3: 18
4: 142
1113549909_1113549924 28 Left 1113549909 13:111184792-111184814 CCTGTGTGTGGGTTACCGGCCCC 0: 1
1: 0
2: 1
3: 2
4: 57
Right 1113549924 13:111184843-111184865 TGGGAGCAGGTGGGGAGAACCGG 0: 1
1: 0
2: 10
3: 68
4: 708
1113549909_1113549918 8 Left 1113549909 13:111184792-111184814 CCTGTGTGTGGGTTACCGGCCCC 0: 1
1: 0
2: 1
3: 2
4: 57
Right 1113549918 13:111184823-111184845 CACTGTGCGGGTTGTGTGTCTGG 0: 1
1: 0
2: 0
3: 5
4: 95
1113549909_1113549919 9 Left 1113549909 13:111184792-111184814 CCTGTGTGTGGGTTACCGGCCCC 0: 1
1: 0
2: 1
3: 2
4: 57
Right 1113549919 13:111184824-111184846 ACTGTGCGGGTTGTGTGTCTGGG 0: 1
1: 0
2: 0
3: 4
4: 133
1113549909_1113549921 18 Left 1113549909 13:111184792-111184814 CCTGTGTGTGGGTTACCGGCCCC 0: 1
1: 0
2: 1
3: 2
4: 57
Right 1113549921 13:111184833-111184855 GTTGTGTGTCTGGGAGCAGGTGG 0: 1
1: 0
2: 4
3: 44
4: 451
1113549909_1113549913 -5 Left 1113549909 13:111184792-111184814 CCTGTGTGTGGGTTACCGGCCCC 0: 1
1: 0
2: 1
3: 2
4: 57
Right 1113549913 13:111184810-111184832 GCCCCGTGGGCTTCACTGTGCGG 0: 1
1: 0
2: 1
3: 11
4: 125
1113549909_1113549922 19 Left 1113549909 13:111184792-111184814 CCTGTGTGTGGGTTACCGGCCCC 0: 1
1: 0
2: 1
3: 2
4: 57
Right 1113549922 13:111184834-111184856 TTGTGTGTCTGGGAGCAGGTGGG 0: 1
1: 1
2: 5
3: 32
4: 460
1113549909_1113549920 15 Left 1113549909 13:111184792-111184814 CCTGTGTGTGGGTTACCGGCCCC 0: 1
1: 0
2: 1
3: 2
4: 57
Right 1113549920 13:111184830-111184852 CGGGTTGTGTGTCTGGGAGCAGG 0: 1
1: 0
2: 1
3: 17
4: 190

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113549909 Original CRISPR GGGGCCGGTAACCCACACAC AGG (reversed) Intronic