ID: 1113549915

View in Genome Browser
Species Human (GRCh38)
Location 13:111184811-111184833
Sequence CCCCGTGGGCTTCACTGTGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 142}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113549909_1113549915 -4 Left 1113549909 13:111184792-111184814 CCTGTGTGTGGGTTACCGGCCCC 0: 1
1: 0
2: 1
3: 2
4: 57
Right 1113549915 13:111184811-111184833 CCCCGTGGGCTTCACTGTGCGGG 0: 1
1: 0
2: 1
3: 18
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113549915 Original CRISPR CCCCGTGGGCTTCACTGTGC GGG Intronic
900610951 1:3544443-3544465 CTCCGTTGGCTTCCCTGGGCTGG + Intronic
900826509 1:4931372-4931394 CCTCTGGGGCTTCACTGTGAAGG + Intergenic
901020663 1:6253717-6253739 CCTCATGGGCTTCCCTGTGCTGG - Exonic
901218244 1:7566781-7566803 CCCAGTGGGCTTCATCGTGCGGG + Intronic
904825388 1:33270932-33270954 CCTCCTGGGCTCCACTGTGGGGG + Intronic
910708830 1:90157605-90157627 CACCATGGGCTGCACTGTGAGGG - Intergenic
911625494 1:100119478-100119500 CCCTGTGGGCCACATTGTGCAGG + Intronic
920102614 1:203526795-203526817 CCCTGAGGGCTTCGCTGAGCTGG + Intergenic
921133697 1:212241582-212241604 CACCAGGGACTTCACTGTGCCGG + Intergenic
922696900 1:227735422-227735444 CGCCGCGGTCTTCACTGCGCAGG + Exonic
923092572 1:230751273-230751295 CCCCATGGCCTCCACAGTGCTGG + Intronic
923223884 1:231921308-231921330 CCATGTGCTCTTCACTGTGCTGG - Intronic
1067820892 10:49529138-49529160 GCCCTTGGGCTTCACTGGGGAGG + Intronic
1069565472 10:69460747-69460769 CTCTGAGGGCTTCACTGGGCAGG + Intronic
1069942231 10:71963989-71964011 CCCCCTTGGCTTCTCCGTGCCGG - Intergenic
1070221822 10:74455876-74455898 TCCCATGGGCTTCACTTTGTGGG + Intronic
1071661570 10:87507796-87507818 TCTCCTGTGCTTCACTGTGCTGG - Intronic
1072944687 10:99799102-99799124 CCCCGTGGCCTTCTCTGTACAGG - Intronic
1076139444 10:128068023-128068045 CGCCGTGGGCTCCCCTGTGCTGG - Intronic
1082770284 11:57202513-57202535 CCCCTTGGGGTTCACTGTCATGG - Intergenic
1083226866 11:61290826-61290848 CCCCGTGGGCTTCTCGATGACGG - Exonic
1084761442 11:71274317-71274339 CTCAGCGGGCTTCACTGGGCTGG - Intergenic
1089584599 11:119502433-119502455 CCCGTTGGGCTTCCCTGTACTGG + Intergenic
1089926037 11:122258800-122258822 GCACGTGGGCTTAACTGTGAAGG - Intergenic
1092291563 12:7162491-7162513 CCCTGGGGGCTTCACTGGGGTGG + Intergenic
1096217456 12:49805914-49805936 ACCCCTGGGCTCCACTGTGGAGG - Intronic
1096459179 12:51812895-51812917 CACCTTGGGCTTCAGTGTGAGGG - Intergenic
1096619079 12:52851163-52851185 CCCCCTGGGGACCACTGTGCAGG + Intergenic
1104450038 12:128861513-128861535 CCCCTTGGGCTTCCCTGCTCTGG - Intronic
1104628173 12:130377009-130377031 CACAGAGGGCTTCCCTGTGCTGG - Intergenic
1105954568 13:25268662-25268684 CACAGTGGCCTTCACTGTGAAGG - Intronic
1106434986 13:29715271-29715293 CCCCGTGGACTTCCCTATTCTGG + Intergenic
1112452055 13:99521599-99521621 CCCCCAGGGCTTCACAGTGTAGG - Intronic
1112896652 13:104307202-104307224 GCCCCAGGGCTTCACTGTGCAGG - Intergenic
1113549915 13:111184811-111184833 CCCCGTGGGCTTCACTGTGCGGG + Intronic
1113825864 13:113252630-113252652 CCCCTTGCGTTGCACTGTGCAGG - Intronic
1113955463 13:114098081-114098103 CCACTTGGGCCTCTCTGTGCTGG - Intronic
1114635143 14:24183024-24183046 CCCAGGGGGCTTCAGTGTGAGGG + Exonic
1124243615 15:28051967-28051989 CCCCCTCTGCTTCACTGAGCTGG + Intronic
1124252842 15:28118274-28118296 CCCCGTGGGCTTCGGGGAGCTGG - Intronic
1127582052 15:60347522-60347544 CCCCGTGGCCATCCCTGTGAGGG - Exonic
1128361163 15:66962625-66962647 CCCCGTGTGCTTCAATGTCATGG - Intergenic
1128716823 15:69914585-69914607 CCCAGTGGGCCTCACTGAGCCGG - Intergenic
1128944621 15:71812059-71812081 CCCCGTGGGCTGCGCCCTGCCGG - Exonic
1133286648 16:4693858-4693880 CCCCATGCGCTTCTCGGTGCTGG + Exonic
1135113998 16:19710766-19710788 CCCCTTGGCCTACACTGGGCAGG + Intronic
1136233901 16:28903179-28903201 CGCCGTGGGCTCCCCAGTGCTGG - Intronic
1136414849 16:30096596-30096618 TCCCGTTGGCTCCACTGTACCGG + Intronic
1136710781 16:32234774-32234796 CCCCATGTGCCTCCCTGTGCAGG + Intergenic
1136757130 16:32694637-32694659 CCCCATGTGCCTCCCTGTGCAGG - Intergenic
1136810979 16:33175738-33175760 CCCCATGTGCCTCCCTGTGCAGG + Intergenic
1136817455 16:33285818-33285840 CCCCATGTGCCTCCCTGTGCAGG + Intronic
1136824019 16:33342347-33342369 CCCCATGTGCCTCCCTGTGCAGG + Intergenic
1137495148 16:48963746-48963768 CCCCGAGGGCTTACCTGTGGAGG - Intergenic
1138263533 16:55643296-55643318 CCTCCTGGGCTACACTGAGCTGG + Intergenic
1139512519 16:67435671-67435693 CTCCATGGGCTTCACGGTGCTGG + Exonic
1140048168 16:71456444-71456466 CCCTGTGGGATGTACTGTGCAGG - Intronic
1142251586 16:88994298-88994320 CCCCCTGGGCTTCGCTGGCCTGG - Intergenic
1203059279 16_KI270728v1_random:954988-955010 CCCCATGTGCCTCCCTGTGCAGG - Intergenic
1144023988 17:11261398-11261420 CCCAGTGGGCTGCACTGAGCTGG - Intronic
1146467323 17:33096554-33096576 TGCTGTTGGCTTCACTGTGCTGG - Intronic
1146670504 17:34734229-34734251 CCCCGTGGCCTTCCCTGATCAGG - Intergenic
1146676235 17:34775435-34775457 CCCCGGGGGCTCCACTGAGGAGG + Intergenic
1147215611 17:38897391-38897413 CCACGGGGGCTGCACTGTCCTGG - Intronic
1147897004 17:43757612-43757634 TCACCTGGGCTTCTCTGTGCAGG + Intronic
1148331160 17:46814747-46814769 CCCCGTGGGGGTCAGTGGGCTGG - Intronic
1148565076 17:48627756-48627778 CCCCGGGGGAGTCCCTGTGCAGG - Intronic
1149099220 17:52884048-52884070 CCCCGTGGGCTCCTGTGCGCCGG - Intronic
1150326605 17:64263069-64263091 CCCCGCGGGCTTCAAAGTACCGG - Intronic
1152662285 17:81548085-81548107 CCCCCTGGTTTTCACTGTGAAGG - Intronic
1153989628 18:10384982-10385004 GGCCGGGGGCTTCTCTGTGCCGG - Intergenic
1156096617 18:33540554-33540576 TCCTGTGGGCTCCACTCTGCAGG - Intergenic
1157326496 18:46672722-46672744 CCACCTGGGCTCCACTGTCCTGG - Intronic
1160517217 18:79485197-79485219 CCCCGTGGGCTGCACACTGGTGG - Intronic
1161029584 19:2051429-2051451 CCCCGTGCGCCGCACTGCGCAGG - Intergenic
1162462202 19:10819866-10819888 CCCCGGGGGCTTCTCAATGCTGG - Intronic
1166407037 19:42528806-42528828 CCCCATGCTCTTCAGTGTGCTGG + Intronic
1166453273 19:42919124-42919146 CCCCGTGGGGTGCAGCGTGCAGG + Intronic
1166485312 19:43206862-43206884 CCCCCTGGGCTGCAGTGGGCAGG + Intronic
1168722328 19:58560988-58561010 CCACCTAGGCATCACTGTGCAGG + Intergenic
927154736 2:20215059-20215081 CCCTGTGGGCTTCACTGTGATGG - Intronic
930845592 2:55900266-55900288 CCCTCTGGGCTTCACTGTAAAGG + Intronic
931161961 2:59702542-59702564 CCCCAAGGGCTTCAGTGAGCAGG + Intergenic
932003095 2:67902429-67902451 CCTCCTGGGCTTCTCTCTGCAGG + Intergenic
934850362 2:97696037-97696059 CCCAGTGGGAAGCACTGTGCTGG + Intergenic
937303597 2:120857736-120857758 CCCTGTGGGCTACACTGAGGTGG - Intronic
940985969 2:160052703-160052725 CCCCCTGGGCTTTAATATGCAGG - Intronic
947519145 2:230830347-230830369 CCCAGTGTGCTTCACTGTCCTGG - Intergenic
947637553 2:231687774-231687796 CCCCTTGGGCTGCACTGTGAGGG - Intergenic
948078279 2:235184034-235184056 CCCCCTGAGCTTCTCTATGCTGG + Intergenic
948625023 2:239263440-239263462 CCCCATGGGCCTCACTGCACAGG + Intronic
948732114 2:239972313-239972335 CCGGGTGGGCTTCACTCTGCTGG + Intronic
949060020 2:241951350-241951372 CCCCATGGGGTTTACAGTGCAGG - Intergenic
1168771905 20:420960-420982 CCCCGTGTGCTACTCGGTGCTGG + Exonic
1170665215 20:18380921-18380943 CCCAGTGGGCTTCAGTGGGCTGG - Intergenic
1171293370 20:23995195-23995217 CCCGGTGGGCTCCCCTGTCCTGG - Intergenic
1171459613 20:25291286-25291308 CCCTGTGGGCTCTACTGGGCAGG + Intronic
1173374878 20:42474411-42474433 CCACGTGGGCAGCTCTGTGCGGG - Intronic
1174399708 20:50269493-50269515 CCCCGTGAGCTCAGCTGTGCGGG + Intergenic
1175968005 20:62669271-62669293 CCTCCTGGGGTTCACTGTCCAGG + Intronic
1176249344 20:64112845-64112867 CCCAGAGGGCTTCACTGAGGAGG + Intergenic
1179558053 21:42193253-42193275 CCGCGGGGGCTTCACCCTGCTGG - Intergenic
1180194999 21:46188590-46188612 CCCCGTCGGCTTCTCGGTGCTGG - Exonic
1181124855 22:20696066-20696088 CCCAGTGGGCTCCCCTGTCCTGG - Intergenic
1184476974 22:44727235-44727257 CCCCGCTGGCCTCACTGTGCAGG + Intronic
1185394176 22:50578352-50578374 CCCCGCGGGCCGCCCTGTGCCGG + Intronic
1203274568 22_KI270734v1_random:78816-78838 CCCAGTGGGCTCCCCTGTCCTGG - Intergenic
950493066 3:13317914-13317936 GCCCGTGGACTTCCCTCTGCTGG - Intronic
950719127 3:14870161-14870183 GCCCTAGGGCTTCACAGTGCGGG - Intronic
953512328 3:43554787-43554809 CCATGTGGCCTCCACTGTGCAGG + Intronic
953851812 3:46470418-46470440 CTCCACAGGCTTCACTGTGCTGG + Intronic
954609078 3:51934712-51934734 GCCCGTGAGCTTCACGCTGCAGG + Exonic
960571365 3:119188175-119188197 CCCCTTTGGCTTCTCTGTACTGG - Intronic
963040516 3:141066479-141066501 CTCCGTGGGCTACACGGCGCTGG + Exonic
968837120 4:2973163-2973185 CCCCGTGGGCTGCACTGACGTGG + Intronic
970082337 4:12301800-12301822 CCACTTGGGCTTCAGTGTACAGG - Intergenic
971338217 4:25743863-25743885 CCACGTTGCCTTTACTGTGCAGG + Intergenic
982404232 4:155002449-155002471 CCCCATGTGCCACACTGTGCTGG - Intergenic
985210398 4:187586597-187586619 CCCCTAGGCCTTCCCTGTGCAGG - Intergenic
993115362 5:83714103-83714125 CCCCATGTTCTGCACTGTGCTGG + Intronic
999281610 5:150369888-150369910 CACAGTGGGCTTCACTGGGAAGG + Intronic
999873529 5:155776659-155776681 CCCCCTCAGCTTCACTATGCAGG + Intergenic
1001287088 5:170431655-170431677 CCCCGTGGGCTTGGCTGAGAAGG - Intronic
1001863791 5:175085008-175085030 CCACATGGGCTTCTTTGTGCCGG - Intergenic
1007150102 6:39681815-39681837 CCCCGTGGAATTCACTGTAATGG + Intronic
1007383324 6:41504212-41504234 CCCGGTGGGCTTCCCTGCCCTGG + Intergenic
1007552834 6:42743435-42743457 CCCCGTGGTCTTCCAAGTGCTGG - Intergenic
1008492797 6:52103462-52103484 CCCAGGAGGCATCACTGTGCAGG + Intergenic
1012437141 6:99226575-99226597 CCTACTGGCCTTCACTGTGCAGG - Intergenic
1018044394 6:159953006-159953028 CCCCGTGGGGATGACTGTTCAGG - Intergenic
1018481037 6:164190592-164190614 CTCCGTGGCCGGCACTGTGCAGG - Intergenic
1019073243 6:169366861-169366883 AGCTGTGGGCTTCACAGTGCAGG + Intergenic
1019153184 6:170022695-170022717 CCCCGTGGCCTGCACTGTTCTGG - Intergenic
1019989518 7:4682122-4682144 CCACGTGGGCTACGCTGGGCGGG + Intergenic
1022089308 7:27097096-27097118 CCGCGTGGGCCTCACAGGGCCGG + Intergenic
1024207798 7:47178689-47178711 CCCCATGGTCTTCCCTCTGCAGG + Intergenic
1026833952 7:73625822-73625844 CCCCTTGGGCCTCTCTGTGCAGG - Intergenic
1032717756 7:134525331-134525353 CTCTGTGGGCTTCACTGGGGTGG - Intergenic
1033681437 7:143599922-143599944 CCCCTTGGGGGTCACTGTGATGG + Intergenic
1033703455 7:143861891-143861913 CCCCTTGGGGGTCACTGTGATGG - Intronic
1034299358 7:150001692-150001714 CCCCATTCTCTTCACTGTGCAGG + Intergenic
1034806655 7:154095081-154095103 CCCCATTCTCTTCACTGTGCAGG - Intronic
1036085185 8:5605934-5605956 CCCCGTGTGGCTCACTCTGCTGG - Intergenic
1037813464 8:22099812-22099834 CCCCGGGGGCTTCAGGCTGCCGG - Exonic
1039473392 8:37827111-37827133 CCCAGTGGGCCTCCCTGTGCTGG - Intronic
1040314135 8:46252018-46252040 CCCCCTGGGCTCCCCTGGGCAGG + Intergenic
1045519044 8:102887211-102887233 CCCAGTGTGCTTCTCTGTGTTGG - Intronic
1048729809 8:137425746-137425768 AACCGTGGGCTTCTCTGAGCAGG - Intergenic
1048951303 8:139499077-139499099 CCCAGTCAGCTTCACTGGGCAGG - Intergenic
1048985305 8:139731758-139731780 CCCTGAGGGCCTCACTGTCCAGG + Intronic
1049328187 8:142034914-142034936 CCCACTGGACTGCACTGTGCTGG - Intergenic
1051350283 9:16192386-16192408 CCCCGTTGCCTGCACTGCGCGGG - Intergenic
1057915707 9:99053638-99053660 CCCCATGGGCCCCACTGCGCAGG + Intronic
1059358800 9:113723129-113723151 CACTGTGGGCTTCCCTGTTCTGG - Intergenic
1060842411 9:126804283-126804305 TTCCGTGGGCTGCATTGTGCTGG - Intergenic
1061188596 9:129069330-129069352 CCCAGTGGCCTGCTCTGTGCTGG - Intronic
1061870128 9:133515997-133516019 CCCCATGGGCCACACTGGGCTGG - Intronic
1186431689 X:9510499-9510521 CCCCGTGGGCCACAGTCTGCTGG - Intronic
1187335515 X:18377886-18377908 CCCCGTGGCATTCCCTGTGCAGG - Intergenic
1188200424 X:27288997-27289019 CCCCATTGGGTTCACTGTTCCGG - Intergenic
1189294361 X:39908391-39908413 CACCGTGGGCATTTCTGTGCAGG - Intergenic
1191213188 X:57910006-57910028 CCCCGCGGGCTGCTCTGCGCAGG - Exonic