ID: 1113552636

View in Genome Browser
Species Human (GRCh38)
Location 13:111205014-111205036
Sequence GGAGTGTGAGCTCATTCACG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 70
Summary {0: 1, 1: 1, 2: 0, 3: 3, 4: 65}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113552636_1113552644 -10 Left 1113552636 13:111205014-111205036 CCCCGTGAATGAGCTCACACTCC 0: 1
1: 1
2: 0
3: 3
4: 65
Right 1113552644 13:111205027-111205049 CTCACACTCCAGAGGGGCAGGGG 0: 1
1: 0
2: 2
3: 31
4: 305
1113552636_1113552653 25 Left 1113552636 13:111205014-111205036 CCCCGTGAATGAGCTCACACTCC 0: 1
1: 1
2: 0
3: 3
4: 65
Right 1113552653 13:111205062-111205084 AGGGAATTGGCCTAATGCCGAGG 0: 1
1: 0
2: 0
3: 3
4: 54
1113552636_1113552657 29 Left 1113552636 13:111205014-111205036 CCCCGTGAATGAGCTCACACTCC 0: 1
1: 1
2: 0
3: 3
4: 65
Right 1113552657 13:111205066-111205088 AATTGGCCTAATGCCGAGGGGGG 0: 1
1: 0
2: 0
3: 1
4: 49
1113552636_1113552654 26 Left 1113552636 13:111205014-111205036 CCCCGTGAATGAGCTCACACTCC 0: 1
1: 1
2: 0
3: 3
4: 65
Right 1113552654 13:111205063-111205085 GGGAATTGGCCTAATGCCGAGGG 0: 1
1: 0
2: 0
3: 3
4: 47
1113552636_1113552648 0 Left 1113552636 13:111205014-111205036 CCCCGTGAATGAGCTCACACTCC 0: 1
1: 1
2: 0
3: 3
4: 65
Right 1113552648 13:111205037-111205059 AGAGGGGCAGGGGCGGGTGTTGG 0: 1
1: 1
2: 6
3: 116
4: 978
1113552636_1113552652 12 Left 1113552636 13:111205014-111205036 CCCCGTGAATGAGCTCACACTCC 0: 1
1: 1
2: 0
3: 3
4: 65
Right 1113552652 13:111205049-111205071 GCGGGTGTTGGGTAGGGAATTGG 0: 1
1: 0
2: 0
3: 17
4: 170
1113552636_1113552649 1 Left 1113552636 13:111205014-111205036 CCCCGTGAATGAGCTCACACTCC 0: 1
1: 1
2: 0
3: 3
4: 65
Right 1113552649 13:111205038-111205060 GAGGGGCAGGGGCGGGTGTTGGG 0: 1
1: 0
2: 16
3: 86
4: 845
1113552636_1113552645 -7 Left 1113552636 13:111205014-111205036 CCCCGTGAATGAGCTCACACTCC 0: 1
1: 1
2: 0
3: 3
4: 65
Right 1113552645 13:111205030-111205052 ACACTCCAGAGGGGCAGGGGCGG 0: 1
1: 0
2: 1
3: 36
4: 388
1113552636_1113552651 6 Left 1113552636 13:111205014-111205036 CCCCGTGAATGAGCTCACACTCC 0: 1
1: 1
2: 0
3: 3
4: 65
Right 1113552651 13:111205043-111205065 GCAGGGGCGGGTGTTGGGTAGGG 0: 1
1: 0
2: 1
3: 35
4: 389
1113552636_1113552650 5 Left 1113552636 13:111205014-111205036 CCCCGTGAATGAGCTCACACTCC 0: 1
1: 1
2: 0
3: 3
4: 65
Right 1113552650 13:111205042-111205064 GGCAGGGGCGGGTGTTGGGTAGG 0: 1
1: 1
2: 6
3: 64
4: 810
1113552636_1113552655 27 Left 1113552636 13:111205014-111205036 CCCCGTGAATGAGCTCACACTCC 0: 1
1: 1
2: 0
3: 3
4: 65
Right 1113552655 13:111205064-111205086 GGAATTGGCCTAATGCCGAGGGG 0: 1
1: 0
2: 1
3: 1
4: 28
1113552636_1113552656 28 Left 1113552636 13:111205014-111205036 CCCCGTGAATGAGCTCACACTCC 0: 1
1: 1
2: 0
3: 3
4: 65
Right 1113552656 13:111205065-111205087 GAATTGGCCTAATGCCGAGGGGG 0: 1
1: 0
2: 0
3: 4
4: 40
1113552636_1113552646 -6 Left 1113552636 13:111205014-111205036 CCCCGTGAATGAGCTCACACTCC 0: 1
1: 1
2: 0
3: 3
4: 65
Right 1113552646 13:111205031-111205053 CACTCCAGAGGGGCAGGGGCGGG 0: 1
1: 2
2: 8
3: 69
4: 565

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113552636 Original CRISPR GGAGTGTGAGCTCATTCACG GGG (reversed) Intronic
902275854 1:15338731-15338753 GGAGGGGGAGATCATTCACCTGG - Intronic
907626918 1:56039624-56039646 GGACGATGATCTCATTCACGAGG + Intergenic
918748696 1:188242207-188242229 AAAGTGTGAGCTCATACACTGGG + Intergenic
924661145 1:246018328-246018350 GGGGAGTGAGAGCATTCACGTGG - Intronic
1064103781 10:12484617-12484639 GGAGGGTGAGCTCATTCACGGGG + Intronic
1065790627 10:29257157-29257179 GGAGTGGGAGGTGATACACGAGG + Intergenic
1067146316 10:43696069-43696091 GGAGTCTGAGCTCTTTAACAGGG - Intergenic
1070510918 10:77159844-77159866 GGCTGGTGAGCTCATTCATGGGG - Intronic
1072805680 10:98422824-98422846 GGAGTGTGAGCACAGCCACTTGG + Intronic
1074363726 10:112841739-112841761 GCAGTGGGAGCTCAGTCACCAGG + Intergenic
1078444221 11:11392130-11392152 GGACTGTGAGCTCCTTAAGGAGG + Intronic
1079391719 11:20027499-20027521 GCAGTGTGAGCTTAGTCACCTGG + Intronic
1080686994 11:34524259-34524281 AGAATGTGAGCTCATTCAGTTGG - Intergenic
1084773208 11:71357566-71357588 GGAGTGGGAGCGCTTCCACGTGG - Intergenic
1095535434 12:43240505-43240527 GGAGTGGGGCCTCATTCACATGG - Intergenic
1096887009 12:54728145-54728167 GGAAAGTGAGCACCTTCACGAGG + Intergenic
1098986782 12:77020709-77020731 GATGTTTGAGCTGATTCACGTGG - Intergenic
1106384490 13:29270660-29270682 GGAGCGTGTGCTCATGCTCGGGG - Intronic
1109224284 13:59673697-59673719 GGAGCTTGAGCTCAATCATGTGG + Intronic
1113552636 13:111205014-111205036 GGAGTGTGAGCTCATTCACGGGG - Intronic
1119758832 14:77137506-77137528 GGAGTGTGAGCACAGGCAGGTGG - Intronic
1122460626 14:101891692-101891714 GGAGGGTGTGCTCACTCACAGGG - Intronic
1122918224 14:104868534-104868556 GGAGTGTGAGCTCATGCTACAGG + Exonic
1122976529 14:105173146-105173168 GGAGGGTGAGCTCATTGAGGTGG - Exonic
1124459196 15:29873415-29873437 GGAGTGTGAGCTCCTGCAGCAGG - Intronic
1125043506 15:35220476-35220498 GAACTGTGAGTTCATTCATGAGG - Intronic
1138035882 16:53605544-53605566 GGAGTGTGAGGACATTGGCGTGG - Exonic
1146820719 17:35981988-35982010 AGAGTGTGAGCTCAATCATGTGG - Intergenic
1152023262 17:77792880-77792902 TGAGTGTGAGGTCATTCTCCCGG + Intergenic
1152258079 17:79251900-79251922 GGAGTGTGAGCTCGGCCACTGGG - Intronic
1157579284 18:48764114-48764136 GGAGTGTGAGATGCTTCAGGGGG - Intronic
1165421301 19:35723285-35723307 GGGGCGTGACCTCATTCCCGTGG + Intronic
1167571007 19:50289090-50289112 GCACTGTGAGCTCACTCACTGGG - Intronic
927959481 2:27232051-27232073 TGCGTGTGAGCTCATACAGGCGG - Exonic
935827729 2:106968355-106968377 GGAGATTGAGCTCAATCAGGTGG + Intergenic
935899017 2:107770624-107770646 GGAACCTGAGCTCATTCATGAGG + Intergenic
937533459 2:122857729-122857751 GGAGATTGAGCTCAATCACAAGG - Intergenic
940055446 2:149508048-149508070 GGAGAGGCAGCTCATTCAAGGGG + Intergenic
942257282 2:174116031-174116053 AGACTGTGAGCTCATTGAGGAGG - Intronic
945879699 2:215312652-215312674 GGAGTGTGATCACATTAACCAGG + Intronic
1168893449 20:1308633-1308655 GGAGGGTGAGCTCTCTCAGGGGG - Exonic
1169775376 20:9246375-9246397 GGAGAGTGAGACCATTCACAGGG - Intronic
1170990865 20:21301052-21301074 GGAGTGCAAGCTAATTCACCTGG - Intergenic
1171378281 20:24710699-24710721 GGAGTTTTAGTACATTCACGGGG + Intergenic
1176996445 21:15560637-15560659 GGAGTTCCAGCTCATTCTCGTGG + Intergenic
1178876286 21:36416668-36416690 GAAGTGTGTGCACTTTCACGAGG - Exonic
960424522 3:117489832-117489854 GGAGTGTTATCTCTTTCACTGGG + Intergenic
965191412 3:165534305-165534327 GGATTGTGAACTCATCCACCGGG + Intergenic
968131665 3:196195952-196195974 GGGGTGTGAGCGCATTCTCAGGG - Intergenic
970340985 4:15106606-15106628 GGAGAGTGAGTTCAATGACGTGG - Intergenic
997752304 5:136357981-136358003 GGTGTAGGAGCTCATTCAGGGGG - Intronic
1005920481 6:30396956-30396978 GGAGCCTGAGGTCATCCACGCGG - Intergenic
1017260555 6:152381251-152381273 TGGGTGTGAGCTCATGCACACGG - Exonic
1020980449 7:15061601-15061623 GTAGTGTGCGCTCATTTACATGG + Intergenic
1021184553 7:17548384-17548406 GGCGGGTGATCTCATTCATGAGG - Intergenic
1030127812 7:106171184-106171206 TGAGTCTGAGCTCACTCACGTGG - Intergenic
1031020248 7:116620167-116620189 GGACAGTGATCTCATTCATGAGG + Intergenic
1031614974 7:123869593-123869615 GGAGTGTTTGCTCATACATGTGG + Intronic
1033524428 7:142196287-142196309 GGTGTGTGGGCTCATTCCCAGGG + Intronic
1036106123 8:5842258-5842280 GGAGTTTGAGTTCAACCACGTGG + Intergenic
1038697088 8:29816241-29816263 GGATGCTGAGCTCATTCACAAGG + Intergenic
1039387692 8:37150964-37150986 GGAGGATGAGCTCATTTATGTGG + Intergenic
1041394380 8:57376330-57376352 GGAGTGTGAGTTCATCCAGCAGG + Intergenic
1041796073 8:61750273-61750295 GGAGATTGAGTTCATTCAAGTGG + Intergenic
1048002720 8:130392851-130392873 AGAGTGAGAACTCATTCATGAGG + Intronic
1055804131 9:80074260-80074282 GGACTGTGAGCTCTTTGAGGAGG - Intergenic
1059397863 9:114049786-114049808 GGTCTGTGAGCTCATCAACGAGG + Exonic
1190826816 X:54025408-54025430 GGAGTGGGAGCTCTTACACAAGG - Intronic
1192042212 X:67634638-67634660 TTAGTGTGTGTTCATTCACGAGG - Intronic
1196095765 X:111797924-111797946 TGTGTGTGAGCCCATTCATGTGG + Intronic