ID: 1113552649

View in Genome Browser
Species Human (GRCh38)
Location 13:111205038-111205060
Sequence GAGGGGCAGGGGCGGGTGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 948
Summary {0: 1, 1: 0, 2: 16, 3: 86, 4: 845}

Found 18 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113552631_1113552649 10 Left 1113552631 13:111205005-111205027 CCGCCCCGCCCCCGTGAATGAGC 0: 1
1: 0
2: 2
3: 22
4: 129
Right 1113552649 13:111205038-111205060 GAGGGGCAGGGGCGGGTGTTGGG 0: 1
1: 0
2: 16
3: 86
4: 845
1113552623_1113552649 20 Left 1113552623 13:111204995-111205017 CCCCCCCACCCCGCCCCGCCCCC 0: 4
1: 51
2: 459
3: 2535
4: 11006
Right 1113552649 13:111205038-111205060 GAGGGGCAGGGGCGGGTGTTGGG 0: 1
1: 0
2: 16
3: 86
4: 845
1113552626_1113552649 17 Left 1113552626 13:111204998-111205020 CCCCACCCCGCCCCGCCCCCGTG 0: 1
1: 5
2: 34
3: 241
4: 1772
Right 1113552649 13:111205038-111205060 GAGGGGCAGGGGCGGGTGTTGGG 0: 1
1: 0
2: 16
3: 86
4: 845
1113552627_1113552649 16 Left 1113552627 13:111204999-111205021 CCCACCCCGCCCCGCCCCCGTGA 0: 1
1: 0
2: 11
3: 104
4: 782
Right 1113552649 13:111205038-111205060 GAGGGGCAGGGGCGGGTGTTGGG 0: 1
1: 0
2: 16
3: 86
4: 845
1113552637_1113552649 0 Left 1113552637 13:111205015-111205037 CCCGTGAATGAGCTCACACTCCA 0: 1
1: 0
2: 2
3: 17
4: 105
Right 1113552649 13:111205038-111205060 GAGGGGCAGGGGCGGGTGTTGGG 0: 1
1: 0
2: 16
3: 86
4: 845
1113552634_1113552649 5 Left 1113552634 13:111205010-111205032 CCGCCCCCGTGAATGAGCTCACA 0: 1
1: 0
2: 0
3: 4
4: 79
Right 1113552649 13:111205038-111205060 GAGGGGCAGGGGCGGGTGTTGGG 0: 1
1: 0
2: 16
3: 86
4: 845
1113552628_1113552649 15 Left 1113552628 13:111205000-111205022 CCACCCCGCCCCGCCCCCGTGAA 0: 1
1: 0
2: 12
3: 117
4: 1020
Right 1113552649 13:111205038-111205060 GAGGGGCAGGGGCGGGTGTTGGG 0: 1
1: 0
2: 16
3: 86
4: 845
1113552638_1113552649 -1 Left 1113552638 13:111205016-111205038 CCGTGAATGAGCTCACACTCCAG 0: 1
1: 0
2: 3
3: 42
4: 443
Right 1113552649 13:111205038-111205060 GAGGGGCAGGGGCGGGTGTTGGG 0: 1
1: 0
2: 16
3: 86
4: 845
1113552635_1113552649 2 Left 1113552635 13:111205013-111205035 CCCCCGTGAATGAGCTCACACTC 0: 1
1: 0
2: 0
3: 9
4: 135
Right 1113552649 13:111205038-111205060 GAGGGGCAGGGGCGGGTGTTGGG 0: 1
1: 0
2: 16
3: 86
4: 845
1113552625_1113552649 18 Left 1113552625 13:111204997-111205019 CCCCCACCCCGCCCCGCCCCCGT 0: 2
1: 0
2: 52
3: 370
4: 2787
Right 1113552649 13:111205038-111205060 GAGGGGCAGGGGCGGGTGTTGGG 0: 1
1: 0
2: 16
3: 86
4: 845
1113552632_1113552649 7 Left 1113552632 13:111205008-111205030 CCCCGCCCCCGTGAATGAGCTCA 0: 1
1: 0
2: 1
3: 8
4: 66
Right 1113552649 13:111205038-111205060 GAGGGGCAGGGGCGGGTGTTGGG 0: 1
1: 0
2: 16
3: 86
4: 845
1113552622_1113552649 23 Left 1113552622 13:111204992-111205014 CCACCCCCCCACCCCGCCCCGCC 0: 2
1: 25
2: 331
3: 2085
4: 9029
Right 1113552649 13:111205038-111205060 GAGGGGCAGGGGCGGGTGTTGGG 0: 1
1: 0
2: 16
3: 86
4: 845
1113552630_1113552649 11 Left 1113552630 13:111205004-111205026 CCCGCCCCGCCCCCGTGAATGAG 0: 1
1: 0
2: 2
3: 14
4: 142
Right 1113552649 13:111205038-111205060 GAGGGGCAGGGGCGGGTGTTGGG 0: 1
1: 0
2: 16
3: 86
4: 845
1113552636_1113552649 1 Left 1113552636 13:111205014-111205036 CCCCGTGAATGAGCTCACACTCC 0: 1
1: 1
2: 0
3: 3
4: 65
Right 1113552649 13:111205038-111205060 GAGGGGCAGGGGCGGGTGTTGGG 0: 1
1: 0
2: 16
3: 86
4: 845
1113552629_1113552649 12 Left 1113552629 13:111205003-111205025 CCCCGCCCCGCCCCCGTGAATGA 0: 1
1: 0
2: 1
3: 20
4: 165
Right 1113552649 13:111205038-111205060 GAGGGGCAGGGGCGGGTGTTGGG 0: 1
1: 0
2: 16
3: 86
4: 845
1113552621_1113552649 24 Left 1113552621 13:111204991-111205013 CCCACCCCCCCACCCCGCCCCGC 0: 2
1: 3
2: 97
3: 786
4: 4840
Right 1113552649 13:111205038-111205060 GAGGGGCAGGGGCGGGTGTTGGG 0: 1
1: 0
2: 16
3: 86
4: 845
1113552624_1113552649 19 Left 1113552624 13:111204996-111205018 CCCCCCACCCCGCCCCGCCCCCG 0: 2
1: 8
2: 109
3: 891
4: 5409
Right 1113552649 13:111205038-111205060 GAGGGGCAGGGGCGGGTGTTGGG 0: 1
1: 0
2: 16
3: 86
4: 845
1113552633_1113552649 6 Left 1113552633 13:111205009-111205031 CCCGCCCCCGTGAATGAGCTCAC 0: 1
1: 0
2: 2
3: 5
4: 81
Right 1113552649 13:111205038-111205060 GAGGGGCAGGGGCGGGTGTTGGG 0: 1
1: 0
2: 16
3: 86
4: 845

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113552649 Original CRISPR GAGGGGCAGGGGCGGGTGTT GGG Intronic
900151449 1:1180901-1180923 CAGGGGCAGGGGCAGGCGTAGGG - Intronic
900154136 1:1197365-1197387 GAGGGGGTGGGGAGGGTGTGAGG - Intronic
900160125 1:1219410-1219432 GAGGGGCAGGCGCGGGTGTGGGG - Intronic
900329580 1:2127399-2127421 GTGGGGCAGGGGCGGCGGTGGGG - Intronic
900365395 1:2309987-2310009 CACGGGCAGGGGCGGGGGTCTGG - Exonic
900420907 1:2555543-2555565 GAGGGGCAGGGGGCGGTCCTGGG + Intergenic
900494941 1:2972042-2972064 GCGGGGGGGGGGGGGGTGTTGGG + Intergenic
900524530 1:3121974-3121996 GAGTGGCAGGCGCGGGCGGTTGG + Intronic
900789075 1:4667355-4667377 GAGGGGCAGGGGCAGGTGGCTGG - Intronic
901630767 1:10647101-10647123 GAGGGGGAGGGGAGGCTGGTGGG + Intronic
901674100 1:10872887-10872909 GAGGGGCTGGGGCAGGGGTGTGG + Intergenic
901844127 1:11971281-11971303 GAGGGGCTGGGGAAGGGGTTGGG + Intronic
902112383 1:14093162-14093184 GACGGGCAGTGGCTGGTGTTGGG - Intergenic
902177959 1:14665536-14665558 TAGGGGCTGGGGTGGGTGTGGGG + Intronic
902400467 1:16154364-16154386 GTTGGGCAGTGGCAGGTGTTGGG - Intronic
902471107 1:16647955-16647977 GAGGTGGGGGGGCGGGCGTTGGG + Intergenic
902553468 1:17232973-17232995 GAGGGGCTGGGGCGGGAGGTGGG + Intronic
902580429 1:17404357-17404379 GTGGGGCTGGGGCAGGTGTTCGG + Intergenic
902807713 1:18871532-18871554 GAGGGGCCGGGGCAGGTGGCTGG - Exonic
902837913 1:19058589-19058611 GACAGGCAGAGGTGGGTGTTAGG - Intergenic
902983126 1:20139580-20139602 GAGGGGCAGGGACAGGCGTGAGG + Intronic
903144662 1:21363298-21363320 GAGGGGCTGGGGCTGGGGCTGGG - Intergenic
903678618 1:25082554-25082576 GTGCTGCAGGGGCGGGTGTTGGG - Intergenic
904038393 1:27570869-27570891 GAGGGGCAGGGGCAGGGGCCTGG - Intronic
904038613 1:27571714-27571736 GAGGGGGAGGGGAGGGGGCTGGG - Intronic
904102193 1:28040848-28040870 GAGGGGCAGGGGGGGGTCGGGGG + Intronic
904428533 1:30447117-30447139 GAGGGGCAGGCGTGTGTCTTAGG + Intergenic
904614598 1:31743049-31743071 GATGGGCAGGCGCCGGTGGTGGG - Intronic
904715595 1:32465291-32465313 GAGGGGCAGGCGCGGCCGTGGGG + Intronic
904825194 1:33269729-33269751 GTTGGGCTGGGGCGGGGGTTGGG + Intronic
905043373 1:34977818-34977840 GGGAGGGGGGGGCGGGTGTTGGG - Intergenic
905044528 1:34985338-34985360 CGGCGGCAGGGGCGGGTTTTCGG - Exonic
905505583 1:38476577-38476599 GAGGGGCAGGGGCGCGGGCCGGG - Intergenic
905569231 1:38991063-38991085 GAGGGGCGGGGGTGGGGGTGGGG + Intergenic
905901078 1:41582292-41582314 GTGGGGCAGGTGGGGGTGATGGG + Exonic
905908875 1:41640259-41640281 GAGCTGCTGGGGCGGGGGTTGGG + Intronic
906187458 1:43872089-43872111 GAGGGGGAGGAGGGGGTGTGTGG + Intronic
906244550 1:44263754-44263776 GAGGGGCAAGAGTGTGTGTTGGG - Intronic
906609225 1:47190495-47190517 GCGGGGCAGGGGCAGGTGGTGGG - Intronic
906725723 1:48042679-48042701 CGGGGGAAGGGGTGGGTGTTAGG + Intergenic
907185009 1:52602672-52602694 GCGGGGCGGGGGCCGGGGTTTGG - Intronic
907456504 1:54579729-54579751 GAGAGGCAGGGGCGGGAGAGTGG + Intronic
908643361 1:66249661-66249683 CAGGGGGTGGGGCGGGTGGTGGG - Intronic
908923627 1:69226172-69226194 GAGGGGCAGGTGTGAGTGTCAGG - Intergenic
910678910 1:89843230-89843252 GGGGGGTAGGGGTGGGGGTTGGG + Intronic
910909551 1:92218710-92218732 GAGGGGCAGGCGCGGGGGACGGG - Intronic
911155044 1:94628538-94628560 CAGGGGCAGGGGCAGGGATTTGG + Intergenic
912460661 1:109828756-109828778 CAGGGGATGGGGCGGGTGTGGGG + Intergenic
912471691 1:109911092-109911114 GACGGGCTGGGGCGGGGGCTCGG + Intronic
912693605 1:111823170-111823192 GGGGGGCAGGGCAGGGTGTGGGG + Intronic
915049223 1:153049858-153049880 CATGGGCAGGGGTGGTTGTTTGG - Intergenic
915368138 1:155326740-155326762 GAGGGGCAGGGGCCTGAGGTGGG - Exonic
915463487 1:156082755-156082777 GCGGGGCAGGAGCGGGTCCTGGG - Intronic
915557456 1:156668545-156668567 GAGGGCCAGGGGCTGTTGCTTGG - Intergenic
915569648 1:156737606-156737628 GAAGGTCAGGGGTGGGTGCTAGG - Intronic
915934535 1:160082937-160082959 GTGGGGGCGGGGCTGGTGTTAGG + Intronic
916714634 1:167438757-167438779 GAGGGGCAGGGGCTGGGGAGGGG + Intronic
916974269 1:170058720-170058742 GATGGGCTGAGGCGGGTGTAGGG + Intronic
917005784 1:170415968-170415990 GATGGGGAGGGGCGGGGGATAGG - Intergenic
917471464 1:175329557-175329579 GATGGACAGGGTGGGGTGTTAGG + Intronic
918248923 1:182684588-182684610 GAGCGGCAGGGGAGGGGGTGGGG + Intergenic
918424538 1:184394975-184394997 GTGAGGCAGGGGTGGGTGTTGGG - Intronic
919712073 1:200738835-200738857 CGGGGGCGGGGGCGGGGGTTGGG + Intergenic
919843475 1:201626286-201626308 GAGGTGCTGGGGCGGGTGGCAGG - Intronic
920684221 1:208096792-208096814 GAGGTGGAGGGGCAGGTGTCCGG - Exonic
920696308 1:208183600-208183622 GAGGGAGAGGGGGGGGTCTTTGG + Intronic
921667614 1:217891503-217891525 GAGGTGCAGGGGTGGGGGTGTGG + Intergenic
921805293 1:219447029-219447051 GAGAGACAGGGGCGGGTGGGGGG - Intergenic
922116349 1:222617997-222618019 GGGGGGCTGGGGCGGGGGCTGGG - Intergenic
922527957 1:226320658-226320680 TAGGGGCAGGGGTGGGGGATGGG + Intergenic
922612600 1:226941124-226941146 CAGGGGCAGGTTTGGGTGTTGGG + Intronic
922749178 1:228062773-228062795 GAGGGGCAGGTGGGGGGTTTGGG - Intergenic
922917515 1:229270946-229270968 GAGCGGCAGGTGGGGGCGTTGGG - Intergenic
923023891 1:230189021-230189043 GAGGAGCAGGGGCAGCTGTAGGG + Intronic
923098624 1:230794944-230794966 GTGGTGCAGGGGCGAGTGTGCGG - Intronic
924775325 1:247111807-247111829 GAGGCGCCGGGGAGGGTGTGGGG + Exonic
1063115076 10:3067388-3067410 TAGGGGCAGGGGCCGGGGCTGGG - Intronic
1063116628 10:3076378-3076400 GAGGGGCTGGGGCGGGGGCGCGG - Intronic
1063121232 10:3106715-3106737 AAGGGGCAGGGGCAGGGGTGAGG - Intronic
1063464674 10:6235016-6235038 GGGGGCCGGGGGCGGGGGTTGGG + Exonic
1063604016 10:7507342-7507364 GAGGTGGAGGGGCAGATGTTGGG + Intergenic
1063957367 10:11280032-11280054 GAGAGGCAAGGGCGCGTGCTTGG - Intronic
1064114743 10:12568286-12568308 GAGGGGGAGGGGTGGGGGATGGG - Intronic
1064729637 10:18317097-18317119 GGGGGGCAGGGGGTGGTGTGGGG - Intronic
1065167369 10:22993795-22993817 GAGGGATAGGGAAGGGTGTTTGG + Intronic
1065186520 10:23174599-23174621 GCGGGGCGGGGGCGGGGGATTGG - Intergenic
1066326616 10:34366484-34366506 GATGGGCAGGGGCTGTTGCTTGG + Intronic
1066469271 10:35682221-35682243 GAGAGGCAGGAGCGGGTGAGAGG + Intergenic
1066622986 10:37378159-37378181 CAGGGACAGAGGAGGGTGTTAGG - Intronic
1066726808 10:38403191-38403213 GAGTCACAGGCGCGGGTGTTCGG + Intergenic
1067028753 10:42866302-42866324 GTGCGGCCGGGGCGGGTGTGAGG - Intergenic
1067440801 10:46308380-46308402 AAGGGGCAGGGGCCTGTGCTGGG - Intronic
1067527989 10:47049767-47049789 GGGGCCCAGGGGTGGGTGTTAGG + Intergenic
1067571926 10:47378060-47378082 TAGGGGCAGGGCCAGGTGGTGGG - Intronic
1068610641 10:59056564-59056586 GGGGGGTGGGGGCGGGAGTTGGG - Intergenic
1069320482 10:67165348-67165370 ACGGGGCAGGGGCAGGTGGTAGG + Intronic
1069659242 10:70112671-70112693 GAGGGGCAGGGTGGGGAGGTGGG + Exonic
1069865945 10:71502984-71503006 GAGGGGCAAGGGCTGGGATTGGG - Intronic
1070159207 10:73855524-73855546 GTGGGGCATGGGGTGGTGTTGGG - Intronic
1070391276 10:75972868-75972890 GAGGGGCTGGGGCTGGGGCTGGG + Intronic
1070508221 10:77135792-77135814 GAGGGGCTGGGGCGGTTGGAGGG + Intronic
1070789045 10:79178838-79178860 GAGGGGCTGGGGGAGGTGTGTGG + Intronic
1071350389 10:84734776-84734798 GTGGGGCAGGGGCAGGAGGTGGG + Intergenic
1071375874 10:85002573-85002595 GAAGAGCAGGGATGGGTGTTAGG + Intergenic
1072232388 10:93424720-93424742 CAGGGGCAGGGGCGGAGGTCAGG + Intronic
1072387998 10:94951827-94951849 GAGGTGCAGAGGTGGGTGATGGG + Intronic
1072504391 10:96049891-96049913 GAGGTGTAGGGGCGTGTGTGTGG + Intronic
1072626224 10:97113953-97113975 GTGGGGCAGGGGTGGGAGTGAGG + Intronic
1073091135 10:100940779-100940801 GAGGGGCAGGGGCAGGAGCAGGG - Intronic
1073632412 10:105161991-105162013 CAGGGGCAGGGGCGGGAGGAGGG - Intronic
1074088686 10:110227150-110227172 GAGGGGCACGCGCGTGTGTGGGG + Intronic
1074111568 10:110426436-110426458 GAGAGGCGGGGGTGGGTGTGAGG + Intergenic
1074187408 10:111108704-111108726 TAGGGGCAGGGGCTGGGGTGGGG + Intergenic
1075031173 10:119025667-119025689 GCAGGGCAGGGGTGGGTGGTGGG - Intergenic
1075304565 10:121356218-121356240 GATGGGCAGGGGATGGTGTGTGG - Intergenic
1075815201 10:125259748-125259770 GAGGGGCAGGGGCAGGGGTAGGG + Intergenic
1076300020 10:129418929-129418951 GCGGGGCGGGGAGGGGTGTTAGG - Intergenic
1076379581 10:130015807-130015829 GGGGAGCAGGGGTGGGGGTTGGG + Intergenic
1076486727 10:130824977-130824999 GAGGGGCAGGGGGTGCTGTAGGG - Intergenic
1076576671 10:131474229-131474251 GAGGGGTATGGGTGGGGGTTGGG - Intergenic
1076676343 10:132149550-132149572 GAGGGGGTGGGGCGGGGGATGGG - Intronic
1076732007 10:132443942-132443964 GAGGGGGAGGGGAAGGTGTGAGG - Intergenic
1076827146 10:132974782-132974804 GAGGGGCTGGGGTGGCTATTGGG - Intergenic
1076890526 10:133281015-133281037 GCTGGGCAGGGGCAGGTGCTGGG + Intronic
1076890548 10:133281085-133281107 GCTGGGCAGGGGCAGGTGCTGGG + Intronic
1076935703 10:133566644-133566666 TAGGGTCAGGGGTGGGGGTTAGG + Intronic
1076946097 10:133651503-133651525 GTGGGGCAGGGGCCGGGGTGGGG - Intergenic
1076990098 11:268283-268305 GTGGGGCTGGGGAGGGTGTGAGG - Intergenic
1077134806 11:993181-993203 GAGGGGCTGGTGCTGGTGTAGGG + Intronic
1077143081 11:1033407-1033429 GAGGGGCTGGTGCGGGTGGCAGG + Intronic
1077165254 11:1131901-1131923 AAGGGGCAGGGGCTGGGGCTGGG - Intergenic
1077208100 11:1353675-1353697 CAGAGGCAGGGACGGGTGTCTGG - Intergenic
1077223059 11:1425854-1425876 GTGGGGCAGGGGAGGGCGTGGGG + Intronic
1077228303 11:1447873-1447895 GAGGTGCGGGGACGGGTGGTCGG - Intronic
1077235864 11:1481743-1481765 GAGGGGCAGGGGCAGGGGCAGGG + Intronic
1077453024 11:2662374-2662396 GGGGGGCAGGGGAGGGGGCTGGG - Intronic
1077527369 11:3075252-3075274 GGGTGGCAGGTGCGGGTCTTGGG + Intergenic
1077874683 11:6294123-6294145 AAGGGGCAGGGGTGGGGGTGTGG + Intergenic
1077898807 11:6473950-6473972 GAGGGGCCGGGGCGGGGCTGCGG + Intronic
1078149694 11:8748158-8748180 GTTGGGGAGGGGAGGGTGTTGGG - Intronic
1078929316 11:15901200-15901222 GAAGGGCAGGAGCGGGTGGGAGG + Intergenic
1079201951 11:18384051-18384073 GTGAGGCAGGGGCAGGTGTCAGG + Intergenic
1079690141 11:23406806-23406828 GAGGGGGAGGGGCAGGGGTGGGG - Intergenic
1080121617 11:28684461-28684483 GAGGGGCAGGGGCTAGGGTCGGG + Intergenic
1080517842 11:33039985-33040007 GAGTGGCAGGGCCGGGAGTAGGG - Intronic
1080649225 11:34209601-34209623 GAGGGGTAGGGGTGGGGGTGAGG + Intronic
1080649235 11:34209620-34209642 GAGGGGTAGGGGTGGGGGTGAGG + Intronic
1080649261 11:34209677-34209699 GAGGGGTAGGGGTGGGGGTGAGG + Intronic
1081632539 11:44699632-44699654 GAGAGGCAGGGGGTGGTGGTGGG + Intergenic
1081870350 11:46380329-46380351 GTGGGGCAGGAGCGGGGGCTGGG - Exonic
1083336083 11:61922690-61922712 GCGGGGCAGGGTGGGGTGTGAGG - Intergenic
1083721607 11:64606443-64606465 GAGGAGCAGGGGTGGGGGGTGGG - Exonic
1083857733 11:65401382-65401404 GAGGGGCAGGGGAGGGAGGCTGG - Intronic
1084035769 11:66509335-66509357 GAGGGGGAGGGGCAGGAGCTTGG + Exonic
1084093422 11:66894318-66894340 GAGGGAGAGGGGCAGGTGCTAGG - Intronic
1084272426 11:68036430-68036452 GAGGTGCAGGGACGGTGGTTAGG - Intronic
1084332437 11:68438029-68438051 GAGGGGCAGGGTCGGCTGGGTGG - Intronic
1084430631 11:69108871-69108893 AAGGGGCAGGGGCAGGTGCTTGG - Intergenic
1084713670 11:70860078-70860100 AAGGGACAGGGTCGGATGTTGGG - Intronic
1084949613 11:72657456-72657478 GAGGGGCAGGGGCCGGGGCATGG - Intronic
1085016104 11:73174982-73175004 GAGGGGCAGGGACTTGCGTTAGG + Intergenic
1085619926 11:78030405-78030427 GAGGGGCAGGGACGTGTCTAAGG - Intronic
1087127302 11:94640688-94640710 GAGGGGCAGGGGCGGGGCGGGGG - Intergenic
1089298542 11:117484021-117484043 GGGGGGCAGGGGCGGGGGGCGGG - Intronic
1089315571 11:117588785-117588807 CATGGCCAGGGGCGGGTGTGGGG + Intronic
1089457244 11:118632780-118632802 AAGGGGCAGGGGCAGGAGCTAGG - Intronic
1089540930 11:119188561-119188583 GAGGGGCAGGGGCTAGGGTTGGG + Intronic
1089554871 11:119310728-119310750 GGGGCGGAGGGGCCGGTGTTGGG + Intronic
1089565535 11:119369282-119369304 GGGGGGCAGGGGCGGGTGGCAGG - Intronic
1089567762 11:119381075-119381097 GGGGGTTAGGGGCGGGGGTTGGG - Intronic
1090788728 11:130070904-130070926 AAGCGGCAGGGCCGGGGGTTGGG + Intronic
1091643939 12:2259224-2259246 GTGGGGCAGGGCGGGGTGTGGGG - Intronic
1091696810 12:2633324-2633346 CAGGGGCAGGAGTGGGTGTGGGG - Intronic
1092119450 12:6033857-6033879 GAGGAGGAGGGGCGGGAGCTTGG - Intronic
1092243856 12:6852114-6852136 GAGGGGCAGGGGAGGGGACTGGG + Exonic
1092290885 12:7158860-7158882 CTGGGGCAGGGGCGGGGGGTTGG + Exonic
1092527023 12:9315603-9315625 CAGGGGCAGGGGCAGGGGCTGGG - Intergenic
1092527026 12:9315609-9315631 GAGGGGCAGGGGCAGGGGCAGGG - Intergenic
1092540243 12:9416163-9416185 GAGGGGCAGGGGCAGGGGCAGGG + Intergenic
1092540249 12:9416175-9416197 CAGGGGCAGGGGCAGGGGCTGGG + Intergenic
1092595865 12:10004104-10004126 GACGGGCAGGTGCAGGAGTTGGG + Intronic
1093425290 12:19021979-19022001 AGGGGGCAGGGGTGGGAGTTTGG - Intergenic
1093653902 12:21674171-21674193 CAGGGGCAGGGGCAGGGCTTAGG - Intronic
1095953138 12:47792160-47792182 GAGGGGCTGGGGCTGGGGTAGGG - Intronic
1096216648 12:49801491-49801513 CAGGGGTAGGGCTGGGTGTTAGG - Intronic
1096238060 12:49943164-49943186 GAGGGGCAGGAAGGGGTGTGAGG + Intergenic
1096504271 12:52082691-52082713 GAAGGGCTGGGGCGGCTGATGGG + Intergenic
1096648430 12:53050288-53050310 GAGGGGCAGGGGTGGAGGTGCGG + Intronic
1096677558 12:53233779-53233801 GTGTGGGAGGGGCGGGTGTCAGG + Intergenic
1096779986 12:53986075-53986097 GGGGGGCAGGGGAGAGGGTTGGG + Intronic
1096981118 12:55728707-55728729 AAGGGGCTGGGGCGGGGGTCGGG - Intronic
1097237020 12:57547100-57547122 GTGGAGCCGGGGCCGGTGTTCGG + Exonic
1097794015 12:63843803-63843825 GCGGAGCAGGGGCGGGAGCTTGG + Intergenic
1098343623 12:69476747-69476769 GAGGGACGGGGGGGGGTGTGGGG + Intronic
1100042388 12:90336115-90336137 GAGGGGTAGAGGGGGGTGTTGGG + Intergenic
1100581293 12:95942847-95942869 CAGGGGCAGGGACGGGAGCTTGG - Exonic
1102040267 12:109796467-109796489 GAGGGGCAGGGCTGGGAGTAGGG - Intronic
1102720519 12:115012365-115012387 GAGAGGAAGGGGCTGGAGTTGGG - Intergenic
1102782551 12:115577861-115577883 AAGAGGCAGGGGCTGGTGATCGG + Intergenic
1103516654 12:121512774-121512796 GAGGAGCAGGAGAGAGTGTTTGG - Intronic
1104197604 12:126555968-126555990 GAGGGGCAGGGGCTACTGTTTGG - Intergenic
1104568645 12:129906153-129906175 CTGGGGCAGGGGCTGGAGTTAGG - Intergenic
1104841417 12:131827946-131827968 GGAGGGCGAGGGCGGGTGTTGGG - Intergenic
1104923146 12:132301515-132301537 GAGGGGCAGGGGCCGACGATGGG - Intronic
1104939848 12:132389993-132390015 GGGGGGCGGGGGCGGGGGTGGGG - Intergenic
1104948776 12:132429407-132429429 GAGGGCCAGGAGCGGGTTTCAGG - Intergenic
1104989827 12:132619101-132619123 GCGGGGCAGGGGCTGGGGCTGGG + Intronic
1104989842 12:132619133-132619155 GCGGGGCAGGGGCTGGGATTGGG + Intronic
1104989894 12:132619251-132619273 GCGGGGCAGGGGCTGGGGCTGGG + Intronic
1104989910 12:132619283-132619305 GCGGGGCAGGGGCTGGGGCTGGG + Intronic
1105281440 13:18965001-18965023 GAGGGGCAGGGGTGCATGTGTGG - Intergenic
1105407213 13:20142518-20142540 GGGGGGCAGGGGCGGGGGATCGG + Exonic
1105705534 13:22965634-22965656 GAGGGCCAGGGGCTGCTGTGTGG + Intergenic
1105858436 13:24390619-24390641 GAGGGCCAGGGGCTGCTGTGTGG + Intergenic
1106407530 13:29486993-29487015 GAGGGGTAGGGGAGGGGGTCAGG + Intronic
1106527253 13:30552074-30552096 GAGGGCCATGGGCAGGGGTTGGG - Intronic
1107787761 13:43971580-43971602 GTGGGGCAGGAGCGGGGGCTGGG - Intergenic
1108574055 13:51776769-51776791 GAAGGGCAGGGGCGGCTTGTGGG - Intronic
1108750122 13:53439869-53439891 GAGGGGGAGGGGTGGGGGATGGG - Intergenic
1109149261 13:58823886-58823908 GCGGGGCAGGCGCGGGTTCTGGG - Intergenic
1109589801 13:64463171-64463193 GATGGACAGGGGCGGGAGTGGGG - Intergenic
1111397229 13:87678645-87678667 GTGGGGCAGGGGCGGGGGAGGGG - Exonic
1111445794 13:88345341-88345363 GAGGGGGCGGTGCGTGTGTTGGG + Intergenic
1112437285 13:99399479-99399501 GAGGGGCTGAGGCGGGTGCCTGG - Intergenic
1113513668 13:110874647-110874669 GATGGGCCGGGGCGGGTGAGGGG - Intergenic
1113552649 13:111205038-111205060 GAGGGGCAGGGGCGGGTGTTGGG + Intronic
1113794525 13:113049336-113049358 GTGGGGAAGGGGTGGGTGGTGGG + Intronic
1113841600 13:113364254-113364276 GAGGGGCAGGAGCGGGGGAGGGG + Intergenic
1113841638 13:113364338-113364360 GAGGGGCAGGAGCGGGTGAGGGG + Intergenic
1113868264 13:113543174-113543196 GAGGGGCAGGGGGAGGAGGTGGG - Intronic
1114317956 14:21524821-21524843 AAGGGGCAGGGGTGGGTTTGTGG + Exonic
1114646661 14:24259883-24259905 GAGGAGCTGGGGTGGGTGTGGGG - Intronic
1115482575 14:33875783-33875805 GAGGGGCATGGATGGGTGTTGGG - Intergenic
1115804645 14:37037098-37037120 CAGAGGCTGGGGCGGGTGTGGGG + Intronic
1116657956 14:47674910-47674932 GAGGAGCAGGGGGCGGTGATGGG + Exonic
1118782431 14:69017811-69017833 GAGAGGCAGGGGAGGGTTGTGGG - Intergenic
1119262203 14:73244546-73244568 GATGGGTAGGGGAGGGTTTTAGG + Intronic
1119381739 14:74233590-74233612 CAGGGGCAGGGGGTGGGGTTAGG - Intergenic
1119424069 14:74524601-74524623 GGGGGCGAGGGGCGGGTGTGGGG - Intronic
1119768619 14:77206238-77206260 GAGGGGCAGGGCAGGGGGCTGGG + Intronic
1121050531 14:90816550-90816572 CTGGGGCAGGGGCGGGGGCTAGG + Intergenic
1121439459 14:93939683-93939705 GAGGGGCGGGCGCGGGTGAGGGG + Intronic
1121449066 14:93996390-93996412 CAGGGGCAGGGGCAGGGGTTTGG - Intergenic
1121467866 14:94127671-94127693 GAGGGGCAGAGGGAGGTGGTTGG - Intergenic
1121617068 14:95320111-95320133 GCGGGGCAGGGGCGGGAGGCTGG + Intergenic
1122124240 14:99570570-99570592 GAGGGTCATGGGAGGGTGTGGGG + Intronic
1122131426 14:99606126-99606148 GATGGTCAGGGGAGGGTGGTGGG + Intergenic
1122135048 14:99627969-99627991 CAGTGGGAGGGGCGGCTGTTAGG + Intergenic
1122206483 14:100150381-100150403 GCGGGGCGGGGGGGGGTGTTGGG - Intronic
1122294522 14:100697829-100697851 GAGGGGTGGGGGAGGGTGGTAGG + Intergenic
1122374062 14:101247081-101247103 GAGGGGCAGGGGCGGCTGGATGG - Intergenic
1122401636 14:101470863-101470885 GAGGGGCAGGGGCTGAGGTGGGG - Intergenic
1123113223 14:105882543-105882565 GAGGGGCAGGGCTGGGTCCTGGG + Intergenic
1123115576 14:105892694-105892716 GAGGGGCAGGGCTGGGTCCTGGG + Intergenic
1123119820 14:105911411-105911433 GAGGGGCAGGGCTGGGTCCTGGG + Intergenic
1202902853 14_GL000194v1_random:53227-53249 GAGGTGCAGGGGGAGGAGTTGGG + Intergenic
1123402559 15:20002979-20003001 GAGGGGCAGGGTTGGGTCCTGGG + Intergenic
1123511897 15:21009633-21009655 GAGGGGCAGGGTTGGGTCCTGGG + Intergenic
1123932346 15:25177935-25177957 GGGGGGCAGGGGCGGGTCTTAGG + Intergenic
1124045957 15:26149818-26149840 GTGGGGGTGGGGCGGGGGTTAGG - Intergenic
1124109512 15:26773102-26773124 GAGGGGGAGGAGCGGGCGCTGGG + Intronic
1124645252 15:31433850-31433872 GAGGGGCAAGAGCGGCTGTGGGG - Intronic
1124696383 15:31867904-31867926 GAGGGGGAGGGGCGGGGGGCGGG + Intronic
1124848242 15:33311559-33311581 GCGGGGCAGGGGGGAGTGTGGGG + Intronic
1125485355 15:40107790-40107812 GAGGGGGAGGGGAAGGTGATAGG - Intronic
1125891965 15:43273717-43273739 GAGGAGGAGGGGAGGGGGTTGGG + Intergenic
1126113387 15:45187992-45188014 GGGGGGCGGGGGCGGGGGTGGGG + Intronic
1127415115 15:58749887-58749909 GACGGGTAGGGGCGGGAGGTAGG - Exonic
1127535522 15:59886586-59886608 GAAAGCCAGGGGAGGGTGTTGGG - Intergenic
1128079082 15:64845497-64845519 GAGGGGCAGGGAAGGGGGCTGGG + Intronic
1128286967 15:66445138-66445160 GAGGGGCAGCGGGGGGAGGTGGG + Intronic
1128519227 15:68364653-68364675 GAGAGGCAGGGGTGGGGGTGGGG - Intronic
1128768381 15:70264891-70264913 GTGGGGCAGGAGCCGGCGTTGGG - Intergenic
1128799895 15:70490617-70490639 GAGGGGCAGCGGCGGGTCCCTGG - Intergenic
1129207437 15:74045372-74045394 CAGGGGCAGGGGCTGGGGTCAGG - Exonic
1129395223 15:75240765-75240787 GTGGGGCAGGGGTGCGTGTCAGG - Intergenic
1130010988 15:80152850-80152872 GAGGGGCAGGGCTCGGGGTTCGG + Exonic
1130358653 15:83159501-83159523 TAGTGGCAGGGGTGGGGGTTTGG + Intronic
1130550912 15:84889389-84889411 GATGGGCAGGGGGTGGTGGTGGG + Intronic
1130926251 15:88387995-88388017 GAGGGGCTGGGGTGAGTGTGTGG - Intergenic
1131108601 15:89750663-89750685 CAGGGGCAGGGGCGCGGGCTGGG - Exonic
1131108604 15:89750669-89750691 GAGGGGCAGGGGCAGGGGCGCGG - Exonic
1131412567 15:92222668-92222690 GGGGGGCAGGGGTGGGGGTGAGG - Intergenic
1131830942 15:96354281-96354303 GAGGGGCGGGGGCGGGAGCCGGG - Intergenic
1131838846 15:96415934-96415956 GAGGGGCGGGGGAGGGTCCTAGG - Intergenic
1131977518 15:97961066-97961088 GAGGCGCGGGGGCAGGTGCTCGG - Exonic
1132206202 15:99987809-99987831 GAGGGGCAGGTGGTGGTGGTGGG + Intronic
1132725286 16:1335765-1335787 GAGGGGCAGGAGCTGCAGTTGGG + Intronic
1132830632 16:1926426-1926448 GCGAGGCAGGGGTGGGGGTTGGG - Intergenic
1132871843 16:2118848-2118870 GCAGGGCAGGGGCAGGTGTTGGG + Intronic
1132885850 16:2181642-2181664 GAGGGGCAGGGGCCGGGCTAGGG + Intronic
1132887112 16:2187125-2187147 GAGGGGCAGTGGCTGGGGCTGGG - Intronic
1132929340 16:2451005-2451027 GAGGGGCCGGGGCAGGTGGAGGG - Intronic
1132951132 16:2563047-2563069 GAGAGACCGGGGCGGGTGCTGGG + Intronic
1132963218 16:2637123-2637145 GAGAGACCGGGGCGGGTGCTGGG - Intergenic
1133002514 16:2858355-2858377 GAAGGGCAGGGGAGGGGGCTTGG + Intergenic
1133246362 16:4451376-4451398 CAGGGGCAGGGGCAGGGGCTGGG + Intronic
1133305042 16:4803117-4803139 GCGGGGCCGGGGTGGGTTTTCGG - Intergenic
1133913303 16:10085626-10085648 GAGGGGCAGAGTCAGGTGGTTGG + Intronic
1134186394 16:12088272-12088294 TCAGAGCAGGGGCGGGTGTTGGG + Intronic
1134401360 16:13913430-13913452 GAGTGGCAGGGGCAGGTTTTAGG - Intergenic
1134520684 16:14918048-14918070 GCGGGGCAGGGGCAGGTGTTGGG - Intronic
1134550891 16:15137926-15137948 GCGGGGCAGGGGCAGGTGTTGGG + Intronic
1134708356 16:16316699-16316721 GCGGGGCAGGGGCAGGTGTTGGG - Intergenic
1134715571 16:16356732-16356754 GCGGGGCAGGGGCAGGTGTTGGG - Intergenic
1134951246 16:18351946-18351968 GCGGGGCAGGGGCAGGTGTTGGG + Intergenic
1134959186 16:18395427-18395449 GCGGGGCAGGGGCAGGTGTTGGG + Intergenic
1135250814 16:20900132-20900154 GAGATGAAGGGGCGGGGGTTGGG - Intronic
1135484551 16:22852627-22852649 GAGGGGAAGGGGCAGGCCTTGGG - Intronic
1135677172 16:24425761-24425783 CAGGGACTGGGGCGGGGGTTGGG - Intergenic
1135721845 16:24824122-24824144 AAGGGGCGGGGGGGGGGGTTGGG - Exonic
1136151923 16:28356707-28356729 GAGGGGCAGGGGAGGGGGAGGGG + Intronic
1136211155 16:28758575-28758597 GAGGGGCAGGGGAGGGGGAGGGG - Intronic
1136255876 16:29038527-29038549 GAGGGGCAGGGGAGGGGGAGGGG - Intergenic
1136709967 16:32228925-32228947 GGGGGGCAGGGGCGGGCGCAGGG + Intergenic
1136757942 16:32700486-32700508 GGGGGGCAGGGGCGGGCGCAGGG - Intergenic
1136810164 16:33169889-33169911 GGGGGGCAGGGGCGGGCGCAGGG + Intergenic
1136816640 16:33279969-33279991 GGGGGGCAGGGGCGGGCGCAGGG + Intronic
1137712154 16:50573857-50573879 GGGGAGCAGGGGCGGGGGTGAGG + Intronic
1138161770 16:54761203-54761225 AAGGGGCAGGGGTGGGGTTTTGG + Intergenic
1138265232 16:55655838-55655860 GATGGGCAGGGGCGGGAGGGTGG - Intronic
1138379347 16:56589597-56589619 GAAGGGCAGGGGCAGGTCTCAGG - Exonic
1138519623 16:57563579-57563601 CAGGGGCTGGGGCTGGTGCTGGG + Intronic
1140870745 16:79104039-79104061 GGGGGGGGGGGGCGGGTGGTGGG + Intronic
1141331815 16:83117781-83117803 GAGGGGCAGGGGAGGGGTTGAGG - Intronic
1141685440 16:85567199-85567221 GAGGGGATGGGGCGGCTGGTGGG + Intergenic
1141949326 16:87330558-87330580 GAGGGGCTGGGGCAGGTGCATGG + Exonic
1142197727 16:88746457-88746479 GAGGGGTAGGGGCTGGGGCTGGG - Intronic
1142265542 16:89062572-89062594 CAGGGGCAGGGGAGGGAGTGAGG + Intergenic
1142290407 16:89191602-89191624 GTGGGGCAGGCTGGGGTGTTGGG + Intronic
1203060093 16_KI270728v1_random:960835-960857 GGGGGGCAGGGGCGGGCGCAGGG - Intergenic
1142582593 17:951558-951580 TGGGGGCGGGGGCGGGGGTTGGG + Intronic
1142614413 17:1126288-1126310 AAGGGGCAGGGGCCGGTTTGTGG - Intronic
1142713556 17:1736249-1736271 GCTGGACAGGGGCGGGGGTTGGG - Intronic
1142744599 17:1949528-1949550 GCAGGGAAGGGGCGGGTCTTCGG - Intronic
1142759393 17:2034465-2034487 GAGGAGCAGGGGAGGGCGATGGG - Intronic
1142885235 17:2908517-2908539 GAGGGGCCGGTGGGGTTGTTTGG + Intronic
1142977823 17:3656095-3656117 GAGGGGCAGGGCAGGGGGTGAGG - Intronic
1142977923 17:3656339-3656361 GAGGGGCAGGGCAGGGTGGGGGG - Intronic
1143166436 17:4899385-4899407 CTGGGGCAGGGGCGGGGCTTAGG + Intronic
1143447887 17:7019604-7019626 GATGGGCTGGGACGGGTTTTGGG - Intergenic
1143448978 17:7024446-7024468 GAGGGGCCGTTGGGGGTGTTGGG - Exonic
1143500577 17:7336504-7336526 GAGGGGCAGGGGCGGGGCCTGGG - Intergenic
1143582640 17:7835674-7835696 GAGGGGCAGCGGCGGAGGCTGGG + Intergenic
1144208042 17:12993081-12993103 GAGGGGCAGGGGTGGGGGACAGG + Intronic
1144322673 17:14145176-14145198 GAGGGGCAGGGAGGGGTGGGTGG + Intronic
1144462472 17:15469085-15469107 GAGGGGGATGGGGGGGAGTTGGG + Intronic
1144570102 17:16392034-16392056 GCGGGGCAGGGGCTGGGGTGGGG + Intergenic
1144659028 17:17056449-17056471 CAGGGGCAGGGGCCGGGGCTGGG + Intronic
1144686937 17:17232273-17232295 GCAGGGCAGGGGAGGGTGTCGGG - Intronic
1144759844 17:17701072-17701094 GAGGCGCAGGGGTGGGTTTCAGG - Intronic
1144852156 17:18249254-18249276 GGGGTGGAGGGGAGGGTGTTGGG - Intronic
1144950171 17:18989649-18989671 GGGGGGCTGGGGCGGGGGCTCGG + Intronic
1146308549 17:31749713-31749735 GAGGGCCAGGGGCAGGCTTTGGG + Intergenic
1146605080 17:34251122-34251144 GAGGGGGATGGGCAGGTCTTAGG - Intergenic
1146955048 17:36932635-36932657 GGGGGGCAGGGGCGTGGGGTGGG - Intergenic
1147387981 17:40092837-40092859 GAGGGCCAGGGGAGGGTTGTGGG + Exonic
1147441196 17:40448217-40448239 GAGGGCCAGGGGCTGGCGTTGGG + Intronic
1147746620 17:42698835-42698857 CAGGGGCTGGGGCTGGAGTTGGG - Exonic
1147967280 17:44199986-44200008 GAGGGGGAGGGCGGGGTGTTGGG - Intronic
1147969320 17:44211118-44211140 GAGGAGCAGCAGCGGGTCTTGGG - Exonic
1148126730 17:45241231-45241253 GTGAGGCTGGGGCGGGTGGTAGG + Intronic
1148438285 17:47698693-47698715 GAGGGGCGGGGGCTGGCGGTGGG - Exonic
1148614668 17:48991215-48991237 GAGGGGCAGGGGCAGGGGGAGGG + Intergenic
1148731499 17:49839596-49839618 GAGGGGCAGGGGTGGGGGCAGGG + Intronic
1149849921 17:60028244-60028266 GAGGGGCAGGGCTGGGGTTTGGG + Intergenic
1149860247 17:60118280-60118302 GAGGGGCAGGGCTGGGGTTTGGG - Intergenic
1149915265 17:60602443-60602465 GACGGGCAGGGGCGGGGGACGGG + Intronic
1150137263 17:62702921-62702943 CAGGAACAGGGGCGGGTGTGAGG - Intronic
1150343147 17:64385020-64385042 GAGGTGCATGGGTGGGTGTTAGG + Intronic
1150833065 17:68541019-68541041 GGGGGGCAGGGGGAGGTGTGGGG - Intronic
1151454031 17:74215461-74215483 GAGGGGCAGAGGCTGGAGGTAGG - Intronic
1151495103 17:74454140-74454162 CAGGGGCCGGGGCGGGGCTTGGG - Intergenic
1151780090 17:76240094-76240116 GAGGGGCAGGGGCAGGGGTCTGG - Intronic
1152376124 17:79919875-79919897 GAGGGGCATGGACAGGTGTGAGG + Intergenic
1152378757 17:79931455-79931477 TGGGGGCTGGGGAGGGTGTTGGG - Intergenic
1152476674 17:80522877-80522899 GAGGTGCAGGGGAGGGAGTAGGG + Intergenic
1152505694 17:80748178-80748200 GAGGGGCTGCGGTGTGTGTTTGG + Intronic
1152505711 17:80748233-80748255 GAGGGGCTGCGGTGTGTGTTTGG + Intronic
1152505815 17:80748559-80748581 GAGGGGCTGCGGTGTGTGTTTGG + Intronic
1152505854 17:80748720-80748742 GAGGGGCTGCGGTGTGTGTTTGG + Intronic
1152505885 17:80748830-80748852 GAGGGGCTGCGGTGTGTGTTTGG + Intronic
1152505901 17:80748885-80748907 GAGGGGCTGCGGTGTGTGTTTGG + Intronic
1152505918 17:80748940-80748962 GAGGGGCTGCGGTGTGTGTTTGG + Intronic
1152505935 17:80748995-80749017 GAGGGGCTGCGGTGTGTGTTTGG + Intronic
1152505961 17:80749101-80749123 GAGGGGCTGCGGTGTGTGTTTGG + Intronic
1152505978 17:80749156-80749178 GAGGGGCTGCGGTGTGTGTTTGG + Intronic
1152506005 17:80749262-80749284 GAGGGGCTGCGGTGTGTGTTTGG + Intronic
1152506021 17:80749317-80749339 GAGGGGCTGCGGTGTGTGTTTGG + Intronic
1152506065 17:80749478-80749500 GAGGGGCTGCGGTGTGTGTTTGG + Intronic
1152506081 17:80749533-80749555 GAGGGGCTGCGGTGTGTGTTTGG + Intronic
1152506096 17:80749588-80749610 GAGGGGCTGCGGTGTGTGTTTGG + Intronic
1152552096 17:81035023-81035045 GCCGGGCGGGGGCGGGTGGTCGG + Intergenic
1152597019 17:81242664-81242686 GAGGGGGAGGGGAGGTTGTGGGG + Intergenic
1152625579 17:81386672-81386694 GAGGGGCGGAGGCGGGGGTAGGG + Intergenic
1152748414 17:82051637-82051659 GCGGGGCCGGGGCGGGGGTCCGG + Exonic
1152821822 17:82441363-82441385 GAGGGGCAGGTGCAGGTGAGCGG + Intronic
1152821839 17:82441409-82441431 GAGGGGCAGGTGTGGGTGGGAGG + Intronic
1152932971 17:83119923-83119945 GAGGGGCTGGGGCGGGGCTTGGG + Intergenic
1152945068 17:83193682-83193704 GAGGGCCAGGGGAGGGGGTGTGG - Intergenic
1153457536 18:5296286-5296308 GCGGGGCAAGGGCGGGGCTTCGG + Intronic
1154360701 18:13658072-13658094 GAAGGGCAGGAGAGGGTGTGGGG - Intergenic
1155064775 18:22258834-22258856 GGGCGGCAGGGGCGGGGGGTGGG - Intergenic
1155164230 18:23219609-23219631 GAGGGGCAGGGGAGAGGGCTGGG + Intronic
1155380043 18:25210757-25210779 GAGGGGCAGAGGCTGGGCTTTGG - Intronic
1155388620 18:25308656-25308678 GAGGGGCTGTGGCGGGTGGGGGG - Intronic
1156334936 18:36161810-36161832 GTGGGGTAGGGGTGGGTGTAGGG - Intronic
1156476714 18:37410169-37410191 GGGAGGCAGGGGCGGGGGTAGGG - Intronic
1158400412 18:57116619-57116641 TAGGGGCTGGGGCGGGGGTCGGG + Intergenic
1158599339 18:58843757-58843779 GAGTGGCAGGGGCGGGGGAGTGG - Intergenic
1158823256 18:61185443-61185465 GAGGTGCAGTGGCTGGAGTTTGG - Intergenic
1158893595 18:61894331-61894353 GAAGGGCCGGGCCGGGTGCTGGG - Intergenic
1158952489 18:62507062-62507084 TGGGGGCAGGGGCGGGGGTGGGG + Intergenic
1159611704 18:70532982-70533004 GAGGCCCAGGTGAGGGTGTTTGG + Intergenic
1160080754 18:75725214-75725236 GTGGGGCGGGGGCGGGGGGTGGG - Intergenic
1160095295 18:75866223-75866245 GAGAGACAGGGGCTGGTGTAGGG + Intergenic
1160286398 18:77547433-77547455 CAGGGGCAGGGGTTGGTGTTGGG - Intergenic
1160544461 18:79643476-79643498 GAGGGGCTGAGGGGGGTCTTTGG - Intergenic
1160544562 18:79644128-79644150 GAGGGGCGGAGGCAGGTGTCCGG + Intergenic
1160770165 19:827608-827630 CAGGGGCAGGTGAGGGTGTCAGG - Intronic
1160793063 19:931869-931891 GAGGGGCAGTGGCGAGGGTGGGG + Intronic
1160828099 19:1090003-1090025 GGGGGGCAGGGGTGTGTGTGGGG + Intronic
1160849001 19:1180701-1180723 GAGGGGAAGGGGCGGGTCCCAGG - Intronic
1160916061 19:1497303-1497325 GACTGGCAGGGGCTGCTGTTGGG - Exonic
1160975377 19:1790180-1790202 GAGGGGCAGGGGTGGGGGAGTGG - Intronic
1160989918 19:1856272-1856294 GAGGGGCACGGGAGGGTGGAGGG + Intronic
1161164373 19:2778214-2778236 GGGGGGCAGGGGTGTGTGTGTGG + Intronic
1161221603 19:3120482-3120504 GAGGGGCAGGGGTGGCCGGTGGG + Intronic
1161253796 19:3295213-3295235 CTGGGGCAGGGGCGGGGGTGGGG + Intronic
1161266366 19:3366528-3366550 GCGGGGCGGGGGGGGGGGTTGGG + Intronic
1161442873 19:4302392-4302414 GAGGGGGAGAGGGGGGTGATGGG - Exonic
1161627685 19:5336790-5336812 GTGGGGCGGCGGCGGGTGGTGGG + Intronic
1161773438 19:6243647-6243669 GCGGGGCTGGGGCGAGTGTGAGG - Intronic
1161782000 19:6299026-6299048 CAGGAGCAGGGGAGGGTGCTGGG + Intergenic
1161787893 19:6339451-6339473 GAGGGGCTGGGGAGGGGGATAGG + Intergenic
1161802837 19:6425379-6425401 GAGCGACATGGGTGGGTGTTCGG + Intergenic
1161943864 19:7422338-7422360 GGGGGGCATGGGCGGGAGCTGGG - Intronic
1162034270 19:7930964-7930986 AAGGGGCAGGGGGGGATGTCAGG + Intronic
1162035033 19:7934020-7934042 GCGGGGCTGGGGTGGGTGTCTGG + Intronic
1162422330 19:10572914-10572936 GTGAGGAAGGGGCGGGTGCTGGG + Exonic
1162497864 19:11033523-11033545 GAGGGGTCGGGGCCGGTGCTGGG - Intronic
1162555777 19:11384441-11384463 TGGGGGCAGGGGAGGGAGTTGGG + Intronic
1162625597 19:11882137-11882159 GAGGGGAAGGGTTGGGTATTAGG - Intronic
1162805514 19:13136178-13136200 GAGGAGCAGGGGTGGCTGGTGGG - Intronic
1162849759 19:13421878-13421900 GAGGGTCAGGAGAGGGTTTTTGG + Intronic
1162965926 19:14156059-14156081 GTGGGGCGGGGGTGGGTGATGGG + Intronic
1163434229 19:17285632-17285654 CATGGGCAGGGGAGGGTATTGGG + Intronic
1163722742 19:18905977-18905999 CAGGTGCAGGGGCGGGTGCGTGG - Intronic
1163727906 19:18932881-18932903 GCGTGGCAGGGGCGGGGGTAGGG - Intronic
1163806750 19:19404116-19404138 GGGGGGCAGGGCGGTGTGTTTGG + Intronic
1164218278 19:23170724-23170746 GAAGGGCATGGGGGGGTGTCTGG - Intergenic
1164623924 19:29714678-29714700 GTGGGGCAGGGGCGGGGCTGGGG - Intronic
1164670764 19:30070770-30070792 GAGTGGCAGGGGCAGGGGTGTGG - Intergenic
1164733004 19:30520050-30520072 GTGGGCCTGGGGCTGGTGTTTGG + Intronic
1165171456 19:33894852-33894874 GAAGGGCAGGGGCGTGTGCACGG - Intergenic
1165313369 19:35041281-35041303 GAGAGGCTGGGGCTGGGGTTGGG + Intronic
1165772404 19:38387037-38387059 GAGGGGCAGGGTCGAGGGTGAGG + Exonic
1165793816 19:38507243-38507265 GAGGGGCGGGGACCGGTGATTGG + Intronic
1165843801 19:38805422-38805444 GAGGGGCAGGGGCTGGGATATGG - Intronic
1165850815 19:38849553-38849575 GTGGGGGAGGGGCGGCCGTTGGG - Intronic
1165952189 19:39480753-39480775 GCGGGGGAGGGGCGGGTGGACGG - Exonic
1166069118 19:40377274-40377296 GAGGGGTCGGGGCTGGGGTTGGG + Intronic
1166072082 19:40393707-40393729 GAGGGGCAGGAGTGGGTATAGGG - Intergenic
1166123378 19:40699362-40699384 GAGGGGTGGGGGCTGGAGTTGGG - Intronic
1166214727 19:41327676-41327698 CAGGGGCAGGGCAGGGGGTTTGG - Intronic
1166302830 19:41921959-41921981 GTGGGGAAGGGGTGGGAGTTGGG - Intronic
1166669923 19:44703705-44703727 CTGGGGCAGAGGCGGGTGTTGGG - Intronic
1166935752 19:46331356-46331378 GAGGGGCAGGGGCTGGTTGAGGG + Intronic
1166948704 19:46412601-46412623 GGGGGGCTGGGGCGGGTGCGGGG + Exonic
1166961043 19:46495945-46495967 GGGGGACAGGGGAGGGTGTGCGG - Exonic
1167015482 19:46838413-46838435 GAGGGGCCGGGGCCGGGGTGGGG + Exonic
1167098901 19:47391856-47391878 GGAGGGGAGGGGCTGGTGTTAGG + Intergenic
1167103272 19:47416945-47416967 GAGGGGGAAGAGCGGGTGTCTGG + Exonic
1167348382 19:48960953-48960975 GTGGGGCAGGGGCGGTGGTGAGG - Exonic
1167420098 19:49397726-49397748 GAGGGTCAGGGAGGGGTGTGAGG - Intronic
1167509746 19:49889779-49889801 GAGGGGCAGGGGCATGTGCATGG - Exonic
1167602899 19:50464946-50464968 GAGAGGCAGGGGCAGGTGGGTGG - Intronic
1167618591 19:50549333-50549355 AAGGGGACCGGGCGGGTGTTGGG - Intronic
1167643598 19:50694774-50694796 GAGGGGAAGGGGCGGGTTGGGGG + Intronic
1167660773 19:50794821-50794843 GAGAGGCAGGGGCAGGTGGGCGG - Exonic
1167944741 19:52979023-52979045 GAGGGGCTGGGGCAAGTGTGAGG - Intergenic
1168323080 19:55521796-55521818 GAGGTGGAGGGGGGGCTGTTGGG + Intergenic
1168332994 19:55580504-55580526 GAGGGGCTGGGGAGGGGGCTGGG + Intronic
1168618317 19:57856018-57856040 GATGGGCAAGGGTGGGTGTGTGG + Intronic
925049139 2:797615-797637 GAGGGGCAGGGGCAGAAGCTGGG + Intergenic
925251772 2:2445012-2445034 CAGCTGCAGGGGCGGGTGCTTGG + Intergenic
925929294 2:8694173-8694195 GGGGGGCAGGGGAGGGGGCTGGG + Intergenic
926227517 2:10978791-10978813 GAGGGGCAGGAGGGAGGGTTGGG + Intergenic
926683614 2:15681189-15681211 GAGGGGGAGGGGAGGGGGTGGGG + Intergenic
927022194 2:19029003-19029025 GAGGGGCGGGGGCGGGGGGCGGG - Intergenic
927110540 2:19861193-19861215 TAGGGGCTGGGGTGGGTGTGGGG - Intergenic
927148717 2:20183671-20183693 CAGGGGGAGAGGCTGGTGTTTGG + Intergenic
927515685 2:23670404-23670426 GATGGGCAGGGGGGTGTGCTGGG + Intronic
927516372 2:23674229-23674251 CGGGGGGAGGGGCGGGTGTTGGG - Intronic
927810771 2:26179192-26179214 CAGGGCCAGGGGCGGGGGCTGGG - Intronic
927810957 2:26179912-26179934 TTGGGGCAGGGGCGGGGGTGGGG + Intronic
927904654 2:26848077-26848099 GCGGGGGAGGGGCGCGTGTCGGG - Intronic
927937308 2:27083093-27083115 GAGGGGCAGCTGCGGCTGGTGGG + Exonic
927956000 2:27207702-27207724 GTAGGGCAGGGGCGGATGTGTGG + Exonic
928020715 2:27702607-27702629 GAGGGACAAGGGCAGGTGTGGGG - Intergenic
928353196 2:30582195-30582217 GGGGGGCAGGGGCAGGGGTGAGG - Intronic
928515327 2:32039562-32039584 GAGGGGCGGGGTCGGGGGCTGGG - Intronic
929189259 2:39124274-39124296 GAGGGGCTGGCGCGGGGGATTGG - Intronic
932476476 2:72009368-72009390 CAGGGGCAGGGGCGGGGGCGGGG + Intergenic
933226196 2:79752051-79752073 CAGGGGCAGGGGAGAGTGTACGG + Intronic
933512726 2:83261760-83261782 GCGGGGCAGGGGGTGGTGGTGGG + Intergenic
933673903 2:85036015-85036037 CAGGGGTAGGGGCAGGTGTTTGG + Intronic
933779980 2:85794795-85794817 GAAGGGCAGGGGCAGTTGTTCGG - Intergenic
934503806 2:94877167-94877189 GAGGTGCAGGGGGAGGAGTTGGG - Intergenic
934750362 2:96789935-96789957 GAGGGCCGGGGGCGGGGGGTGGG - Intronic
934758830 2:96842336-96842358 GAGGGGCGGGGGCCGGGGTTGGG - Intronic
934855058 2:97724485-97724507 GAGGGGCAGTCGAGGGTTTTGGG + Intronic
937017435 2:118618873-118618895 GAGGGGCAGGGGCTGGGGTCAGG - Intergenic
937301892 2:120847749-120847771 GGGGGGCAGGGGCGGGGGGGCGG + Intronic
937331394 2:121032495-121032517 GAGGAGGAGGAGCGGGTGCTAGG - Intergenic
938328267 2:130428688-130428710 GGGGCTGAGGGGCGGGTGTTGGG - Intergenic
938361680 2:130692806-130692828 GGGGCTGAGGGGCGGGTGTTGGG + Intergenic
938572101 2:132570269-132570291 GAGGGGTAGTGGGGGGTGTGGGG - Intronic
939365966 2:141231604-141231626 GCGGGGCAGGGGTGGGGGTGGGG - Intronic
939622776 2:144440679-144440701 GAGGGGCAGGAGTGGGTGGCTGG + Intronic
940102321 2:150055413-150055435 AAGCGGCAGGGGCGGGTGTTGGG - Intergenic
940640537 2:156341644-156341666 GAGGGGCTGGCGCGGATTTTAGG - Intronic
941038179 2:160590486-160590508 GAGGGGGAGGGGAGGGTGAAGGG - Intergenic
941060566 2:160842511-160842533 GAGGGGCGGGGGTGGGTGGGAGG - Intergenic
941156101 2:161980243-161980265 GGAGTGCAGGGGTGGGTGTTGGG - Intronic
941637013 2:167945760-167945782 GAGAGGCAGGGTCAGGTGGTTGG - Intergenic
942076359 2:172360180-172360202 GAAGGGCAGGGGGTGGTGGTGGG - Intergenic
942678466 2:178451697-178451719 GCGGGAGAGGAGCGGGTGTTTGG - Exonic
942726129 2:179009661-179009683 GAGTGGCAGGGGTGGGGGGTGGG + Intronic
942911030 2:181244784-181244806 CAGGGCCAGGGGCGGGGGTTGGG - Intergenic
943649470 2:190441471-190441493 AAGGAGGAGGGGCGGGGGTTGGG + Intronic
944822011 2:203440888-203440910 GAGGAGGTGGGGGGGGTGTTGGG + Exonic
945050782 2:205822170-205822192 CATGGGCAGGGGTTGGTGTTGGG - Intergenic
946025249 2:216668040-216668062 TATGTGCAGGTGCGGGTGTTGGG + Intergenic
946322269 2:218960943-218960965 CAGGGGCTGGGGCGGGGGATGGG - Exonic
947590840 2:231384250-231384272 GAGGGGCAGGGGCAGGGGCAGGG - Intergenic
947720681 2:232367787-232367809 AAGGGCCAGGGGCGGGAGCTGGG - Intergenic
947834561 2:233166211-233166233 GCGGGGCAGGGGCTGGTGGGAGG - Intronic
948683795 2:239658260-239658282 GAGGGGACGGGGCGGGGGTCGGG - Intergenic
948753089 2:240143763-240143785 GCGGGGCAGGGGCAGGAGCTGGG - Intronic
948844410 2:240676360-240676382 GAGGGGCAGGCAAGGGTGTGCGG - Intergenic
948849450 2:240698519-240698541 GAGGGGCAGGCAAGGGTGTGCGG + Intergenic
948936352 2:241167487-241167509 GTGTGGCAGGGGCTGGGGTTGGG + Intronic
1168842024 20:915759-915781 GAGGGGCAGGGGTGGGTCTGAGG - Intronic
1169194225 20:3674704-3674726 GAGGGGTAGGAGCGGGTGTGAGG + Intronic
1170428711 20:16258961-16258983 GATGGGAAGGGGTGTGTGTTTGG - Intergenic
1170569704 20:17625781-17625803 CGGGGGGAGGGGAGGGTGTTGGG - Intronic
1170975408 20:21159507-21159529 GAAGGGCTGGGGTGGGTGGTGGG - Intronic
1171122605 20:22579495-22579517 GGGGGGCAGTGGCGGGTGGGAGG + Intergenic
1171360969 20:24586119-24586141 GAGGAGCAGGGGAGAGTGGTGGG + Intronic
1171401575 20:24875941-24875963 CAGGGGCTGGGGTGGGTGTGAGG - Intergenic
1171523829 20:25794752-25794774 CTGGGGCAGGGGCTGGGGTTGGG - Intronic
1171531558 20:25856711-25856733 CTGGGGCTGGGGCTGGTGTTGGG - Intronic
1171552998 20:26061131-26061153 CTGGGGCAGGGGCTGGGGTTGGG + Intergenic
1172037013 20:32018190-32018212 GAGGGGCGGGGGCGGGGGCGGGG + Intronic
1172037028 20:32018213-32018235 GAGGGGCGGGGGCGGGGGCGGGG + Intronic
1172109406 20:32536481-32536503 GGGGGGCAGGGGCGGGGGCGAGG + Intronic
1172284415 20:33731153-33731175 GAGTGGCTGGGGTGGGTGTTGGG + Intergenic
1172993439 20:39052405-39052427 GAGGGGCAGGGGCAGGGGCGGGG + Intergenic
1173105270 20:40127686-40127708 AAGGGGCAGTGGGGGGTGATTGG - Intergenic
1174449972 20:50613787-50613809 GAGGGGCAGGTGCTGGAGCTGGG + Intronic
1175153130 20:56950971-56950993 GAGGGGGAGGGGAGGGGGATGGG + Intergenic
1175371798 20:58497230-58497252 GAGGGGCAGATGCGGGTTTCAGG + Intronic
1175486612 20:59351451-59351473 CAGGGACAGGGGTGGGTGTGGGG - Intergenic
1175623272 20:60468708-60468730 GAGGGGCAGCGCCGGAGGTTGGG - Intergenic
1175858311 20:62134652-62134674 GGGGGGCAGGGGTGGGTGGGTGG + Exonic
1175865301 20:62172831-62172853 CAGGGGCAGGGGTGGGCGCTGGG - Intronic
1175865333 20:62172948-62172970 CAGGGGCAGGGGTGGGCGCTGGG - Intronic
1175931926 20:62497577-62497599 GTGGGGGATGGGTGGGTGTTGGG + Intergenic
1175933330 20:62503624-62503646 GAGGGGAAGGGGAGGCTGGTGGG + Intergenic
1175941376 20:62539015-62539037 GCGGGGCAGGGGTGGGGGCTGGG - Intergenic
1175941392 20:62539052-62539074 GCGGGGCAGGGGTGGGGGCTGGG - Intergenic
1176090443 20:63316180-63316202 GGGGGGCAGGGGCGAGAGGTGGG + Intronic
1176122710 20:63461417-63461439 ATGGGGAAGGGGCTGGTGTTTGG - Intronic
1176245013 20:64093325-64093347 GAGGCGCAGGGGCTGGAGCTCGG + Intronic
1178640028 21:34338067-34338089 GAGGGGAAGGGACGTGGGTTGGG + Intergenic
1178860763 21:36287136-36287158 GAGAAGCAGGGGAGAGTGTTAGG + Intronic
1178900054 21:36591507-36591529 GAGGGGTAGGGGCCGGGGTCTGG - Intergenic
1179209305 21:39312773-39312795 GAGGGGAAGGGGCGGGGGCGGGG + Intronic
1179564621 21:42239587-42239609 GAGGGGCAAGGGGAGGTGTAGGG + Intronic
1179626771 21:42653545-42653567 GAGGGGGAGGGGCGGGCGGGCGG + Intergenic
1179789817 21:43749816-43749838 GAGGGGAAGAGGAGTGTGTTGGG + Intronic
1179926006 21:44534232-44534254 GAGGGGGCGGGGCTGGTGTGGGG + Intronic
1180002633 21:45002152-45002174 GGGGGGCTGGGGAGGGGGTTGGG + Intergenic
1180064471 21:45405553-45405575 GAGCGGCCGGGGCGGGGGTGAGG - Intronic
1180727222 22:17955355-17955377 GATGGGTAAGAGCGGGTGTTGGG - Intronic
1180755064 22:18155526-18155548 GAGAGGCAGGGGCGGGAACTGGG + Intronic
1180891453 22:19291808-19291830 GCGGGGCAGGGGCGGGGGAAGGG - Intergenic
1181034818 22:20164814-20164836 GAGGGGCAGGGGCAGGAGAAGGG + Intergenic
1181432327 22:22888907-22888929 GAGGGGCACTGGCTGGTGATGGG + Intronic
1181457696 22:23069157-23069179 GAGGGGCAGGGGCATGTGCCTGG - Intronic
1181458675 22:23073570-23073592 GTGTGGCAGGGGCTGGTGTGGGG - Intronic
1181508999 22:23380545-23380567 GAGGGGCAGGGGCAGGAGGAGGG - Intergenic
1181692409 22:24571399-24571421 GAGGGGCAGGGGCTGGGGACTGG - Intronic
1181782410 22:25202610-25202632 GAGGGGCAGAGGCTGGAGCTGGG + Intronic
1181851558 22:25753220-25753242 GGTCGGCAGGGGCGGGTGTGGGG + Intronic
1182226103 22:28800225-28800247 CAGGGGCAGGGGCAGGGGCTGGG - Intronic
1182249928 22:28992167-28992189 GCGGGGCCGGGGCGGGGGGTTGG - Intronic
1182269636 22:29145324-29145346 GAGAGGCAGGGGAGGGGCTTCGG + Intronic
1182431722 22:30302709-30302731 GCTGGGCAGGGGCAGGTCTTGGG + Intronic
1182788928 22:32932562-32932584 GAGGGGCAGGGGCAAGAGATGGG + Intronic
1182972150 22:34589047-34589069 GAGGGGGAGGGGGGGTTGCTGGG + Intergenic
1183160564 22:36110413-36110435 GACGGGCAGAGACGGGGGTTGGG + Intergenic
1183197758 22:36365097-36365119 ATGGGGGAGGGGCTGGTGTTCGG - Intronic
1183590881 22:38778787-38778809 GAGAGCCAGGGGCTGGTGTGTGG - Exonic
1184254679 22:43280387-43280409 GAGGGGAAGGGACGGGGGATGGG - Intronic
1184347745 22:43923879-43923901 GCGGGGCGGGGGCGCGGGTTAGG - Exonic
1184358996 22:44002528-44002550 GAGGGGCAGAGGCGGGTGCGTGG + Intronic
1184392507 22:44212650-44212672 GTGGGGCAGGGATGGGGGTTGGG - Intronic
1184565906 22:45292099-45292121 GAGGGGCAGAGGCGGGGCTTGGG - Intronic
1184641795 22:45876844-45876866 GCGGGGCAGGGGTGGGAGTGAGG - Intergenic
1184645020 22:45890862-45890884 GCGGGGCAGGGAGGTGTGTTGGG + Intergenic
1184864678 22:47195616-47195638 GAGGAGGAGGGGCCGGAGTTAGG - Intergenic
1184968561 22:47998854-47998876 CAGGGGCTGGGGCTGGGGTTGGG - Intergenic
1185143591 22:49117278-49117300 CAGGGGCAGGGGCAGGGGTCGGG + Intergenic
1185380793 22:50506720-50506742 TAGAGGCAGGGGTGGGTGGTGGG + Intronic
949868925 3:8570464-8570486 GAAAGGCAGGGGCAGGTGCTGGG - Intergenic
950138555 3:10600096-10600118 GAGGGGCTGGGGCTGGTGGGGGG + Intronic
950438494 3:12994162-12994184 GGGGGGCGGGGGCGGGCGCTCGG + Intronic
950497604 3:13343320-13343342 GAGGTGGAGGGGTGGGTGGTGGG + Intronic
951545698 3:23822840-23822862 GAAGGGCGGTGGCGGGGGTTGGG - Intronic
953294806 3:41704311-41704333 GAGGGGCAGGGGTGGGAGATGGG + Intronic
953820075 3:46200467-46200489 GAGGGGCAGGGGAGGCAGTCAGG + Intronic
953974690 3:47373332-47373354 GAGGGGCAGGGGATGGTTTCAGG - Intergenic
954298324 3:49686283-49686305 GGGGGGGGGGGGCGGGCGTTGGG - Intronic
954334672 3:49909347-49909369 GAGGAGCAGGAGCGGCTGCTGGG - Exonic
954388888 3:50258713-50258735 CTGGGGCAGGGGCTGGTGTTGGG - Exonic
954391041 3:50267998-50268020 GAGGGCCAGGGGGAGGTGTCTGG + Intronic
954405107 3:50341151-50341173 GAGGGCCAGGGCCGGATGTGGGG - Exonic
954693986 3:52410494-52410516 AAGGGGCGGGGGCGGGTGTTGGG + Intergenic
954712443 3:52511901-52511923 GCTGGGCAGGGGCGGGTGAAGGG - Intronic
954712525 3:52512232-52512254 AAGGGGCAGGGGCTGGGGCTGGG + Intronic
955318715 3:57959296-57959318 GTGGTGCAGGGCCTGGTGTTTGG - Intergenic
955818487 3:62873535-62873557 GAGGGGCAGTGGCGGGGGGTGGG - Intronic
957082739 3:75650363-75650385 GAGGGGAAGGGGCCTGTGCTTGG - Intergenic
957458504 3:80486202-80486224 CAGGGGCAGAGGCAGGTGTATGG - Intergenic
959386445 3:105714292-105714314 GAGGGGAAGGGGATGGTTTTGGG + Intronic
959566093 3:107834543-107834565 GAGGGGCAGGGGGCGGAGTGAGG + Intergenic
961075181 3:123975648-123975670 AAGGGGCGGGAGGGGGTGTTAGG + Intronic
961308514 3:125976874-125976896 AAGGGGCGGGAGGGGGTGTTAGG - Intronic
961331378 3:126142840-126142862 CACGGGCAGGGTCGGGGGTTGGG + Intronic
961370042 3:126423425-126423447 GAGGGGCAGGGGTGGGGGCAGGG - Intronic
961458584 3:127036333-127036355 GAGTAGCATGGGCGGGTGGTGGG + Exonic
961771002 3:129249843-129249865 GAGGGGCAGGGGCTTGTGCCAGG + Intronic
962102368 3:132356346-132356368 GGGAGGCAGGTGGGGGTGTTGGG - Intronic
962407664 3:135113813-135113835 GAGGGGCAGGGGCATGGGTCAGG - Intronic
962738632 3:138347493-138347515 GAGGGGCAGGGGAGGGGAGTGGG + Intergenic
963017450 3:140839569-140839591 GAGGGGCTGGGGCTGGGGTAGGG - Intergenic
963742984 3:149097973-149097995 GAGGGGGAGGGGAGGGGGTAGGG + Intergenic
964554257 3:157918359-157918381 GAGGGGCAGGGGAGGGAGAAAGG - Intergenic
964627924 3:158776793-158776815 GAGGGGCAGTTGTGGCTGTTAGG + Intronic
965404147 3:168249579-168249601 GAGGGGCTGGGGCGGGAGGGCGG + Intergenic
966172241 3:177095206-177095228 TAGGGGGAGAGGGGGGTGTTGGG + Intronic
966267998 3:178069954-178069976 CAGGGGCTGGGAAGGGTGTTGGG + Intergenic
966876282 3:184323704-184323726 GAGGGACAGGAGAGGGTGGTGGG - Intronic
967299664 3:188000568-188000590 AAGGGGCAGGTGGGGGTGTTTGG + Intergenic
967525348 3:190486508-190486530 GAGGGGAGGGGCCGGGTGTGGGG + Intergenic
968298643 3:197596534-197596556 CAGGGGCAGGGGCTGGCGTGAGG + Intergenic
968521676 4:1037154-1037176 GAGGGGCAGTGGGGCCTGTTGGG + Intergenic
968548538 4:1210750-1210772 GAGGGGCTGCAGCGGGTGCTGGG - Intergenic
968562994 4:1294820-1294842 CAGGGGCAGGGGCGGGGGTGGGG + Intronic
968700915 4:2058205-2058227 GAGGGGCAGGGGACGGGGTGGGG - Intergenic
968761786 4:2446082-2446104 GAGGGGAAGGGGATGGTGCTGGG + Intronic
969185220 4:5469527-5469549 ATGGGGCAGGGATGGGTGTTTGG + Intronic
969525237 4:7700880-7700902 AAGGGGCAGGGGTTGGTGTCTGG + Intronic
969662871 4:8540577-8540599 GTGGGGCAGGGGCGGGGCCTGGG + Intergenic
969692491 4:8711327-8711349 GGGGGGCAGGGTGGGGTCTTGGG - Intergenic
969715467 4:8866119-8866141 GATGGGCCGGGGCGGGGGCTGGG + Intronic
970141648 4:12989342-12989364 GGGGGGCAGGGGGTGGTGGTGGG + Intergenic
970444978 4:16115998-16116020 AAGGGGAAGGTGTGGGTGTTGGG - Intergenic
972759861 4:42092590-42092612 GCGGGGCGGGGGGCGGTGTTTGG + Intergenic
973531875 4:51843441-51843463 GTGGGGCGGGGGCGGGCGTGGGG + Intronic
973607141 4:52599255-52599277 GAGGGGTAGGGGTGGGGGTCAGG + Intronic
973907429 4:55546273-55546295 GCGGGGCAGGGGCGGGAGTGGGG - Intronic
974626544 4:64433323-64433345 GAGGGGGAGGGGCAGGAGCTTGG + Intergenic
975701916 4:77075447-77075469 GAGGGGCGGGGGCGGGGGCGGGG - Intronic
978042349 4:104083783-104083805 GAGGGGAAGGGGTGAGTTTTGGG - Intergenic
978970912 4:114805192-114805214 GAGTGGCAGGGGCAGGGGTTGGG + Intergenic
979796562 4:124853937-124853959 GAGGGGGGGGGGTGGATGTTGGG - Intergenic
979797165 4:124860636-124860658 GTGTGGCAGGGGTGTGTGTTGGG + Intergenic
979968560 4:127106446-127106468 GACGGGCAGGGGAGGGGGGTGGG + Intergenic
980480445 4:133380266-133380288 GAGGGGCAGGTGCGGGAACTGGG - Intergenic
981492415 4:145353652-145353674 GAGGGGCAGGGGATGGTTTCAGG - Intergenic
981550568 4:145937652-145937674 GAGCGGCTGGGGAGGGTGTAGGG - Intronic
982042383 4:151409092-151409114 GCGGGGCAGGGGCGGGGGTGGGG - Intergenic
985449507 4:190052157-190052179 GTGGGGCAGGGGCCGGGGTGGGG - Intergenic
985575530 5:671850-671872 GAGGGACAGGGTTGGGTGTGGGG + Intronic
985588115 5:751308-751330 GGGGCGCAGGGGCAGGTGTGGGG + Intronic
985588137 5:751357-751379 GGTGGGCAGGGGCGGGCGTGGGG + Intronic
985602785 5:843775-843797 GGGGCGCAGGGGCAGGTGTGGGG + Intronic
985602808 5:843824-843846 GGTGGGCAGGGGCGGGCGTGGGG + Intronic
985790928 5:1926495-1926517 GCGGGGCAGGGGCAGGTGCAGGG - Intergenic
985790950 5:1926559-1926581 GCGGGGCAGGGGCAGGTGCAGGG - Intergenic
985790972 5:1926623-1926645 CAGGGGCAGGGGCAGGTGCAGGG - Intergenic
986438545 5:7758801-7758823 GAGGGGCAAGGGCAGGTGGGCGG + Intronic
987317812 5:16740383-16740405 GACGGACAGGGGTGGGAGTTGGG + Intronic
987588656 5:19893112-19893134 GAGGGGCAGAGGGAGCTGTTTGG - Intronic
989130792 5:38104752-38104774 GGGGGGCAGGGGCAGGAGTGGGG + Intergenic
989480447 5:41925144-41925166 CAGGGGCAAGGGCGGGTACTGGG - Intergenic
989582838 5:43049419-43049441 CTGGAGCAGGGGCGGGTGTCTGG - Intergenic
990612301 5:57469842-57469864 AAGGGGCAGGGCTGGATGTTTGG + Intergenic
990743704 5:58937243-58937265 GAGGGGCGGGGGCGGGAGCAGGG + Intergenic
991144300 5:63283011-63283033 GAGGGGCAGGGGCAGGTGGTTGG + Intergenic
991176206 5:63689910-63689932 GAGGAACAGTGGCGGGTTTTTGG - Intergenic
992746647 5:79827242-79827264 GAGGGGAAGAAGGGGGTGTTGGG - Intergenic
992933815 5:81680071-81680093 GGGTGGCAGGGCCAGGTGTTGGG - Intronic
993353313 5:86876482-86876504 AAGGGGCAGTGGCAGGTGGTTGG + Intergenic
993905702 5:93621217-93621239 GAGGGGCGGGACCGGGTGGTCGG - Intronic
996859880 5:128053280-128053302 GAGGGGCAGGGGATGGTTTCAGG + Intergenic
996879972 5:128285591-128285613 GAGTGGTGGGGGTGGGTGTTGGG - Intronic
997438525 5:133892374-133892396 CAGGGGCAGGGGTGGGTGGATGG - Intergenic
997591618 5:135076671-135076693 GGGGGGAAGGGGCAGGAGTTGGG + Intronic
998161456 5:139814966-139814988 AAGGGCCAGGGGCAGGTGGTGGG - Intronic
998307764 5:141096274-141096296 GAGGGGCAGGTGCGGGTCCTGGG - Exonic
998308401 5:141102127-141102149 GAGGGGCAGGTGCGGGTCCTGGG - Exonic
998310311 5:141123473-141123495 GAGGGGCAGGTGCGGGTCCTGGG - Exonic
998312751 5:141151729-141151751 GAGGGGCAGGTGCGGGTCCTGGG - Exonic
998313441 5:141157476-141157498 GAGGGGCAGGTGCGGGTTCTGGG - Intergenic
998314932 5:141174313-141174335 GAGGGGCAGGTGCGGGTCCTGGG - Exonic
998315510 5:141179515-141179537 GAGGGGCAGGTGCGGATCCTGGG - Exonic
998316051 5:141184037-141184059 GAGGGGCAGGTGCGGGTCTTGGG - Exonic
998316606 5:141188796-141188818 GAGGGGCAGGTGTGGGTCCTGGG - Exonic
998317240 5:141194030-141194052 GAGGGGCAGGTGCGGGTCTTGGG - Exonic
998317914 5:141201252-141201274 GAGGGGCAGGTGCAGGTCCTGGG - Exonic
998318869 5:141210385-141210407 GAGGGGCAGGTGCGGGTCCTGGG - Exonic
998319437 5:141215601-141215623 GAGGGGCAGGTGCGGGTCCTGGG - Exonic
998320415 5:141224983-141225005 GAGGGGCAGGTGCCGGTCCTGGG - Exonic
998321425 5:141236032-141236054 GAGGGGCAGGTGCGGGTCCTGGG - Intergenic
998321998 5:141241394-141241416 GAGGGGCAGGTGCGGGTTCCGGG - Intergenic
998322656 5:141247056-141247078 GAGGGGCAGGTGCGGGTCCCGGG - Exonic
998608440 5:143661719-143661741 TAGGGGCAGGGAGGGGTCTTGGG + Intergenic
998981865 5:147712739-147712761 GAGTGGAAGGGGTGGGTGCTGGG - Intronic
999193131 5:149763387-149763409 CAGGGGCAGGGGGAGGTGTTTGG + Intronic
999279452 5:150355468-150355490 GGGGGGGGGGGGCGGGTGGTAGG - Intergenic
999361270 5:150988595-150988617 TAGGGGCAGGGAGGAGTGTTTGG + Intergenic
999758423 5:154682555-154682577 GAGGGGCCGGGGAGGGTGCCCGG - Intergenic
999765515 5:154737800-154737822 GAGGGGCAGGGGCGGGGAACCGG - Intronic
1000102378 5:158028698-158028720 GGGGGGCAGGGGCTGGGGTGGGG - Intergenic
1000348248 5:160332357-160332379 GAGGGGCAAGGGCAGATGTAAGG - Intronic
1001032990 5:168276335-168276357 GTGGGGCTGGGGAGGGCGTTAGG - Intergenic
1001035342 5:168292594-168292616 GTCGGGCGGGGGCGGGGGTTGGG + Intronic
1001280512 5:170383128-170383150 GAGGGGGAGGGTGGGATGTTGGG + Intronic
1002350176 5:178577595-178577617 GGGGGGCAGGCGCGGGTTCTGGG - Intronic
1002350785 5:178582408-178582430 CTGGGGCAGTGGCGGGTGTTGGG - Intronic
1002643870 5:180643579-180643601 AAGGGGCAGGGGATGGTTTTAGG - Intronic
1003308185 6:4947173-4947195 GAGGGGATGGGGCAGGTTTTGGG + Intronic
1003411848 6:5871875-5871897 GAGAGGCAGGGGAAGGTTTTTGG - Intergenic
1003624416 6:7728369-7728391 GCGGGGTAGGGGCCGGGGTTGGG + Intronic
1004169240 6:13283272-13283294 GAGGGGCAGGGGCAGGGGGAGGG - Intronic
1004608333 6:17214824-17214846 GAGGGGCAGGGGGAGCTGTCTGG - Intergenic
1005821712 6:29604474-29604496 GAGGTGCGGGGGTGGGTGTCAGG - Exonic
1005825115 6:29627797-29627819 GGGGGGCAGGGGTAGCTGTTGGG + Intronic
1005969850 6:30752420-30752442 CAGGGGCGGAGGCGGGTGCTGGG + Intergenic
1006092466 6:31636224-31636246 GAGGGGCTGGGCCGGGGGGTAGG - Exonic
1006180656 6:32151724-32151746 GAGGGGTAAGGGAGGGGGTTGGG + Intronic
1006318588 6:33305352-33305374 GAGGGGCAGGGGTGTGGGTGAGG + Exonic
1006440079 6:34048447-34048469 GAGGGGCTGGGGCTGGGGGTGGG + Intronic
1006642705 6:35497080-35497102 GAGGAGCCGGGGCGGGGGTGGGG + Intergenic
1006716831 6:36125721-36125743 AAAGGGCAGGGGCTGGGGTTGGG + Intergenic
1007696480 6:43737154-43737176 GAGGGGCAGGGGTGGGGGTGGGG - Intergenic
1007712443 6:43833377-43833399 GAGTGGCAGGGGCTGGAGTGTGG - Intergenic
1007810499 6:44482382-44482404 GCGGGGCAGGGGCGGCTCTCAGG - Intergenic
1008414261 6:51221291-51221313 AAAGGGCAGGGGCGGGGGATGGG + Intergenic
1008601502 6:53100520-53100542 GAGGGCCAGGTGAGGGTGCTTGG + Exonic
1008875735 6:56324497-56324519 GAGGGTCAGAGGGGGATGTTAGG - Intronic
1009442970 6:63704406-63704428 CAGGGGCTGGTGGGGGTGTTGGG - Intronic
1010154045 6:72771181-72771203 GAGGGGAATGGGTGGGTGTGGGG + Intronic
1011216309 6:85009503-85009525 GAGTGGCAGGGTAGGGTGTGGGG + Intergenic
1011655648 6:89549395-89549417 GAAGGGCAAGGGAGGGTGTGGGG - Intronic
1014007878 6:116442220-116442242 GTGGGGGAGGGGAGGGTGATAGG + Intergenic
1014521289 6:122445555-122445577 GAGGGGCGGGGGAGGGGGTTGGG - Intronic
1016182792 6:141168126-141168148 GAGAGGCACGGGCGGGAGCTGGG + Intergenic
1016597263 6:145815612-145815634 GAGGGGTGGGGGCGGGTGAGCGG - Intergenic
1016923414 6:149317753-149317775 GAGGGGGAGGGGAGGGGGTCGGG - Intronic
1016949578 6:149566625-149566647 GGCGGGCAGGGGCGGGGGTCCGG + Intronic
1017163097 6:151383785-151383807 GAGGGGCAGGGGCAGGGGCAGGG - Intronic
1017352849 6:153463408-153463430 GAGGGGCAGGGGAGGGGAATGGG + Intergenic
1017446603 6:154511758-154511780 GGGGGGTTGGGGGGGGTGTTGGG - Intergenic
1018447140 6:163868045-163868067 GAGGGGCAGGGGCCTGGGTGAGG + Intergenic
1018627821 6:165796800-165796822 GTGGGGCTGGGGCTGGTGTGAGG - Intronic
1018867694 6:167758773-167758795 GAGGGGAGTGGGCGGCTGTTTGG - Intergenic
1018954590 6:168400307-168400329 GAGGGGCAGGGGCTGGAGAAGGG - Intergenic
1018981940 6:168607849-168607871 GAGGGGGAGGTGTGGGTGCTTGG + Intronic
1019170486 6:170130815-170130837 GAGGGGGAGGTGCAGGTGTCTGG - Intergenic
1019287725 7:231941-231963 CCTGGGCAGGGGCGGGTGCTGGG - Intronic
1019345992 7:531179-531201 CAGGGGCAGGGGCGGGGGGCGGG + Intergenic
1019376161 7:693407-693429 CGGGGGCTGGGGCGGGTGTCGGG - Intronic
1019476740 7:1247916-1247938 GCGGGGGAGGGGCGGGTCCTCGG - Intergenic
1019521307 7:1461674-1461696 GAGGAGGAGGGGCGGGTGCTGGG - Intergenic
1022186322 7:27973108-27973130 GTGGGGCAGGGTGGGGTGTTAGG + Intronic
1022475960 7:30709764-30709786 GAGGACCAGGGGCGGGGGATGGG - Intronic
1022509072 7:30923662-30923684 CAGGGGCAGGGGCGGGCGGAGGG + Exonic
1022671326 7:32458949-32458971 TGGGGGGAGGGGCGGGTGTTAGG - Intergenic
1022936776 7:35186357-35186379 CAGGCGCTGGGGAGGGTGTTGGG - Intergenic
1023299855 7:38758731-38758753 GTGGGGCAGGGGTGGGGGTAGGG - Intronic
1023418240 7:39951163-39951185 GGGGGGCAGCGGCGGGAGTCCGG + Exonic
1023743829 7:43303828-43303850 GTGGGACAGGGGCGGGTGTAGGG - Intronic
1023779381 7:43641979-43642001 CAGGGGCAGGGGAGGGAATTGGG + Intronic
1024586095 7:50843314-50843336 GAGGAGCAGGGCAGGGTGTGTGG - Intergenic
1024688803 7:51777456-51777478 GAGGGGCAGGGGCTGGCGCTGGG - Intergenic
1025025201 7:55510899-55510921 GGAGGGCAGGGGATGGTGTTGGG - Intronic
1025206605 7:56996660-56996682 GAGGGGGAGGGGCGGGGCCTCGG + Intergenic
1025665335 7:63580267-63580289 GAGGGGGAGGGGCGGGGCCTCGG - Intergenic
1026476871 7:70743979-70744001 CAGGGGCTGGGGCGGGGGTGGGG - Intronic
1027353976 7:77338915-77338937 GAGGGGCGGGGGTGTGTGTGTGG - Intronic
1027850494 7:83445476-83445498 GGGAGGCTGAGGCGGGTGTTTGG + Intronic
1028091704 7:86710574-86710596 GGGGGGAGGGGGCGGGTGGTGGG + Intronic
1028213289 7:88101380-88101402 GAGTTGCAGGGGCGGGTGTTTGG + Intronic
1028401305 7:90428614-90428636 GTGGGGCAGAGGCGGGGGGTGGG - Intronic
1028977976 7:96935075-96935097 GAGGGGTAAGGGCGGGGGTGGGG - Intergenic
1029086563 7:98016424-98016446 GCGGGGCAGGGGAGGGAGGTGGG + Intergenic
1029137054 7:98380818-98380840 GAAGGGGTGGGGCGGGGGTTGGG - Intronic
1029994618 7:104995343-104995365 GTGGGGTAGGGGAGGGTGTTGGG - Intergenic
1030481766 7:110113605-110113627 GGGGGGTGGGGGCGGGTGGTGGG - Intergenic
1031213376 7:118859006-118859028 GAGAGGCACGGGCGGGAGCTGGG - Intergenic
1032075614 7:128834468-128834490 GTGGGGCAGGGGTGGGTGGGTGG - Intronic
1032078127 7:128845778-128845800 GAGGTGCAGGGGAGGGTGTGGGG + Intronic
1032094772 7:128932528-128932550 GAGTTGCAGGGCCTGGTGTTTGG - Intergenic
1032193399 7:129777037-129777059 GATGGGGAGAGGCAGGTGTTAGG + Intergenic
1032197238 7:129796477-129796499 GAGTGGGAGGGGCTGGAGTTTGG - Intergenic
1032279568 7:130490339-130490361 GAGGCTCAGGGCCGCGTGTTTGG - Intronic
1032391253 7:131556670-131556692 GAGGGGCGGGGGCGGGGGCGGGG - Intronic
1032391257 7:131556676-131556698 GAGGGGGAGGGGCGGGGGCGGGG - Intronic
1032824639 7:135557253-135557275 GGTGGGGAGGGGAGGGTGTTGGG + Intergenic
1032841784 7:135719932-135719954 GAGAGACAGGGGAGGGAGTTGGG + Intronic
1032987475 7:137354482-137354504 GCGGGGTGGGGGTGGGTGTTGGG + Intergenic
1034103472 7:148471030-148471052 GATGGGCAGGGGAGGGTTGTAGG + Intergenic
1034356423 7:150453904-150453926 GGGTGGCAGTGGCGGGTGCTAGG + Intronic
1034738734 7:153453849-153453871 CAGGGGCAGGGCCAGGAGTTGGG - Intergenic
1034826958 7:154274456-154274478 GACAGGCAGGGGCGGGTGTATGG - Intronic
1034939889 7:155223775-155223797 GAGGGGAAGGGGAGGGGGTGTGG - Intergenic
1035021920 7:155805293-155805315 GGGCGGCAGGGGCGGGTGTGCGG - Intronic
1035037181 7:155902931-155902953 AAGGGGCTGAGGCTGGTGTTGGG + Intergenic
1035263570 7:157676328-157676350 GAGGGGCTGGGCCAGGTGGTGGG - Intronic
1035316937 7:158002314-158002336 GAGAGGCAGGGACGTGTTTTGGG + Intronic
1035469073 7:159098201-159098223 GCAGGGCAGGGCCGGGTGGTCGG + Intronic
1036433881 8:8714952-8714974 GAGGAGCAGGAGCGGTGGTTGGG + Intergenic
1036626968 8:10480218-10480240 GAGGGGCACGGGTGTGTGGTCGG + Intergenic
1036651942 8:10649881-10649903 GTGGGGCAGGGGCGGCTGAAGGG - Intronic
1036822872 8:11954087-11954109 GAGGGGCAGGTGCCAGTGTATGG - Intergenic
1037262795 8:17027214-17027236 GAGGGGCGGGGGCGGGGGGGGGG - Intergenic
1037401790 8:18501441-18501463 CAGGGGCAGGGGTGGTTGATGGG + Intergenic
1037482039 8:19314016-19314038 GAGCGGCCGCGGCGGGTGTCCGG + Intronic
1038017552 8:23528650-23528672 GAGGGGCAGGGGAGGTCATTGGG - Intergenic
1038289331 8:26234918-26234940 GAGGGGCAGGTGCAGGAGTGGGG - Intergenic
1038295964 8:26291434-26291456 GAGGGGGAGGGGCGGGGGAGCGG - Intergenic
1038441622 8:27574603-27574625 GTGGGGTAGGGGCGGGAGTAGGG + Intergenic
1038542705 8:28402482-28402504 GAGGGGCGGGGGCGGGAGAGCGG - Intronic
1039064695 8:33598488-33598510 GGGGGACAGGGGTGGGTGGTGGG + Intronic
1039212728 8:35235419-35235441 GAGGGGAAGGGGCGGCTGCGGGG + Intergenic
1039903086 8:41767035-41767057 GAGGGGCACGGGCGGGAGCGTGG - Intronic
1039903103 8:41767087-41767109 GAGGGGCTGGAGCCGGGGTTGGG - Intronic
1041083238 8:54233576-54233598 GGGGGGCAGGGGTGGGGGTGGGG - Intergenic
1041748187 8:61231891-61231913 GGGGGGCAAGGGTGGATGTTGGG + Intronic
1043817262 8:84816626-84816648 CTGGGGCAGGGGCGGGGGTATGG + Intronic
1043925140 8:86028200-86028222 AAGGGGTAGGGGCAGGTGGTGGG - Intronic
1045344281 8:101280657-101280679 GAAGGGCAGGGGCTGGTGTTTGG + Intergenic
1046094367 8:109539911-109539933 GAGGGGCAGGTGAGTGTGTGCGG + Intronic
1047212450 8:122850893-122850915 GAGGGGCAGGTGAGGATGTGGGG - Intronic
1047446163 8:124921577-124921599 GAGAGGCAGGGGCAGGTCCTGGG + Intergenic
1047681130 8:127255309-127255331 GAGGGGCAGGGGTGGGGGGAGGG + Intergenic
1048581242 8:135731396-135731418 GATGGGCAGAGGCTGGGGTTTGG + Intergenic
1049230367 8:141478569-141478591 GGTGGGGAGGGGCAGGTGTTGGG + Intergenic
1049282059 8:141754551-141754573 GAGGGGCAGGGGCTGGTGTGGGG - Intergenic
1049301508 8:141872931-141872953 CAGGGGCAGGGGAGGGTGGTGGG + Intergenic
1049383777 8:142330830-142330852 GGGGGGCAGGGGCGGGAGTGTGG - Intronic
1049441525 8:142611920-142611942 GAGGGGCTGGGGCCGGTGGATGG + Intronic
1049761668 8:144334474-144334496 GAGGGGGAGGGGAGGGTGGGTGG - Intronic
1049918532 9:342137-342159 GGGGGGCAGGGGATGGTTTTGGG - Intronic
1050485381 9:6129118-6129140 GAGGTGCAGGGGCCTGTATTTGG + Intergenic
1051445590 9:17135603-17135625 AAGGGGCAGGGGCCCGGGTTTGG - Intronic
1051934788 9:22433873-22433895 GAGAGGCATGGGCGGGAGGTGGG + Intergenic
1052531199 9:29686330-29686352 GAGGGGCAGGGGCAGGGAGTGGG + Intergenic
1053120834 9:35546613-35546635 GAGGGGCAGGTGGAGGTGGTGGG + Exonic
1053153451 9:35757173-35757195 GAGGGCCAGCGGCCGGGGTTGGG - Exonic
1053179260 9:35954149-35954171 GGGGGCCAGGGGAGGGAGTTGGG - Intergenic
1053329215 9:37188608-37188630 GAGGGGGAGGGGCGGGGGAAGGG - Intronic
1053352856 9:37424786-37424808 GAGGGGCGGGGACAGGTGTGCGG + Intronic
1053598228 9:39585112-39585134 GAGGGGCAGGAGTGGGGGTGAGG + Intergenic
1053835476 9:42130105-42130127 GAGGGGCGGAGGCGGGAGGTGGG + Intergenic
1053856257 9:42342121-42342143 GAGGGGCAGGAGTGGGGGTGAGG + Intergenic
1054595152 9:67058505-67058527 GAGGGGCAGAGGCGGGAGGCGGG - Intergenic
1055187494 9:73474260-73474282 GAGGGGGAGGGGCAGGAGCTTGG - Intergenic
1055354440 9:75423546-75423568 GCGGGGCAGGGGAGGGGGTTGGG - Intergenic
1057277244 9:93682385-93682407 CTGGGGCTGGGGCGGGTGCTGGG + Intergenic
1057483375 9:95462994-95463016 GAGGGGCAAGGGTGGGTGGGGGG - Intronic
1057695226 9:97318332-97318354 AAGGGGCTGGGGGTGGTGTTAGG + Intronic
1057890374 9:98865327-98865349 GAGAGGCAGGGGCAGGTGATGGG - Intergenic
1057922093 9:99105493-99105515 GCGGGGCAGGGGCGTGTGTCCGG + Intronic
1058013039 9:99999169-99999191 GAGGGGGAGGGGCGGGGGACAGG - Intronic
1058099743 9:100905703-100905725 GGGGGGCGGGGGCGGGGGTGAGG + Intergenic
1058351669 9:104032487-104032509 GAGGGGCAGGGGTTGGTGGGCGG - Intergenic
1058373772 9:104300068-104300090 GAGGTGCAGGAGCGGGTGCATGG - Intergenic
1058508504 9:105691226-105691248 CTGGGGCAGGGGCAGGGGTTGGG - Intergenic
1058847482 9:108975324-108975346 GAGGGGCAGGGGTGGGGGTAGGG + Intronic
1059447992 9:114350923-114350945 CAGCGGCAGGGGCGGGGGCTGGG + Exonic
1060278807 9:122202124-122202146 GAGGTGCAGAGGAGCGTGTTTGG - Intergenic
1060421639 9:123473319-123473341 GAGGGGCAGGGGAGGGCGGAGGG + Intronic
1060897261 9:127225586-127225608 GAGGTGCAGGGACGGGTGTCGGG + Intronic
1060952531 9:127612883-127612905 GAAGGAGAGGGACGGGTGTTGGG - Intronic
1060984077 9:127809837-127809859 GAGGGGCAGGGCTGGGGGTGGGG + Intronic
1061088250 9:128411826-128411848 GAGGGGCAGGGGAGGATATTGGG + Intronic
1061119830 9:128635826-128635848 GGTGGGCTGGGGCGGGTGTTTGG - Intronic
1061383734 9:130276108-130276130 GAGGGGCAGGGGTGGGTGGGTGG + Intergenic
1061393701 9:130331936-130331958 AAGGGGCAGAGGAGGGTGGTGGG - Intronic
1061677507 9:132226743-132226765 GAGGGGCCCAGGAGGGTGTTGGG - Intronic
1061804039 9:133128315-133128337 GAGGGGCTGCGGGGGGTGCTGGG + Intronic
1061853275 9:133428574-133428596 CAGGGGCGGGGGCGGGGGTGGGG - Intronic
1062252565 9:135605620-135605642 GTGTGGCAGGGGAGGGTGATTGG + Intergenic
1062276338 9:135733282-135733304 GAGGTGCAGGGGCAGGTGTGGGG - Intronic
1062465865 9:136681233-136681255 GAGGACCAGGGGCCGGTGGTGGG - Intronic
1062535291 9:137018585-137018607 GAGGGGAAGTGGCGGGTGAGGGG + Intronic
1062581159 9:137229833-137229855 GAGGGGCCGGGGCTGGGGCTGGG + Intergenic
1062636053 9:137492496-137492518 GAGGGGCATGGGCGGGTGGGTGG + Intronic
1062661998 9:137641729-137641751 CAGGGGCAGAGACGGGTGTTTGG + Intronic
1203768192 EBV:37253-37275 GAGGGGCAGGGGCAGGGGCAGGG + Intergenic
1203745415 Un_GL000218v1:38424-38446 GAGGTGCAGGGGGAGGAGTTGGG + Intergenic
1203564693 Un_KI270744v1:81060-81082 GAGGTGCAGGGGGAGGAGTTGGG - Intergenic
1186460245 X:9742739-9742761 GAGGGGCAAGGGCACGTCTTTGG - Intronic
1187825994 X:23334180-23334202 GGGGGGAGGGGGCGGGTGTCGGG - Exonic
1188545997 X:31307926-31307948 GGGAGGCAGGGGCGGGGGTATGG + Intronic
1188759762 X:34013041-34013063 GAGGTGCATGGGAGGGAGTTTGG + Intergenic
1188807152 X:34605391-34605413 GAGGGGCAGGTGCAGGAGCTGGG - Intergenic
1189150476 X:38701235-38701257 GAGGGGCAGTGGGAGGTGGTTGG - Intergenic
1189930655 X:46005676-46005698 GAGGGGCAGTGGGGGGAGGTGGG - Intergenic
1190054248 X:47172702-47172724 GCAGGGCAGGGGCGGGGGTGCGG + Intronic
1193338362 X:80317473-80317495 GAGAGGCAGAGGCATGTGTTTGG - Intergenic
1195228354 X:102821172-102821194 CAGGGGCTTGGGCGGGGGTTGGG - Intergenic
1195342396 X:103918591-103918613 GGGCGTCGGGGGCGGGTGTTCGG - Intergenic
1196886587 X:120251405-120251427 GAACGGCAGGGTGGGGTGTTGGG - Intronic
1197749882 X:129957228-129957250 GAGGGGCGGGGGCGGGGGCCGGG - Intergenic
1198198199 X:134386355-134386377 AAGGGGCAGGGGTGAGGGTTGGG + Intronic
1198832338 X:140764349-140764371 GTGGGGCGGGGGCGGGGGTGGGG + Intergenic
1198986371 X:142458849-142458871 GTGGGGAAGGGTCGGGTGTTGGG - Intergenic
1199271450 X:145888130-145888152 CAGTAGCAGGGGAGGGTGTTGGG - Intergenic
1199470508 X:148190616-148190638 CAGGGGCGGGGGAGGGGGTTGGG + Intergenic
1200683943 Y:6244162-6244184 GAGGGGCAGGGGCGGGGGCAGGG + Intergenic
1200686562 Y:6264488-6264510 GAGGGGCCGGGGGTGGTGTGAGG + Intergenic
1200989438 Y:9335404-9335426 GAGGGGCGGGGGGTGGTGTGAGG + Intergenic
1200992110 Y:9355737-9355759 GAGGGGCCGGGGGTGGTGTGAGG + Intergenic
1200997426 Y:9396361-9396383 GAGGGGCCGGGGGTGGTGTGAGG + Intergenic
1201002599 Y:9485207-9485229 GAGGGGCCGGGGGTGGTGTGAGG + Intronic
1201010532 Y:9546011-9546033 GAGGGGCCGGGGGTGGTGTGAGG + Intergenic
1201048692 Y:9910224-9910246 GAGGGGCAGGGGCGGGGGCAGGG - Intergenic
1201158735 Y:11153435-11153457 GAGGTGCAGGGGGAGGAGTTGGG + Intergenic
1202088436 Y:21163418-21163440 GGGGGGCGGGGGCGGGTGGGAGG - Intergenic
1202332655 Y:23770888-23770910 GAGGGGCAGGATGGGGTGTGAGG + Intergenic
1202538114 Y:25899175-25899197 GAGGGGCAGGATGGGGTGTGAGG - Intergenic