ID: 1113553956

View in Genome Browser
Species Human (GRCh38)
Location 13:111216348-111216370
Sequence CCTCCACCCAGCCACAGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 518
Summary {0: 1, 1: 0, 2: 4, 3: 46, 4: 467}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113553956_1113553969 29 Left 1113553956 13:111216348-111216370 CCTTCCCTGTGGCTGGGTGGAGG 0: 1
1: 0
2: 4
3: 46
4: 467
Right 1113553969 13:111216400-111216422 ATCACCTGCTGCCACCTGGTGGG 0: 1
1: 0
2: 1
3: 16
4: 174
1113553956_1113553963 -3 Left 1113553956 13:111216348-111216370 CCTTCCCTGTGGCTGGGTGGAGG 0: 1
1: 0
2: 4
3: 46
4: 467
Right 1113553963 13:111216368-111216390 AGGGCAGGGAGAAGCCAGTGTGG 0: 1
1: 1
2: 21
3: 109
4: 1003
1113553956_1113553970 30 Left 1113553956 13:111216348-111216370 CCTTCCCTGTGGCTGGGTGGAGG 0: 1
1: 0
2: 4
3: 46
4: 467
Right 1113553970 13:111216401-111216423 TCACCTGCTGCCACCTGGTGGGG 0: 1
1: 0
2: 2
3: 39
4: 253
1113553956_1113553967 25 Left 1113553956 13:111216348-111216370 CCTTCCCTGTGGCTGGGTGGAGG 0: 1
1: 0
2: 4
3: 46
4: 467
Right 1113553967 13:111216396-111216418 TGGAATCACCTGCTGCCACCTGG 0: 1
1: 0
2: 0
3: 22
4: 184
1113553956_1113553968 28 Left 1113553956 13:111216348-111216370 CCTTCCCTGTGGCTGGGTGGAGG 0: 1
1: 0
2: 4
3: 46
4: 467
Right 1113553968 13:111216399-111216421 AATCACCTGCTGCCACCTGGTGG 0: 1
1: 0
2: 5
3: 32
4: 180
1113553956_1113553965 5 Left 1113553956 13:111216348-111216370 CCTTCCCTGTGGCTGGGTGGAGG 0: 1
1: 0
2: 4
3: 46
4: 467
Right 1113553965 13:111216376-111216398 GAGAAGCCAGTGTGGGCAGATGG 0: 1
1: 1
2: 7
3: 84
4: 679
1113553956_1113553964 -2 Left 1113553956 13:111216348-111216370 CCTTCCCTGTGGCTGGGTGGAGG 0: 1
1: 0
2: 4
3: 46
4: 467
Right 1113553964 13:111216369-111216391 GGGCAGGGAGAAGCCAGTGTGGG 0: 1
1: 0
2: 3
3: 109
4: 743

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113553956 Original CRISPR CCTCCACCCAGCCACAGGGA AGG (reversed) Intronic
900116346 1:1029295-1029317 CCCCCACCCATACACTGGGAAGG - Intronic
900237800 1:1600808-1600830 CCTCCCCACAGCCATCGGGAGGG - Intergenic
900526729 1:3133055-3133077 CCACCACCCAGTCAGAGGCACGG - Intronic
900618723 1:3577268-3577290 CCACAAGCCAGCCACAGGGGAGG + Intronic
901423891 1:9168973-9168995 CTTCCTTCCATCCACAGGGAAGG + Intergenic
901857666 1:12054578-12054600 CCCACTCCCAGCCACATGGAGGG + Intergenic
902481084 1:16712262-16712284 GGTCCTCCCAGGCACAGGGAAGG - Intergenic
902528388 1:17074654-17074676 AGTCCACCCAGCCACAGCAAGGG + Intronic
902806714 1:18865602-18865624 CCTCCATCCAACCGCAGGGCAGG - Intronic
903020779 1:20392359-20392381 CCCCAACCCAACCCCAGGGATGG + Intergenic
904311800 1:29633962-29633984 CTTCCCTCCAGCCTCAGGGAAGG - Intergenic
904321075 1:29698193-29698215 CCCAGACCCAGCCGCAGGGAGGG + Intergenic
904359594 1:29963117-29963139 CCTCCAGCCACTCCCAGGGAAGG + Intergenic
904359638 1:29963241-29963263 CCTCCAGCCACTCCCAGGGAGGG + Intergenic
904359649 1:29963272-29963294 CCTCCAGCCACTCCCAGGGAGGG + Intergenic
904359660 1:29963303-29963325 CCTCCAGCCACTCCCAGGGAGGG + Intergenic
904359671 1:29963334-29963356 CCTCCAGCCACTCCCAGGGAGGG + Intergenic
904359681 1:29963365-29963387 CCTCCACCCACTCCCAGGAAGGG + Intergenic
904359693 1:29963396-29963418 CCTCCAGCCACTCCCAGGGAGGG + Intergenic
904965424 1:34369044-34369066 CCACCACCACCCCACAGGGAAGG + Intergenic
905015335 1:34774426-34774448 CCTCCTCCCATCCAGAAGGAGGG + Intronic
905464669 1:38143819-38143841 CCTCCACCCACCACCAGTGATGG - Intergenic
905769900 1:40630780-40630802 CCTAGACCCAGCCACAGGCTGGG - Intronic
905816439 1:40954593-40954615 CCTCCCCCCAGACACATGCACGG - Intergenic
905857214 1:41321987-41322009 CCCCAACCCAGCCTCAGAGAAGG + Intergenic
906326176 1:44847489-44847511 CCTCAACCTGCCCACAGGGAAGG - Intergenic
906656401 1:47551649-47551671 CCTCCACCAGGCCCGAGGGATGG + Intergenic
909301953 1:74023824-74023846 CCTACACTCAGCTACAGTGAGGG - Intergenic
909329939 1:74398594-74398616 CCTCCACCCAGCCTGAGAGGTGG - Intronic
912430062 1:109624248-109624270 CCTCCACCCTGGCTTAGGGAAGG - Intronic
912801578 1:112722914-112722936 CCTCCTCCCTGCTGCAGGGAGGG - Intronic
912804401 1:112744010-112744032 CTTCCTCCCAGCCCCAGGGCTGG - Intergenic
913689623 1:121266939-121266961 CCTCCAGGCAGCCATGGGGAAGG - Intronic
913971472 1:143421030-143421052 CCTCCACCAAGCCATAGGGGAGG + Intergenic
914065849 1:144246643-144246665 CCTCCACCAAGCCATAGGGGAGG + Intergenic
914113302 1:144719711-144719733 CCTCCACCAAGCCATAGGGGAGG - Intergenic
914147975 1:145013333-145013355 CCTCCAGGCAGCCATGGGGAAGG + Intronic
914437371 1:147671668-147671690 CCTCCTCCCTGCATCAGGGAGGG - Intergenic
915108242 1:153547430-153547452 CCTCCTCCCATCCACAAGGGAGG + Exonic
915528267 1:156489246-156489268 CTGCAGCCCAGCCACAGGGAAGG - Intronic
918049551 1:180962393-180962415 CGCCCACACAGCCCCAGGGAAGG + Intergenic
918429421 1:184443715-184443737 CTTCCCCCTAACCACAGGGAAGG + Intronic
919523698 1:198621206-198621228 CCTCTACCCAGCCACTGGAAAGG + Intergenic
919678508 1:200410069-200410091 CCTCGACCCGGCCAGAGGGGAGG + Intergenic
920206591 1:204296633-204296655 TCTGCAGCCAGCCACAGAGAAGG - Intronic
920310665 1:205046468-205046490 CCTCCAGCCAGGCACAGGGTGGG - Intronic
920476946 1:206285413-206285435 CCTCCAGGCAGCCATGGGGAAGG - Intronic
920515550 1:206582289-206582311 CCTCCTCCCACCCCCTGGGAAGG - Intronic
922780733 1:228250371-228250393 CCTTGGCCCAGCCACAGGGATGG - Intronic
922782572 1:228264522-228264544 CCTTGGCCCAGCCACAGGGATGG - Intronic
924416143 1:243858742-243858764 CCTCCTCCCAGTGCCAGGGAGGG - Intergenic
924564944 1:245189674-245189696 TCTCCTCCCTGCCACAGAGAAGG - Intronic
1062958256 10:1554228-1554250 CATCCACCCAGCCAGGGGCAGGG + Intronic
1064195187 10:13238546-13238568 CATCCTCCCAGCGACATGGAGGG - Intergenic
1070580736 10:77717224-77717246 CCTCCACCATCCCCCAGGGAGGG - Intergenic
1070615334 10:77965462-77965484 CCTCCTCACGGCCACTGGGATGG - Intergenic
1070657180 10:78279601-78279623 CCACAGCCCAGCCACAGTGAGGG + Intergenic
1071417191 10:85452286-85452308 CCTTCACCCACCCAAGGGGAAGG - Intergenic
1073130112 10:101182909-101182931 CCTCCACAGAACCAGAGGGATGG - Intergenic
1073249981 10:102115227-102115249 CCTCCCCCGAGCCCCAGGCACGG + Intronic
1073515107 10:104069230-104069252 CCTCCACCCAGCCGGAGAGGTGG - Intronic
1074229778 10:111522546-111522568 CCTCCATCCAGGCACCAGGATGG - Intergenic
1074467649 10:113697659-113697681 TCTCCACCCACCCATGGGGAGGG + Intronic
1074775812 10:116767434-116767456 CCTCCACCCAGCAGCTGGGGTGG - Intergenic
1075655538 10:124158734-124158756 CTACCACGCAGCCATAGGGATGG - Intergenic
1076600144 10:131651988-131652010 GCTCCAACCAGCCGCAGGCAGGG - Intergenic
1076622935 10:131804296-131804318 CCCACAGCCAGCCACAGGGCAGG - Intergenic
1076642643 10:131929232-131929254 CCTCCTCCCAGCCACTGGGCAGG + Intronic
1076896710 10:133316764-133316786 CCACCCCCCAGACACAGAGATGG + Intronic
1076896943 10:133317640-133317662 CCCCCCCCCAGACACAGAGATGG + Intronic
1076896955 10:133317675-133317697 CCCCCCCCCAGACACAGAGATGG + Intronic
1076896967 10:133317710-133317732 CCCCCCCCCAGACACAGAGATGG + Intronic
1076896994 10:133317814-133317836 CCCCCCCCCAGACACAGAGATGG + Intronic
1076897014 10:133317882-133317904 CCCCCCCCCAGACACAGAGATGG + Intronic
1076897033 10:133317947-133317969 CCCCCCCCCAGACACAGAGATGG + Intronic
1076897054 10:133318016-133318038 CCCCCCCCCAGACACAGAGATGG + Intronic
1076897064 10:133318049-133318071 CCCCCCCCCAGACACAGAGATGG + Intronic
1076897074 10:133318082-133318104 CCCCCCCCCAGACACAGAGATGG + Intronic
1076897122 10:133318278-133318300 CCCCCCCCCAGACACAGAGATGG + Intronic
1076897143 10:133318347-133318369 CCCCCCCCCAGACACAGAGATGG + Intronic
1076897153 10:133318380-133318402 CCCCCCCCCAGACACAGAGATGG + Intronic
1077308404 11:1877997-1878019 CCTCCACCAAGCCATAGGGGAGG - Intronic
1077722983 11:4646095-4646117 CCTCATCCCAGGCACAGAGAGGG - Intronic
1078542347 11:12222368-12222390 CCTCCACCCAGGCAGGGGGAGGG - Intronic
1078937317 11:15963333-15963355 CCTCCTCCCAGACTCAGGAATGG + Intergenic
1079035076 11:17014023-17014045 CCTCCTCCCAGCCGCGGGGCAGG + Exonic
1079115922 11:17640631-17640653 CCTCCTGCCCACCACAGGGAGGG + Intronic
1080123327 11:28702301-28702323 CCTCCTTCCTGGCACAGGGAGGG + Intergenic
1081426593 11:42932596-42932618 CCTCTCCTCAGCCAAAGGGATGG - Intergenic
1081692351 11:45086953-45086975 CCTCCACCCAGGGACAGTCAGGG - Intergenic
1081937126 11:46912786-46912808 CCTACACCCAGACAGAGGGAGGG + Intronic
1082092199 11:48099167-48099189 CCTGGACAGAGCCACAGGGATGG - Intronic
1083591519 11:63898063-63898085 CAACTTCCCAGCCACAGGGAAGG + Intronic
1083955804 11:65982233-65982255 GCCCCACCCAGCCCCAGGCAGGG + Intergenic
1084233852 11:67773385-67773407 CCTCCACCAAGCCAATGGGGAGG - Intergenic
1084304201 11:68271382-68271404 CCTCCACCCAGGTAGAGAGAGGG + Intronic
1084513943 11:69625552-69625574 TCTCCTCCCAGCCAAATGGAGGG + Intergenic
1085254356 11:75164107-75164129 GCCCCACCCAGCCACAGGGGTGG + Intronic
1085662106 11:78377829-78377851 CCTCCACCCTGCCAGAGATAAGG + Intronic
1087301787 11:96444279-96444301 TCTTCTCCCAGCTACAGGGATGG + Intronic
1088123204 11:106393951-106393973 CCCCCAACCACGCACAGGGAAGG - Intergenic
1088357756 11:108961095-108961117 CCACCTCCCTGCCACATGGAAGG + Intergenic
1088469392 11:110177179-110177201 CCTCCACCCGGGGACAGGAACGG + Intronic
1088598484 11:111456642-111456664 CATCCACCCTGACACTGGGAGGG + Intronic
1089192091 11:116660604-116660626 CCTGCACCCAGCCAGGGGGATGG + Intergenic
1089626811 11:119756081-119756103 CCTCCTTCCAGCCCCAGGAAGGG + Intergenic
1089654188 11:119935138-119935160 CTTCCACCTATCCTCAGGGAGGG + Intergenic
1089795206 11:120974739-120974761 CAGCCACCCAGCTACAGGCAGGG - Intronic
1090458611 11:126870356-126870378 CCTCCAGCCAGCCACAGCATTGG - Intronic
1091104150 11:132902690-132902712 CCTCACCCCTGGCACAGGGAGGG + Intronic
1091157237 11:133385020-133385042 CCTGCCCACAGCCACAAGGAGGG - Intronic
1091353473 11:134915917-134915939 ACTCCTCATAGCCACAGGGATGG + Intergenic
1092041949 12:5393077-5393099 CCTCCGTACAGCCACAGGGCAGG - Intergenic
1093005203 12:14043777-14043799 CCTCCATGGAGCTACAGGGACGG + Intergenic
1097053612 12:56237765-56237787 CTTCCCCCCAACCACAGGAATGG + Exonic
1097287480 12:57889154-57889176 CCTCCACCCAGCTCCCAGGAAGG + Intergenic
1099213467 12:79823037-79823059 CATTCAGCCAGCCACAGGTATGG + Intronic
1099301071 12:80895005-80895027 CCTCTACCCTGCCACAGAAAAGG + Intronic
1100613070 12:96208339-96208361 ACTGCACCCAGCCAGAGGGCAGG + Intronic
1100697918 12:97115636-97115658 CATCCTCCCAGCCACTGGGTTGG - Intergenic
1101838796 12:108313133-108313155 CCTGTTCCCAGGCACAGGGAAGG + Intronic
1102414181 12:112746382-112746404 CCACCACCCAGAGTCAGGGAAGG + Intronic
1102663430 12:114549250-114549272 CCTGGACCCAGCCACACGGGGGG - Intergenic
1103211852 12:119172998-119173020 TCTCCACCCATCCTCAAGGAGGG - Intergenic
1103800502 12:123534154-123534176 CCACCACCCGGCCGCCGGGAGGG + Intergenic
1103931163 12:124451844-124451866 CGCCCACCCATCCCCAGGGAAGG + Intronic
1104003222 12:124873694-124873716 CCTCCCCTCAGCCCCAGGGTGGG + Intronic
1104091115 12:125518496-125518518 GCTCCACCCAGATACAAGGAAGG - Intronic
1104187428 12:126446140-126446162 CCTCCATCCAGTCACTGAGATGG - Intergenic
1104309634 12:127642918-127642940 CCTCCCCCCATCCCAAGGGATGG + Intergenic
1104852553 12:131884227-131884249 CCCCCACTCAGTCACAGGAAAGG + Intergenic
1104852611 12:131884451-131884473 CCCCCACTCAGCCACGGGAAAGG + Intergenic
1104852621 12:131884479-131884501 CCCCCACTCAGCCACGGGAAAGG + Intergenic
1107448704 13:40489737-40489759 CTGCCACCCAGCCATAAGGAAGG + Intergenic
1108782670 13:53855614-53855636 CCCCCACCCAGCAACAAAGAGGG - Intergenic
1112381101 13:98891092-98891114 CCTCCTCCCACCAACAGGAAAGG - Intronic
1113007967 13:105729192-105729214 ACTCCACCCAGTCAGATGGACGG - Intergenic
1113531789 13:111032589-111032611 CATCCACTCAGCCACAGGTGGGG + Intergenic
1113553956 13:111216348-111216370 CCTCCACCCAGCCACAGGGAAGG - Intronic
1113707314 13:112443283-112443305 GCTCCACCCAGCCCCGGGGACGG - Intergenic
1113778517 13:112962704-112962726 CCTCCCCCCAGGCTCTGGGAGGG + Intronic
1113963882 13:114140827-114140849 CCTCCTCCCACCCACAAGGAAGG + Intergenic
1114715162 14:24816821-24816843 CCTCAACACAGGGACAGGGAAGG - Intronic
1115689197 14:35826300-35826322 CTTCCACCGAGCCAGAGGGCGGG - Exonic
1117402523 14:55371061-55371083 CCTGCAACCAGCTACAGGGTGGG + Intronic
1118093009 14:62503500-62503522 AGTCCACACATCCACAGGGAAGG + Intergenic
1118130306 14:62955717-62955739 CCTCCACTCAGTCACAGCAATGG + Intronic
1118993599 14:70817918-70817940 GCTCCACCCAGCGACCGCGAAGG - Intergenic
1119290756 14:73492847-73492869 CCTCCACACTGTCACAGGGCAGG - Exonic
1119353714 14:73988109-73988131 CCTCCACCCAGCCACATCTTGGG - Exonic
1119387725 14:74268196-74268218 CCTCCACACAGCCTCAGTGAGGG + Intergenic
1119420187 14:74503650-74503672 CCACCAACCACCCTCAGGGAAGG + Intronic
1119662591 14:76462523-76462545 CCTGCAACCAGACACAGAGAGGG - Exonic
1119725439 14:76919349-76919371 CCTCTGGCCAGCCACAGAGAGGG + Intergenic
1120226391 14:81795454-81795476 CCTACACACGGACACAGGGAGGG + Intergenic
1120710212 14:87785697-87785719 CCACCCCCCAGCCCTAGGGAAGG + Intergenic
1120852971 14:89187471-89187493 CAGCCAGCCAGCCACAGTGATGG - Intronic
1122112983 14:99514696-99514718 CCTCCAGCCAGCCACAGATGTGG + Exonic
1122549703 14:102543392-102543414 CTCCCACCCAGCCACCGGAACGG - Intergenic
1122809472 14:104280921-104280943 CCTCCACTCAGCACCAGGGATGG + Intergenic
1122924334 14:104892750-104892772 ACTCCCCACAGCCACAAGGAGGG - Intronic
1123039560 14:105484923-105484945 CCTCTACCCGCCCCCAGGGATGG - Intergenic
1123053537 14:105559148-105559170 CCCACACCCAGCCGCCGGGAGGG + Intergenic
1123078115 14:105679563-105679585 CCCACACCCAGCCGCCGGGAGGG + Intergenic
1123928703 15:25145563-25145585 CCTCAAGACAGCCCCAGGGATGG - Intergenic
1124119540 15:26876882-26876904 CCTCCTCCCAGCCACACTGGGGG - Intronic
1124992800 15:34692555-34692577 CAACCAGCCAGCCACAAGGAAGG - Intergenic
1125315633 15:38428188-38428210 CTTCCACCAAGGCACAGGAAGGG - Intergenic
1127820938 15:62655539-62655561 CCTCCACCCTGCCACCGGAGAGG + Intronic
1128128246 15:65208671-65208693 CCCCAACCCAGCCTCAGGTAGGG - Intronic
1128243101 15:66114948-66114970 CCTCCTTCCACACACAGGGATGG + Intronic
1128886604 15:71293900-71293922 CCCCCAGGCAGCCACTGGGAGGG - Intronic
1129670309 15:77604301-77604323 CCCCGGCCCATCCACAGGGAAGG + Intergenic
1130326941 15:82888951-82888973 CCTCCACTCCTCCCCAGGGAAGG - Intronic
1131047876 15:89327429-89327451 CCTCAACCCAGCCACTGACATGG + Intronic
1131050752 15:89346328-89346350 CCTCTAGCCAGACCCAGGGATGG - Intergenic
1132156086 15:99496044-99496066 CCCCTACCCTGCCACTGGGATGG - Intergenic
1132338087 15:101061486-101061508 CCTCCAGCCAGCAGCAGGCAGGG - Intronic
1132473894 16:122806-122828 CCCCCACCCACCTAAAGGGATGG + Intronic
1132533207 16:463952-463974 CCTCCACCCCTCCTCAGAGAGGG - Intronic
1132657377 16:1046919-1046941 CCCACCCTCAGCCACAGGGACGG + Intergenic
1132660263 16:1058011-1058033 CCTCCTCCCAGCTCCAGGGTGGG - Intergenic
1132870350 16:2113030-2113052 CCTCCACTCACCCACAGCCATGG + Intronic
1133025523 16:2987493-2987515 CATCCACCCAGCCCCAGGCATGG + Intergenic
1133139171 16:3731728-3731750 CCTCCTCCCGGCCAGAGGCACGG + Intronic
1133268588 16:4599572-4599594 CGTCCACCCAGCTGCAGGGGCGG + Intronic
1133389986 16:5402366-5402388 TCTCCACCCATCCACAAGGCTGG - Intergenic
1133463318 16:6006278-6006300 CATCCACCAAGTCACAGTGATGG + Intergenic
1133726999 16:8547211-8547233 CCTCCACACAGCTGCTGGGATGG - Intergenic
1134717069 16:16362558-16362580 CCTCCACTCACCCACAGCCATGG - Intergenic
1134957682 16:18389601-18389623 CCTCCACTCACCCACAGCCATGG + Intergenic
1135725698 16:24852515-24852537 CCTCCCCGCGGGCACAGGGAGGG + Intronic
1136064726 16:27751015-27751037 CCTGCACCCAGCCACAGACCCGG + Intronic
1136241332 16:28946104-28946126 CCTCCACACATCCACAGCGTTGG - Intergenic
1136355721 16:29744123-29744145 CCACCACCCAGACCCGGGGAGGG + Exonic
1136712815 16:32253837-32253859 CCTTAACCCAGCCCTAGGGACGG - Intronic
1136755101 16:32675592-32675614 CCTTAACCCAGCCCTAGGGACGG + Intronic
1136813012 16:33194777-33194799 CCTTAACCCAGCCCTAGGGACGG - Intronic
1136819488 16:33304857-33304879 CCTTAACCCAGCCCTAGGGACGG - Intronic
1136826051 16:33361392-33361414 CCTTAACCCAGCCCTAGGGACGG - Intronic
1136831117 16:33460163-33460185 CCTTAACCCAGCCCTAGGGACGG - Intronic
1136929370 16:34405528-34405550 CCCACATTCAGCCACAGGGAAGG + Intergenic
1136975204 16:35006277-35006299 CCCACATTCAGCCACAGGGAAGG - Intergenic
1137627090 16:49916111-49916133 CTATCACCCACCCACAGGGAGGG - Intergenic
1138393877 16:56689828-56689850 CCGCCACCCAGAGAGAGGGAGGG - Intronic
1139503966 16:67389903-67389925 CCCCAACCCAGCCCCAGGCATGG - Exonic
1139642072 16:68298942-68298964 TCTCCACCCAGTCACAGATAAGG + Exonic
1140257261 16:73348153-73348175 CCTCCAACCAGCCAAAGCCACGG + Intergenic
1140404662 16:74700726-74700748 CCTCCACTCAGCCACTTGGATGG + Exonic
1140503366 16:75453974-75453996 TCTCCAGCTACCCACAGGGAGGG + Intronic
1140615455 16:76657498-76657520 CCAGCACCCATTCACAGGGAAGG - Intergenic
1141135469 16:81462151-81462173 CATCCACCCAGACACAAGAATGG - Intronic
1141428923 16:83960885-83960907 CCTCTACCCAGCCCCAGCAAAGG + Intronic
1141644572 16:85360354-85360376 CCCCCACCCGGCCGCAGGGCAGG - Intergenic
1141719759 16:85749911-85749933 CCTCCTCCCATCCACAGGACCGG + Intronic
1141774560 16:86114207-86114229 CCTGCACTTAGCCACTGGGATGG + Intergenic
1141884264 16:86880962-86880984 CCCCCAACCAGCCACACGGCTGG - Intergenic
1202991589 16_KI270728v1_random:17747-17769 CCTTAACCCAGCCCTAGGGACGG - Intergenic
1203057243 16_KI270728v1_random:935931-935953 CCTTAACCCAGCCCTAGGGACGG + Intergenic
1143923978 17:10353176-10353198 GCTCCACCCAGCAACATGGCAGG - Intronic
1145985367 17:29042547-29042569 CCTCTCCTCAGCCACAGAGAGGG - Intronic
1146191996 17:30776860-30776882 ACTGCACCCGGCCACACGGAAGG + Intronic
1146271585 17:31488697-31488719 CCTCCACCATCCCAGAGGGACGG - Intronic
1146337171 17:31983567-31983589 ACTGCACCCGGCCACACGGAAGG + Intronic
1147773181 17:42881911-42881933 ACTGCACCCAGCCAAATGGATGG + Intergenic
1147900130 17:43778563-43778585 CGTGCACCCCGCCACGGGGAAGG + Intronic
1147912223 17:43862482-43862504 CCTGCACCAAGCCCCAGAGATGG - Exonic
1148341974 17:46878656-46878678 CCTCCACCCAGGCTCAGTGCTGG + Intronic
1149458756 17:56810578-56810600 CCTACACTCAGAAACAGGGAGGG + Intronic
1149558062 17:57588269-57588291 ACAGCACCCAGCCTCAGGGATGG - Intronic
1149657788 17:58319395-58319417 CATCCACCCAGCCCCAGGCCTGG + Intronic
1150124954 17:62629451-62629473 CCTGGACACAGCCCCAGGGAGGG - Intronic
1150131528 17:62671850-62671872 CCTCCACCCAGACACGTGGGCGG - Intronic
1151447336 17:74175872-74175894 CCTCCACCCAGACACACTTACGG + Intergenic
1151537186 17:74745582-74745604 TCTCCCCGCATCCACAGGGAGGG + Exonic
1151727162 17:75891942-75891964 CCTCCACCCCCCCAGCGGGAGGG + Intronic
1151730182 17:75906379-75906401 CCACCACCCAGCCCCAGGAGAGG + Intronic
1152046261 17:77937868-77937890 CATCCTCCCAGCCACAGGCTTGG - Intergenic
1152191817 17:78892758-78892780 CCTCCACCCAGCTGCAGGCCCGG - Intronic
1152244417 17:79177659-79177681 CCTGCACCCAGGCTCTGGGATGG - Intronic
1152306836 17:79526046-79526068 ACACCACCCAGCCACAGTGCAGG + Intergenic
1152450419 17:80375324-80375346 CCTCAACCCACCAAAAGGGAAGG - Intronic
1152609737 17:81309753-81309775 GGTCCACCCAGCCCCAGGAAGGG + Intergenic
1152750429 17:82060082-82060104 CCTCCCCTCAGGCCCAGGGAGGG - Exonic
1153503024 18:5768188-5768210 CTTGCTCCCAGCCACAGGGGAGG - Intergenic
1153655264 18:7276711-7276733 CCTCCATCCAGCCACTGTCATGG - Intergenic
1155317613 18:24588425-24588447 CCATCACCCAGCCACAGGCCAGG - Intergenic
1156228092 18:35128901-35128923 CCTACAGCCAGCCCCAAGGAGGG - Intronic
1156598447 18:38575192-38575214 GCTTCACCCAGGCAGAGGGAGGG + Intergenic
1157601263 18:48894456-48894478 CCGCCTCCCAGCCCCAGGGCAGG - Intergenic
1157622782 18:49025871-49025893 CCTCCTCCTAGCCTCAGGGCGGG + Intergenic
1157853753 18:51084486-51084508 CCTCAACCCAGCCCCAAGGAAGG - Exonic
1159016284 18:63104123-63104145 CCTCCACCCTGCAGCAGAGAGGG - Intergenic
1160246708 18:77165431-77165453 CCTGCATCCAGGCACAGTGAAGG - Intergenic
1160293535 18:77617121-77617143 CCTGCACACAGCCACACTGAGGG - Intergenic
1160514491 18:79470903-79470925 CCTGCCCCCCGCCCCAGGGAGGG - Intronic
1160617241 18:80140603-80140625 CCTGAACACAGCCACAGTGAAGG - Intronic
1160725930 19:617844-617866 CCTCCGCTCTGCCACAGGAAGGG - Exonic
1160816869 19:1040142-1040164 CCTCCGCCCAGCAGCAGGCAGGG - Exonic
1161312773 19:3603968-3603990 CCTCTCCCCAGACACAGGGAGGG - Intronic
1162188738 19:8927864-8927886 CCCTCAGCCAGCCAGAGGGAGGG + Intronic
1163236042 19:16031346-16031368 CCTCCTCCAGGACACAGGGAGGG - Intergenic
1163476670 19:17530564-17530586 CCCTCACCCAGCCACATGGATGG + Intronic
1163760314 19:19132895-19132917 CCCCCACCCACCCACAGGACTGG + Intronic
1164623724 19:29713327-29713349 CCATCTGCCAGCCACAGGGAAGG + Intronic
1165511312 19:36268221-36268243 CCCCCACCCCGCCACGGGGTAGG - Intergenic
1166049870 19:40252262-40252284 CCTCCACCCACCCATAGTTAAGG + Intronic
1167873229 19:52390567-52390589 CCTCCACACATTCATAGGGAGGG - Intergenic
1167874292 19:52398507-52398529 TCTCCACACATTCACAGGGAGGG - Exonic
1202715123 1_KI270714v1_random:38166-38188 GGTCCTCCCAGGCACAGGGAAGG - Intergenic
925147991 2:1593863-1593885 CCTGCTCACAGCCCCAGGGAGGG - Intergenic
925188922 2:1867510-1867532 CCTCTCCCCAGCCAGAGGCAAGG - Intronic
925883184 2:8369885-8369907 CCTCCTCCCACCCACAGCGTGGG + Intergenic
925904017 2:8528564-8528586 CCTCCACCCACCCACACACAGGG + Intergenic
925912780 2:8583999-8584021 CCACAATCCAGCCTCAGGGAGGG + Intergenic
928178916 2:29053898-29053920 CCTCCACCCACTCTCAGGGGCGG + Exonic
929453928 2:42053451-42053473 CCTCCACCCAGGGAGAGGGAGGG + Intronic
930021552 2:47004808-47004830 CCTCCAAGCAGCCACAGGGCAGG - Intronic
931916299 2:66960524-66960546 CTTCCACTCACCCACAGGAAGGG + Intergenic
933089511 2:78103771-78103793 CCTGGACCCAGCCACACTGAGGG + Intergenic
933634882 2:84698031-84698053 CCTTCAGCCCGCCACAGGTAGGG - Intronic
933871093 2:86566248-86566270 CCTCCACCCAGAAACAGGGAAGG - Intronic
933970592 2:87466932-87466954 CTGCCACCCAGCCGCAGGAAAGG + Intergenic
934176166 2:89581963-89581985 CCTCCACCAAGCCATAGGGGGGG + Intergenic
934618150 2:95787959-95787981 CCTGCCCCCAGCCACAGGGAGGG + Intergenic
934642743 2:96036600-96036622 CCTGCCCCCAGCCACAGGGAGGG - Intronic
935571140 2:104661136-104661158 CCTCCACCCTCCCAGAGGCAGGG + Intergenic
935597134 2:104887774-104887796 CCCACGCCCAGCCACAAGGATGG + Intergenic
935648734 2:105363855-105363877 CCTGCTCCCAGCCACAGGGCTGG - Intronic
936323137 2:111483250-111483272 CTGCCACCCAGCCGCAGGAAAGG - Intergenic
936520632 2:113210121-113210143 CCAGCAGCCAGCCCCAGGGAGGG - Intergenic
937919173 2:127118261-127118283 GGTCCACCCAACCTCAGGGAAGG + Intergenic
938469231 2:131544220-131544242 CCCCCACCCCGCCACGGGTAGGG - Intergenic
939060807 2:137419517-137419539 CCTGGACCCAGCCACACTGAGGG - Intronic
939875950 2:147577932-147577954 CCTCCACCAAGCCAGAGAGCTGG + Intergenic
941629629 2:167869620-167869642 CCTCCACCAAGCCACGAAGAAGG + Exonic
941697988 2:168573736-168573758 CCCCCAGCCACCCACAGAGAAGG - Intronic
941928435 2:170917884-170917906 CCTGGACCCAGCCACACTGAGGG - Intergenic
942095793 2:172535590-172535612 CCTCCCCCCAGCTTCATGGAAGG + Intergenic
944106686 2:196086480-196086502 CCTCCTCCCACCCGCAGGCATGG - Intergenic
944143365 2:196480498-196480520 CCATCCCCCAGCCACAGTGATGG + Intronic
946271059 2:218594590-218594612 CCTCTACCTAGCCACTGGCAGGG + Exonic
946816570 2:223584325-223584347 CATCCTCTCAACCACAGGGAAGG - Intergenic
947524272 2:230868866-230868888 TCCCCACGCTGCCACAGGGAAGG - Intronic
947710394 2:232310476-232310498 CGTCCACCCACACAGAGGGATGG + Intronic
948144571 2:235699002-235699024 CCACCAACCAGCCACAGGTATGG - Intronic
948473771 2:238203550-238203572 CCTCCACCCAGCCTCCGCCATGG - Exonic
949070019 2:242018804-242018826 CCTCATCCCAGCAACAGGGAAGG + Intergenic
1171021306 20:21586704-21586726 CCCTCACCCAGCCACAGACAGGG - Intergenic
1172010037 20:31841306-31841328 CCCTCACCCACCCACAGGGCTGG - Intergenic
1172699297 20:36843113-36843135 CTTCCTCCCAGCCCCAGCGAGGG - Intronic
1172897491 20:38310663-38310685 CCTCCTCCCAGCCACAGTCCCGG - Intronic
1173569789 20:44068700-44068722 CTTCCAGCGAGCCTCAGGGATGG - Exonic
1174040786 20:47697909-47697931 CCTCCTCCCAGCCTCAGTGCAGG - Intronic
1174112498 20:48206042-48206064 CCAGCTCCCAGCCCCAGGGAAGG + Intergenic
1174239845 20:49124661-49124683 ACTTCACACAGACACAGGGAAGG + Intronic
1174266585 20:49336430-49336452 CCTCCTCCCAGCATAAGGGAAGG - Intergenic
1174274041 20:49390649-49390671 CCTCCATCCAGCTGCAGGGGAGG - Intronic
1174686406 20:52460032-52460054 TCTCCAGCAAACCACAGGGATGG - Intergenic
1175160337 20:57003535-57003557 CCTGCATCCAGACACAGGGACGG + Intergenic
1175165103 20:57038004-57038026 CTTCCACCCTGCTACATGGAGGG - Intergenic
1175173183 20:57093835-57093857 CCTACAGACAGACACAGGGAAGG - Intergenic
1175943634 20:62549062-62549084 CCTCCGGCCAGCGACAGCGAGGG - Intergenic
1176045277 20:63089478-63089500 CCTGCACCCAGGGACAGAGATGG - Intergenic
1176070178 20:63222161-63222183 CCTCCCCCCACCCCCAGGAATGG - Intergenic
1176191776 20:63814579-63814601 CCTCCTCCCACCCCCAGGCAAGG + Intronic
1178420551 21:32439587-32439609 CCTCCACCGAGCCAATGGGGAGG + Intronic
1178426766 21:32484881-32484903 TCCCCACTCACCCACAGGGAGGG + Intronic
1179842643 21:44087333-44087355 CATCCTCCCAGCCACGAGGAAGG + Intronic
1180969583 22:19808168-19808190 GCCCCACTCAGCCCCAGGGATGG + Intronic
1182062090 22:27405771-27405793 CCTTGGACCAGCCACAGGGATGG + Intergenic
1182115948 22:27756449-27756471 CCACCACTGAGCCCCAGGGAAGG + Intronic
1183107299 22:35623526-35623548 CCTCAACCCAGCCAGTGGGGAGG + Intronic
1183365968 22:37406952-37406974 CCTCCAGGCAGCCACAGGCTTGG + Intronic
1184091400 22:42294855-42294877 CCTCCACCCAACCACAGCACCGG - Intronic
1184261792 22:43321605-43321627 TGTCCACCCAGCCACAGCGAGGG + Intronic
1184369800 22:44075089-44075111 CCTCCACCCCCACACTGGGAGGG - Intronic
1184679384 22:46061968-46061990 CCTCCAGGCAGCCCCAGGGCGGG - Intronic
1184832491 22:46997732-46997754 CCTCCCCCCGCCCACAGAGAGGG - Intronic
1184864831 22:47196297-47196319 CTTCCACCCAGACACTGAGAGGG - Intergenic
1184986798 22:48141366-48141388 CCTCCACCCTGCACCAGGCACGG + Intergenic
1185032733 22:48453204-48453226 CACCCACCCAGCCTGAGGGAGGG - Intergenic
1185154765 22:49186728-49186750 CCTCCACCCACAGCCAGGGATGG - Intergenic
1185310678 22:50152629-50152651 CCTCCGCTTGGCCACAGGGAAGG - Intronic
950067884 3:10127828-10127850 GATCCACCCAGCCAAAGTGATGG - Intergenic
950124291 3:10502023-10502045 CCCCTGCCCAGCCACAGGTATGG - Intronic
950431406 3:12953163-12953185 CCTGCAGCCAGGCACAGGGTGGG - Intronic
950458833 3:13109062-13109084 CCTCCAACCACCAACATGGAAGG + Intergenic
951472693 3:23072778-23072800 TCTCCCCCCAGCCTCAGTGAGGG - Intergenic
953479333 3:43236579-43236601 TCTCCACAAAGCCACAGAGAAGG - Intergenic
953696876 3:45166671-45166693 CCACCGCCCAGCCTCTGGGAAGG - Intergenic
953726707 3:45405853-45405875 CCTTCTCCCAGCCACAGAGATGG - Intronic
954661651 3:52229875-52229897 CTCCCACCCAGCCACAGGCTTGG + Intronic
954713411 3:52515850-52515872 TCCCCACCCTGCCAGAGGGAGGG + Intronic
958592472 3:96175472-96175494 CCTGGACCCAGCCACACTGAGGG + Intergenic
960054500 3:113267575-113267597 CCTGCCCCCAGCCCCAAGGAAGG + Intronic
960065012 3:113362258-113362280 CCTTCACCCAGACACATGGAAGG - Intronic
961535749 3:127569525-127569547 GCTCCAGCCAGCCACGGTGATGG - Intergenic
961575418 3:127831997-127832019 CCTCCCCCCAGCCTCAGTGCAGG - Intergenic
961646096 3:128393577-128393599 CCCCCACCCAGCCACAATGCAGG + Intronic
961823815 3:129588523-129588545 CCTCTCCCCAGCCACAGCGGTGG + Intronic
961871036 3:129988437-129988459 CCACCGCCCAGACACAGGCAGGG - Intergenic
962355190 3:134687767-134687789 CCTCCATCCTGCCACAGGTGTGG - Intronic
962915858 3:139902805-139902827 CCACCCCACAGCCACAGGAAGGG + Intergenic
963063164 3:141241371-141241393 TCTCCACCCAGCCCTGGGGAAGG + Intronic
963846137 3:150159831-150159853 CCTCCTTCCACCCCCAGGGAAGG + Intergenic
964275548 3:155005104-155005126 CTTGTACCCAGCCACAGGGGTGG + Intergenic
965546989 3:169926401-169926423 CCCCCACAAAGCCACTGGGAAGG - Intronic
967753355 3:193140402-193140424 CCTCCAACCAGTCACAGGAGAGG - Intergenic
967851538 3:194086363-194086385 CCTCCACCAAGCGACTGGGATGG - Intergenic
968049236 3:195642742-195642764 CCTCATCCCAGCAACAGGGAAGG + Intergenic
968098166 3:195946888-195946910 CCTCATCCCAGCAACAGGGAAGG - Intergenic
968106671 3:196006400-196006422 CCTCATCCCAGCAACAGGGAAGG - Intergenic
968305379 3:197647192-197647214 CCTCATCCCAGCAACAGGGAAGG - Intergenic
968442336 4:630227-630249 ACTCCCCTCGGCCACAGGGATGG - Intronic
968445598 4:650646-650668 CCGACACCCACACACAGGGAGGG + Intronic
968454384 4:689524-689546 GTTCAAGCCAGCCACAGGGAGGG + Intergenic
968541282 4:1169625-1169647 ACTCCAGCCAGCAACATGGAGGG + Intronic
968584933 4:1411915-1411937 CGGCCATCCAGGCACAGGGAGGG - Intergenic
968584945 4:1411970-1411992 CGGCCATCCAGGCACAGGGAGGG - Intergenic
968584960 4:1412030-1412052 CAGCCATCCAGGCACAGGGAGGG - Intergenic
968584973 4:1412090-1412112 CGGCCATCCAGGCACAGGGAGGG - Intergenic
968731542 4:2271523-2271545 CCTCCAGCCAGCCTCCGGGGGGG + Intronic
968874955 4:3261832-3261854 ACGCCACCCAGTCACACGGAGGG - Intronic
969178120 4:5415489-5415511 ACTCATCGCAGCCACAGGGAGGG + Intronic
969184177 4:5463301-5463323 CCAGCACACAGCCTCAGGGAAGG - Intronic
969821299 4:9722374-9722396 CCTCCACCGAGCCAATGGGGAGG + Intergenic
971473812 4:27053895-27053917 TCTCCAGCCAGTTACAGGGAAGG + Intergenic
972650807 4:41015868-41015890 CCTCCACCCAGTCCAATGGAAGG + Intronic
974560639 4:63512192-63512214 CCTCCACCCACCGACAGGCCAGG - Intergenic
975221726 4:71820359-71820381 CCTGTACCCAGCCATAGTGAAGG - Intergenic
976246729 4:83012598-83012620 CCGCAACCCAGCTTCAGGGAAGG + Intronic
977595143 4:98871078-98871100 CCTTCACCGAGACATAGGGAAGG + Intergenic
982687949 4:158514542-158514564 CCTCCTTCCAGGCTCAGGGATGG + Intronic
984808214 4:183770760-183770782 CCTCCAACCAAGCACAGGGCAGG + Intergenic
985125801 4:186693355-186693377 CGTTCATCCAGCCACAGGTAGGG - Intronic
985505800 5:279582-279604 CCTCATCCCAGCAACAGGGAAGG + Intronic
985742400 5:1626336-1626358 CCTCATCCCAGCAACAGGGAAGG - Intergenic
988066089 5:26229834-26229856 CCTCATCCCAGCAACAGTGAAGG - Intergenic
989011450 5:36876869-36876891 ACACCACCAAGCCGCAGGGAGGG + Exonic
989020536 5:37000549-37000571 CCTCCTCCCAGCCTTAGTGAGGG + Exonic
990566246 5:57032397-57032419 AGTCCAACCAGCCTCAGGGATGG + Intergenic
990620618 5:57555085-57555107 CCTCCAGCCATCCTAAGGGAAGG - Intergenic
990620821 5:57556733-57556755 CCTCCAGCCATCCCAAGGGAAGG - Intergenic
991418070 5:66411989-66412011 CCCCAACCCAGCCACAAGGGAGG - Intergenic
992385920 5:76284641-76284663 CCTCCAGCCAGTCAGGGGGAAGG + Intronic
992530813 5:77650148-77650170 ACCACACCCAGCTACAGGGAAGG + Intergenic
992780763 5:80124910-80124932 CCTCCACACAGTGACAGGGATGG - Intronic
994405097 5:99335133-99335155 CCTGCGCTCAGCCTCAGGGAGGG - Intergenic
995131359 5:108633631-108633653 CCTCAACACAGCCACATGGTTGG + Intergenic
997387859 5:133487785-133487807 CCTCCACTGAGCCACAGCTAAGG + Intronic
997480464 5:134180565-134180587 CCTCAACCCAGGGATAGGGAGGG + Intronic
997558730 5:134824864-134824886 CCTCCCACCAGGCAAAGGGAAGG + Intronic
998129223 5:139643001-139643023 CCCCCAGCTAGCAACAGGGAGGG - Intergenic
998377142 5:141698624-141698646 CCTAGTGCCAGCCACAGGGAAGG + Intergenic
999367142 5:151030459-151030481 TCTCCACTCAGCAGCAGGGAAGG + Exonic
1001052019 5:168421273-168421295 TGCCCACCCGGCCACAGGGAAGG + Intronic
1001647848 5:173295433-173295455 CCCCCCCCCACCCACAAGGAGGG - Intergenic
1001839972 5:174867087-174867109 CCCCCACCCAGCCCCATGGCAGG - Intergenic
1002013129 5:176300609-176300631 ACTGCACCCAGCCACAGAGTTGG + Intronic
1002214707 5:177622139-177622161 ACTGCACCCAGCCACAGAGTTGG - Intergenic
1002563396 5:180097377-180097399 ACCCCGCCCAGCCACAGGCAAGG + Intergenic
1002570405 5:180136624-180136646 CCTCCTCCCTGGCACAGAGAGGG - Intronic
1002870715 6:1165066-1165088 CATCCACCCGGCCACAGGAGAGG - Intergenic
1003180013 6:3783209-3783231 CCTGCACCCAGCCCCAGGGAGGG - Intergenic
1003208624 6:4038550-4038572 ACTGCACCCAGCCACAATGAGGG + Intronic
1003386160 6:5669499-5669521 GCTCTCCCCAGCCACAGTGAAGG - Intronic
1003873921 6:10420876-10420898 CCTCCACCCCACCCCTGGGAAGG - Intergenic
1004273665 6:14216503-14216525 TCTCAACTCAGCCACATGGAAGG + Intergenic
1005813925 6:29535270-29535292 CCTCCTCCAGGGCACAGGGAGGG - Intergenic
1006029861 6:31170731-31170753 CCTCCACCCATCCAGGGGGCGGG - Intronic
1007085369 6:39140684-39140706 TCTCCACCCAGGCACTGGCAGGG + Intergenic
1007114780 6:39335770-39335792 CCTTCACCCAGCCACTTGGGAGG - Exonic
1007429626 6:41769232-41769254 CCTCTACCCTGCCACAAGGCTGG - Intergenic
1007637413 6:43307779-43307801 CCAGCTCCCAGCCACAAGGAGGG + Intronic
1007711914 6:43829927-43829949 ACCCCACCCATCCACAGGCAAGG - Intergenic
1010378900 6:75205119-75205141 CCTCCACCAATGCACCGGGAGGG + Intronic
1011970800 6:93220291-93220313 CATGCAACTAGCCACAGGGATGG - Intergenic
1015255038 6:131169588-131169610 CCTCCACCCAGTCCCCTGGAGGG + Intronic
1015793853 6:136990724-136990746 CTTCAACCCAGCCACAGAAAAGG - Intergenic
1016864502 6:148751626-148751648 CCTCCACCCAATCTCAGGGTGGG - Intronic
1017026516 6:150186021-150186043 CCTCCTTCCAGCGACAGGGTAGG - Intronic
1017030097 6:150213575-150213597 ACTCCTTCCAGCCACAGGGATGG - Intronic
1018068066 6:160137513-160137535 CCTGCACCCAGCCACATGCTGGG + Intronic
1018434059 6:163745189-163745211 CCACCATGAAGCCACAGGGATGG - Intergenic
1018668831 6:166163222-166163244 CCTCCTGCCACCCACAGAGACGG + Intronic
1019328372 7:450795-450817 CCCCAACCCACCCACAGGCAGGG + Intergenic
1019437010 7:1027746-1027768 CCTCTACCCCGGCACAGGGAGGG + Intronic
1019569871 7:1705938-1705960 CCTTCACCCTGACAAAGGGATGG + Intronic
1021147019 7:17101567-17101589 CCCAGACCCAGCCACAGGGAAGG - Intergenic
1021839811 7:24713458-24713480 CCTGAACCCCGTCACAGGGAAGG + Intronic
1022261408 7:28708408-28708430 CCTCCACCCAGCCACTCGCTGGG - Intronic
1022417700 7:30192119-30192141 GCTCAACCCAGCCACAGGACAGG + Intergenic
1023587264 7:41743738-41743760 CCTCCACCCAACTGCTGGGATGG + Intergenic
1023861758 7:44220957-44220979 CCTCCACACAGCCCAGGGGAGGG + Intronic
1024009045 7:45252342-45252364 CCAGAACCCAGCCCCAGGGATGG + Intergenic
1024567895 7:50697820-50697842 CCCCCACCCCACCCCAGGGAGGG + Intronic
1025017312 7:55449623-55449645 ACCCCAGCCAGTCACAGGGAGGG - Intronic
1026589688 7:71684143-71684165 CCTGCACCCAGGCCCAGGGTGGG + Intronic
1027037992 7:74940185-74940207 CCTCCACCCTTCCACAGCCATGG + Intergenic
1027085569 7:75261289-75261311 CCTCCACCCTTCCACAGCCATGG - Intergenic
1029306548 7:99624088-99624110 CCTCCACTCCTCCTCAGGGAAGG - Exonic
1029457175 7:100677273-100677295 CCTTCTCCCACCCAAAGGGAAGG + Intronic
1029642240 7:101828630-101828652 CCTTTGCCCAGACACAGGGACGG - Intronic
1032263793 7:130356484-130356506 CCTTCCCCCAGCCCCAGGAATGG + Intronic
1033339261 7:140479214-140479236 CCTCCGCCCGCCCCCAGGGACGG + Exonic
1035439141 7:158881360-158881382 CCTCTAGTCAGCCACACGGAAGG + Intronic
1035688949 8:1547390-1547412 CCTCCACCCAGACACAGCTGTGG - Intronic
1035830239 8:2687573-2687595 CCTCTGACCAGCCACAGGGTTGG - Intergenic
1037789121 8:21920430-21920452 CGTCCCCCTAGCCACAGTGAAGG + Intronic
1039665529 8:39522819-39522841 CGGCGGCCCAGCCACAGGGATGG + Intergenic
1040072858 8:43202364-43202386 CCTCCACACAGCCACGGGCTCGG - Exonic
1040081854 8:43292788-43292810 CCTCCTCCCAGCCCCAGGCCCGG - Intergenic
1043694810 8:83204881-83204903 ACTCTACAAAGCCACAGGGATGG + Intergenic
1045137136 8:99233376-99233398 CCTCCATCAAGGCCCAGGGACGG - Intronic
1045323248 8:101097884-101097906 CCTCCACCCACCCTCTGAGATGG + Intergenic
1049277325 8:141726327-141726349 CCTCCCGCCAGCCACAGTGGTGG + Intergenic
1049488261 8:142877528-142877550 CCTCCCCCCTACTACAGGGAGGG - Intronic
1049660905 8:143819331-143819353 CCTCCCCACACCCTCAGGGACGG + Intronic
1051264870 9:15300594-15300616 ACTGCAACCAGCCACATGGAAGG - Intronic
1052081329 9:24209747-24209769 CCTCCCCGCCACCACAGGGATGG + Intergenic
1052876732 9:33573619-33573641 TCTCCTCCAAGACACAGGGAGGG - Intergenic
1053499269 9:38570768-38570790 TCTCCTCCAAGACACAGGGAGGG + Intronic
1055893041 9:81143473-81143495 TCTCCATCCAGACACAGGGTGGG - Intergenic
1056454408 9:86746167-86746189 CATGCCCCCACCCACAGGGATGG - Intergenic
1057162329 9:92897100-92897122 TCTCCTCCAAGACACAGGGAGGG + Intergenic
1057678688 9:97155248-97155270 TCTCCTCCAAGACACAGGGAGGG + Intergenic
1058706106 9:107639033-107639055 CCTCCTCCAGGCCACAGGGCAGG + Intergenic
1058719702 9:107752483-107752505 TATCCATCCAGCCACAGAGATGG + Intergenic
1059472748 9:114518965-114518987 CCTCCACCCAGCCAAGGGAGGGG + Intergenic
1060148018 9:121268503-121268525 CCTCGACCCCGCCCCCGGGATGG + Intronic
1060209680 9:121701933-121701955 CCTCTCCCCAGCCAGAGGCATGG - Intronic
1060406577 9:123375891-123375913 CCCCCACCCCGCCCCAGGAAGGG - Intronic
1060423622 9:123486881-123486903 CCCCTGCCCAGCCACAGGGGTGG + Intronic
1060793809 9:126501896-126501918 ACTGCACCCAGCCCCAGGGAGGG - Intronic
1061044197 9:128155715-128155737 CCTAGACCCAGCCACACTGAGGG + Intergenic
1061431381 9:130533416-130533438 CCCCCACCCAGCCCCAGTGCTGG - Intergenic
1061536655 9:131254479-131254501 CCTGCACACAGGCACAGAGATGG + Intergenic
1061564150 9:131426530-131426552 CCTGGACCTAGCCTCAGGGAGGG + Intronic
1061613193 9:131762393-131762415 CCTTGACCCAGCCACTGGGAGGG + Intergenic
1061990868 9:134157840-134157862 CCCCGACCCAGGCGCAGGGATGG + Intronic
1062080053 9:134619011-134619033 CCTCCAGGCAGCCTCAGGGGTGG + Intergenic
1062090956 9:134678661-134678683 CAGCTGCCCAGCCACAGGGAAGG - Intronic
1062199265 9:135292868-135292890 CCTCCACCCAGCCGGAGAGGTGG - Intergenic
1062209605 9:135356571-135356593 CCTCCACCCCGCTGCTGGGAAGG - Intergenic
1062307672 9:135918840-135918862 CCCCCTCCCAGCCACTGGAATGG + Intergenic
1062454681 9:136629931-136629953 CCTCCCCCCTGCAACAGGCAGGG - Intergenic
1062730425 9:138105377-138105399 CCTACATTCAGCCACAGGCAGGG + Intronic
1186356717 X:8799272-8799294 TCTGCAGCCAGCCCCAGGGAGGG - Intronic
1186357045 X:8800387-8800409 TCTGCAGCCAGCCCCAGGGACGG - Intronic
1187384893 X:18839459-18839481 CCTCCAGCTAGGAACAGGGAAGG + Intergenic
1189139337 X:38585010-38585032 CCTCCAAGCAGCAACATGGATGG - Intronic
1193049265 X:77083604-77083626 CCTCCACCCAGCCAGAGAGGTGG - Intergenic
1199569621 X:149254528-149254550 CCCCCACCCAGTCACAGACATGG + Intergenic
1202039267 Y:20665687-20665709 ACTCCGCCAAGCCACAGGGTTGG - Intergenic
1202242421 Y:22785533-22785555 CCCTCAGCCAGCCACAGAGAGGG - Intergenic
1202395406 Y:24419282-24419304 CCCTCAGCCAGCCACAGAGAGGG - Intergenic
1202475379 Y:25250810-25250832 CCCTCAGCCAGCCACAGAGAGGG + Intergenic