ID: 1113554065

View in Genome Browser
Species Human (GRCh38)
Location 13:111216894-111216916
Sequence TCTGAAAGGCAGAAAGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1014
Summary {0: 5, 1: 2, 2: 19, 3: 100, 4: 888}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113554065_1113554068 28 Left 1113554065 13:111216894-111216916 CCTTCCTCTTTCTGCCTTTCAGA 0: 5
1: 2
2: 19
3: 100
4: 888
Right 1113554068 13:111216945-111216967 AAAATGCGAATTAAAATACGAGG 0: 1
1: 0
2: 0
3: 19
4: 211

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113554065 Original CRISPR TCTGAAAGGCAGAAAGAGGA AGG (reversed) Intronic
900527266 1:3135335-3135357 TCTGCAAGGCAGGAAGAGCTGGG - Intronic
900810572 1:4798569-4798591 TTGGACAGGCAGGAAGAGGAGGG - Intergenic
900908760 1:5579272-5579294 TCTGGAAAGCAGAATGAGCAAGG - Intergenic
901267420 1:7922364-7922386 TCAGAAAGGCAGAGAGAGGAAGG + Intronic
902773242 1:18658334-18658356 TCTGGAAGACAGCAAGAGAAGGG + Intronic
902868765 1:19299489-19299511 TATGAAAGACTGAAGGAGGAGGG - Intergenic
903020831 1:20392878-20392900 TCTGAAAGGTGGAGAGAAGAAGG + Intergenic
903254147 1:22081289-22081311 TCTGAAAGGAAGAAAGGTCATGG + Intronic
903375585 1:22863753-22863775 TCTGAATGGCAGAAAGAGCCAGG - Intronic
903382860 1:22909000-22909022 CCTGGGAGACAGAAAGAGGAGGG - Exonic
903443098 1:23402928-23402950 GCTGAAATGTGGAAAGAGGAAGG + Intronic
904790890 1:33020039-33020061 TCTGGAAGGCACAAAGCAGATGG + Intronic
904852860 1:33472518-33472540 TCTGAAAGGCAGCAAACGGAGGG + Intergenic
905284207 1:36868733-36868755 TCACCAAGGGAGAAAGAGGAAGG - Intronic
905659969 1:39714325-39714347 ACTGCAAGGCTGAAGGAGGAAGG + Intronic
906013677 1:42553348-42553370 TTTGAAAGGTGGAAAGAAGAAGG - Intronic
906182416 1:43833699-43833721 AATGAGAGGCAGAAAGGGGAAGG + Intronic
906935787 1:50212960-50212982 ACTGTGAGGCAGGAAGAGGAAGG - Intergenic
907025298 1:51111956-51111978 TCTAAAAGGTAAAATGAGGATGG - Intronic
907221742 1:52911978-52912000 TCTCTGAGGCAGAAAGAGCAAGG - Intronic
907626384 1:56034453-56034475 TCTGAGAACCAGAAATAGGAAGG + Intergenic
907699083 1:56765785-56765807 TCTGAAAGGTAGAGAGAAGAAGG - Intronic
907923923 1:58938442-58938464 GCTGAACGGCAGCAAGACGAGGG - Intergenic
908280326 1:62527193-62527215 TCTTAAAGGCAGAAGGATCAGGG - Intronic
908530291 1:65027562-65027584 TGTGAAAGGCAAAAGGAAGAGGG + Intergenic
909292798 1:73905259-73905281 ACTGAAGAGGAGAAAGAGGAAGG + Intergenic
909483735 1:76151866-76151888 TCTGGAATTCAGAAAGATGATGG + Intronic
909852459 1:80485802-80485824 TATGAAAGGCAGAAATAGTCAGG - Intergenic
910287397 1:85570948-85570970 GCAGAAATGTAGAAAGAGGACGG + Intronic
910399763 1:86826766-86826788 TGTGAAGGGCAGAGAAAGGAAGG + Intergenic
910402548 1:86851890-86851912 TCTGAAAGGCAGAACAAGAGTGG - Intergenic
910865357 1:91783350-91783372 TCTGAAAGGCTGAAATATCAAGG - Intronic
912187257 1:107292971-107292993 TCTGAAGGGCATAAGGCGGAAGG - Intronic
912453140 1:109779782-109779804 TCCGAAAGGGAGCAATAGGAAGG + Intergenic
912520169 1:110239807-110239829 TCTAAAAGGAAGAGAGAGGAAGG - Intronic
912569498 1:110611003-110611025 GCTTAAAGACAGAATGAGGAAGG + Intronic
912705494 1:111908829-111908851 TGTGAAAGGGAGAAGGAGGGGGG + Intronic
913098299 1:115540349-115540371 TCTGTACTGCAGACAGAGGATGG - Intergenic
914194033 1:145435223-145435245 TAAGAAAGGCAGGAAGAGGCCGG + Intergenic
914347985 1:146816074-146816096 GCTGAAGGGGAGAGAGAGGAAGG - Intergenic
914475365 1:148018120-148018142 TAAGAAAGGCAGGAAGAGGCCGG + Intergenic
914666235 1:149835206-149835228 TCTCAAAAAAAGAAAGAGGAAGG - Intergenic
914669532 1:149858592-149858614 TCTCAAAAAAAGAAAGAGGAAGG + Intronic
915502688 1:156330226-156330248 CCTGGAAGGATGAAAGAGGAGGG - Intronic
916266375 1:162893545-162893567 TGTGAAATGCAGGAAGGGGAAGG - Intergenic
916419731 1:164625860-164625882 ACAGAAAGGCAGAAGGAGGGTGG - Intronic
916686244 1:167149943-167149965 TCTGGCAGGAAGAAAAAGGAAGG - Intergenic
916828672 1:168468576-168468598 TCTTTCAGGCAGAAAGAGGAGGG + Intergenic
917441664 1:175074031-175074053 GCTGCATGGCAGAGAGAGGAAGG - Intronic
918282430 1:183020428-183020450 TCTGAAAGACAGAGAGAAAAAGG - Intergenic
918368736 1:183837425-183837447 TCTGAATGAGAGAAAAAGGAGGG + Intronic
918703575 1:187635477-187635499 AGTGACAGGGAGAAAGAGGATGG - Intergenic
918703741 1:187636759-187636781 TCTGAACAGCAGAAAGAGGGTGG + Intergenic
919938194 1:202268714-202268736 TTTGAGAGGAAGAAAGAGGCTGG - Intronic
919979062 1:202631069-202631091 ACTGACAGCCAGAGAGAGGAAGG + Intronic
920367180 1:205454351-205454373 TCCTAAAGGCATGAAGAGGAAGG - Intronic
920709210 1:208278954-208278976 TCTGGAAGCCTGAAAGAGGGTGG + Intergenic
921166637 1:212512870-212512892 ACTCAAAGGCAGAGAGAAGAGGG + Intergenic
921199950 1:212794689-212794711 TCTTGAAGTCTGAAAGAGGAAGG + Intronic
921315431 1:213886008-213886030 TCAGAGATGCAGAGAGAGGAAGG - Intergenic
921412288 1:214848759-214848781 GCTGAAAGGCAGGAGGAAGATGG - Intergenic
921783319 1:219195556-219195578 TGGGAAAGGAAGAGAGAGGATGG - Intronic
922174111 1:223181690-223181712 TCTGAAAGGCAGAGAGAAGGAGG + Intergenic
922321047 1:224487385-224487407 ACAGAAAGACAGAAGGAGGAAGG - Intronic
922549226 1:226481848-226481870 TCTGGAAGACAGAAAGCAGAGGG - Intergenic
922710081 1:227822016-227822038 TTAGAAAGGAAAAAAGAGGAAGG - Intronic
922961106 1:229646213-229646235 TCAGACAGGCAGTAAGAAGAGGG + Intronic
923045948 1:230355756-230355778 TTTGCAAGGCAGAGAGAAGAAGG + Intronic
923135066 1:231110216-231110238 TCTGAAAGGTAGAAAGAAGAAGG + Intergenic
923632432 1:235660240-235660262 TCTGAAAGAATGTAAGAGGAAGG - Intergenic
923705010 1:236336893-236336915 TCAGAAAGGCAGGAAGTGGCTGG + Intergenic
924095815 1:240549746-240549768 TTGGCAAGGCAGAAAGGGGAAGG + Intronic
924502178 1:244647996-244648018 ACTGGAAGGCAGGAGGAGGAGGG + Intergenic
924612093 1:245581911-245581933 TGTCAAAGAGAGAAAGAGGAAGG + Intronic
924735283 1:246750095-246750117 TTCGAACAGCAGAAAGAGGATGG - Intronic
924799463 1:247317171-247317193 TCTGAAAGGTGGAGAGAGGGTGG + Intronic
1062999843 10:1906129-1906151 CCTGAAAGGAAGAAAGAAGGAGG + Intergenic
1063382450 10:5594341-5594363 TCTGCAAGGCAGAGGGAGGGAGG - Intergenic
1063514516 10:6681935-6681957 TTTTTCAGGCAGAAAGAGGAAGG + Intergenic
1064426594 10:15234987-15235009 ACTGCCAGGCAGAAAAAGGAGGG + Intronic
1064676534 10:17765598-17765620 TCTGAAAGGGAGAAATTGGAAGG + Intronic
1064718790 10:18206563-18206585 TCTGAAAGCCAGAGAGTGGCTGG - Intronic
1064885486 10:20106725-20106747 TCTGAAAGGCCGAGAGTTGAAGG - Intronic
1064979394 10:21151039-21151061 ACTGAAAGGCAGAGACGGGAAGG + Intronic
1065269910 10:24018063-24018085 TCTGTAAAGCAGAAAGAAGCTGG - Intronic
1066345637 10:34582869-34582891 GCAGAAAGGAAGAAAGAAGAAGG - Intronic
1066499300 10:35974483-35974505 TCTCACAGGGAGGAAGAGGAAGG - Intergenic
1067022639 10:42815022-42815044 TCTGAAAGGTGGAAAGAAAAAGG - Intronic
1067179797 10:43976144-43976166 TCTGAGAGGTGGAAAGAGCAAGG - Intergenic
1067192158 10:44080723-44080745 TCTGAAAGGTACAGAGAAGAAGG - Intergenic
1067410987 10:46064390-46064412 TCTTAAAGTCAAAAGGAGGAGGG + Intergenic
1067537727 10:47126997-47127019 TCTGAAAGGTGGGAAGAGGAAGG + Intergenic
1067968853 10:50945991-50946013 TTAGGGAGGCAGAAAGAGGATGG - Intergenic
1068656285 10:59579265-59579287 TCTGAAAGGTGGAGAGAAGAAGG - Intergenic
1068870971 10:61944069-61944091 TTTGAAAAGGACAAAGAGGAGGG - Intronic
1069041768 10:63703317-63703339 GATGAAAGTCAGAAAGAGAAGGG - Intergenic
1069053722 10:63821795-63821817 TGTGAGAAGCAGAAAGAGGCAGG - Intergenic
1069224030 10:65919125-65919147 TTTGAAAGACAGAGAGAGGCAGG + Exonic
1070026548 10:72637499-72637521 TATGAAAGGGAGAAGGAAGACGG + Intergenic
1070427719 10:76305415-76305437 CATGAAAGAAAGAAAGAGGAAGG - Intronic
1070453035 10:76581099-76581121 TGGAAGAGGCAGAAAGAGGAAGG + Intergenic
1070479031 10:76863113-76863135 TCTGTAAAGCAAAAATAGGAGGG - Intergenic
1070520025 10:77244507-77244529 TGTGGAAGGGAGAAGGAGGAAGG + Intronic
1070956969 10:80470508-80470530 CCTGAAAGGCATAAAGATTATGG - Intronic
1071102295 10:82053294-82053316 TATTAAAGGCAGAAGGATGAGGG + Intronic
1071163755 10:82781153-82781175 TCTGAGATGTGGAAAGAGGAAGG - Intronic
1071497418 10:86178710-86178732 TCTCAAAGGCAGAAAGGGCCAGG - Intronic
1071782037 10:88856709-88856731 TCTGAAAGGTATAAATAGGCTGG - Intergenic
1071794098 10:88987043-88987065 TGGGAAAGGAAGAGAGAGGACGG - Intronic
1072043375 10:91630866-91630888 TCTGGAATGCAAAAAGAAGAGGG + Exonic
1072217442 10:93299359-93299381 TCTTAGAGGCAGCAAGAGCATGG - Intergenic
1072391704 10:94994000-94994022 TCTGGACAGCAGAAAAAGGATGG - Intergenic
1072457260 10:95587786-95587808 TCTGAAAGGTAGGAGGAAGAGGG + Intergenic
1073452440 10:103617811-103617833 TCTGAAGGTCAGACAGAGGAAGG - Intronic
1073563077 10:104513466-104513488 TCACAAAGCCAGCAAGAGGAAGG - Intergenic
1073682208 10:105716793-105716815 TGTAAAAGAAAGAAAGAGGAAGG - Intergenic
1074460233 10:113629942-113629964 TCTGAAAGGCAGCATCATGAGGG + Intronic
1075586795 10:123664466-123664488 AGTGAAAGCCAGAAAGAGAAGGG - Intergenic
1076238306 10:128882952-128882974 TCTGGAAAGCACAATGAGGAAGG + Intergenic
1076420277 10:130326743-130326765 TCTGAAAAGCAATAATAGGAAGG + Intergenic
1077199029 11:1296393-1296415 TCTGAGGGGAAGAGAGAGGATGG + Intronic
1077244507 11:1529678-1529700 ACTAAATGGCAGGAAGAGGAAGG + Intergenic
1077454811 11:2672129-2672151 TTTGAAAGGCCCAAAGAGGGAGG - Intronic
1077531199 11:3096090-3096112 TCTGCAAGGGAAAAACAGGAGGG + Intronic
1078138344 11:8671449-8671471 TCTCCAAGGCAGAGAGAGAATGG - Intronic
1078433986 11:11309520-11309542 TGTAAAAGGCAGAAAAAGTAAGG - Intronic
1079415211 11:20228264-20228286 TCTGGAAGGCAAAAAGAGAAGGG - Intergenic
1079458036 11:20653512-20653534 TCTGGAGGGGAGACAGAGGATGG + Intronic
1079570892 11:21942259-21942281 TCTGAAAAGTAAAAAGAAGAAGG - Intergenic
1079827476 11:25214876-25214898 TAAGAAAGGAAGAAAGGGGAGGG - Intergenic
1080280087 11:30546904-30546926 TCTGCAAGGGATAAAGAGGTAGG - Intronic
1080638652 11:34145354-34145376 TCTCAAAGGAAGAAAAAGAAAGG - Intronic
1080639910 11:34152584-34152606 TCTGTAGGGCAGAGAGAGGAGGG + Exonic
1080849254 11:36054132-36054154 TCTGAAATGCAGAAAATGGGGGG - Intronic
1081041894 11:38223741-38223763 TCCGAACAGCAGAAAAAGGATGG - Intergenic
1081073741 11:38642587-38642609 TCTGAAAGGAAGAATAAGGCAGG - Intergenic
1081270146 11:41073298-41073320 TGAGAAAGGAAGCAAGAGGAGGG + Intronic
1081525491 11:43924897-43924919 TAGGAAAGTCAGAGAGAGGAGGG + Intergenic
1081932490 11:46881701-46881723 ACTGGATGGCAGTAAGAGGAAGG - Exonic
1082181420 11:49124683-49124705 TCTGAAAGACTAAAATAGGATGG + Intergenic
1082207407 11:49454875-49454897 TCAGAAAGGCAGAAATCTGAGGG - Intergenic
1082251762 11:49990170-49990192 TCTGAGGAGCAGAAAGAGAAAGG - Intergenic
1082778747 11:57269756-57269778 CCTGAAAGGCAGACAGAGGCTGG - Intergenic
1082782422 11:57298099-57298121 TCCAAAAGGGAGAAATAGGAAGG - Intergenic
1083415354 11:62521984-62522006 TCTGAAAGGTCCAAAGATGAAGG - Exonic
1083818487 11:65151625-65151647 TTTGAAAGGAAGAGAGAGGTTGG + Intergenic
1083920168 11:65778180-65778202 CGGGAAAGGCAGAAAGAGGTCGG + Exonic
1084493869 11:69492576-69492598 TCTGGAAGCCAGAAAGGGCAAGG + Intergenic
1084574439 11:69979825-69979847 CCCGAAAGACAGAAAGAGAAGGG - Intergenic
1085003540 11:73062820-73062842 TCTGAAAGGGACAAGGAGAATGG + Intronic
1085213123 11:74800847-74800869 GCTGAAAGGCTGAATGAAGAGGG - Intronic
1085247098 11:75111118-75111140 TATGAAAGGGAGAAAGAAGAAGG + Intronic
1085478138 11:76800602-76800624 TGTGAAAGGCATAAAGAGGCTGG - Intergenic
1085697220 11:78715283-78715305 TCAGAAAAGCAGAAAGATCAAGG - Intronic
1085713350 11:78850670-78850692 TCAGAAAGGCAGCAAGAGAAAGG + Intronic
1085855837 11:80174698-80174720 AGAGAGAGGCAGAAAGAGGAAGG + Intergenic
1086285813 11:85249584-85249606 ACTGAAATGAAGAAAGAGGCAGG + Intronic
1086439600 11:86814865-86814887 TCTGAGAGGCAGAAAGTGCAGGG + Intronic
1086461787 11:87013068-87013090 TCTGAGAGGCACAATGTGGATGG - Intergenic
1086464458 11:87038371-87038393 CCTGCAAGGGAGAAGGAGGAGGG + Intronic
1086513237 11:87583565-87583587 TGTGCAAGGGAGAAGGAGGAAGG - Intergenic
1086543322 11:87938844-87938866 TCTGAAAGGTAGAGAAAAGAAGG - Intergenic
1086684070 11:89710163-89710185 TCTGAAAGACTAAAATAGGATGG - Intergenic
1086987516 11:93266534-93266556 TTAGAACAGCAGAAAGAGGATGG + Intergenic
1087101317 11:94367978-94368000 TCAGAAAGGTACAAAGTGGATGG + Intergenic
1087171742 11:95056564-95056586 TATGAAATACAGAAAGAGGGCGG + Intergenic
1087472370 11:98592723-98592745 TCAGAAAGGAAGAAAGAGCAAGG + Intergenic
1087694602 11:101362224-101362246 ACAGAAAGACAGATAGAGGAAGG + Intergenic
1087736980 11:101845360-101845382 TCTGAAAAGCAGAATGAGGAAGG - Intronic
1087741206 11:101889229-101889251 AAAGAAAGGAAGAAAGAGGAAGG + Intergenic
1088108062 11:106228009-106228031 TCTGAACAGTGGAAAGAGGATGG + Intergenic
1088565999 11:111173661-111173683 TTAAAAAGGAAGAAAGAGGAAGG + Intergenic
1089374476 11:117984933-117984955 TCTGAAATGCAGAAAAGGCAAGG + Intergenic
1090069815 11:123534321-123534343 GCTGAGAAGGAGAAAGAGGAGGG + Intronic
1090130943 11:124141623-124141645 GCTGAGATGCAGAAGGAGGACGG - Exonic
1090679129 11:129034502-129034524 CCAGAAAGAAAGAAAGAGGAGGG - Intronic
1090711218 11:129387456-129387478 ACTGAAAGAGAGAGAGAGGAAGG + Intronic
1090762443 11:129849301-129849323 TCCAAAAGGGAGAAACAGGAAGG + Intronic
1091321218 11:134653350-134653372 ACTGAAAGGTAGAAAGAGCAAGG - Intergenic
1091805440 12:3352716-3352738 TCTGCAATGCTGAATGAGGAGGG - Intergenic
1091868137 12:3860595-3860617 TCTGAAAGGGAGAAAAAGGAAGG - Intronic
1091963416 12:4718494-4718516 TCTGAAAGGTAGAGAGAACAGGG - Intronic
1092108259 12:5939688-5939710 TCCGAAAGGTAGAAAGCGCATGG + Intronic
1092121361 12:6046279-6046301 TTTGAAAGAGAGAAAGAGAAGGG - Intronic
1092193063 12:6534066-6534088 TTTGAAAGAAAGAAAGGGGAGGG + Exonic
1092633068 12:10406638-10406660 TCTGAAAGGTGGAAAGAGGAAGG + Intronic
1092818512 12:12331703-12331725 TCTGACAGGGAGGAGGAGGAGGG + Intronic
1093134172 12:15430257-15430279 TCTAAAAGGCAGGCAGAAGAAGG + Intronic
1093160831 12:15744292-15744314 TCTCATAGGGTGAAAGAGGAAGG - Intronic
1093818405 12:23579252-23579274 TCTGAAAGCCAAAAAGTGCAAGG + Intronic
1093920631 12:24855868-24855890 TTTGAAAGGCTGAAGAAGGAGGG - Intronic
1094373038 12:29758969-29758991 TATGTAAGGAAAAAAGAGGATGG + Intronic
1094399546 12:30047030-30047052 TCAGAAAGGAAGAAATAGGTAGG + Intergenic
1094422772 12:30289274-30289296 TCTGAAAAGAATACAGAGGAAGG - Intergenic
1095528611 12:43158024-43158046 TGAGAAAAGCAGCAAGAGGATGG + Intergenic
1095631179 12:44379129-44379151 AAAGAAAGGAAGAAAGAGGAGGG + Intronic
1096012381 12:48230831-48230853 TTTGAAAGCCAGAAAGAAGTAGG + Intergenic
1096944198 12:55386026-55386048 TCTCAAAAACAAAAAGAGGAAGG - Intergenic
1097285995 12:57877922-57877944 CATGAAAGGCAGAGAGAGAAGGG + Intergenic
1098024902 12:66191085-66191107 ACTCAAAAGCAGACAGAGGATGG + Intronic
1099250014 12:80242932-80242954 TCTTAGAAGCAGAAACAGGACGG - Intronic
1099298625 12:80863141-80863163 TTTGATAGAAAGAAAGAGGAAGG + Intronic
1099491056 12:83288548-83288570 GCTGAAGAGAAGAAAGAGGAGGG - Intergenic
1099904443 12:88755715-88755737 TCTGATAGGAAGTAAAAGGAAGG + Intergenic
1100674536 12:96852162-96852184 TCTAAAAGGAACAAAGTGGAGGG + Intronic
1101077077 12:101141590-101141612 TCTGAGAAGTAGACAGAGGATGG + Intergenic
1101123643 12:101609058-101609080 TCTGAAAAGGAGAAGGAGAAGGG + Intronic
1101780984 12:107835349-107835371 TCTGAAATGCAGAAATGTGAAGG - Intergenic
1101813330 12:108126703-108126725 TGTGAAAGGGAGAATGAGGTTGG - Intergenic
1102079405 12:110085902-110085924 CCTGAGAGGGAGAAAGTGGAAGG + Intergenic
1102569862 12:113820855-113820877 AGTGAAAGGTAGCAAGAGGAGGG - Intronic
1102654811 12:114473151-114473173 TCTGAGAGACAGAGAGAGAAAGG - Intergenic
1102663345 12:114548696-114548718 TTTAAAAGGCAGAAATAGGGTGG - Intergenic
1102959860 12:117085414-117085436 TCGGGAAGGCAGAAGGTGGAAGG + Intronic
1103463492 12:121123523-121123545 CCTGAGAGGGAGAAAGTGGAAGG - Intergenic
1104787782 12:131460807-131460829 TCATAAAGGCAGGAAGGGGAGGG + Intergenic
1105211708 13:18260986-18261008 TTTGTTAGGCAGAGAGAGGAAGG - Intergenic
1106350419 13:28924219-28924241 TCTGAAAGGTGTAAAGAGAATGG - Intronic
1106895741 13:34300426-34300448 CCTCAAAGGCAGAAAGAGAAAGG + Intergenic
1106938553 13:34750686-34750708 TCTCAAAGACAGAGAGAGAAAGG + Intergenic
1107135665 13:36941253-36941275 TCTGAAAGGTGAAAAGAAGAAGG - Intergenic
1107258998 13:38468119-38468141 TCTGAAAGGTAGAGAGAAGATGG - Intergenic
1107306286 13:39023564-39023586 TCTAAAAGGAGGAAAGAGGGTGG - Intronic
1107383666 13:39884076-39884098 TCTGAAGAGCAGAAAGAAAAAGG + Intergenic
1107525918 13:41231131-41231153 TATTAAAGACAGAAAGTGGATGG + Intronic
1107599427 13:41998205-41998227 TTTGAAAGTGACAAAGAGGATGG - Intergenic
1107965954 13:45598488-45598510 TCAGACAGCCAGAAAGAGGCAGG - Intronic
1108454528 13:50599575-50599597 TCTGCAAGAGAGAAGGAGGAAGG - Intronic
1108494226 13:51008135-51008157 ACTGAAAAGCAGAAGGAGAAAGG - Intergenic
1108562869 13:51664047-51664069 AATGAAAGGAAGAAAGTGGAAGG + Intronic
1108581703 13:51833613-51833635 TGTGAGGGACAGAAAGAGGAGGG + Intergenic
1108605111 13:52029822-52029844 TCTGAGAGTGAGGAAGAGGAGGG + Exonic
1108912734 13:55577144-55577166 TGTGATATGCAGAAAGGGGAAGG - Intergenic
1109156228 13:58913465-58913487 TCTGAAAGGTAGAAAGAAGAAGG + Intergenic
1109317204 13:60764348-60764370 TGTTAAAGGCAGACAGAGAAAGG - Intergenic
1109821627 13:67664629-67664651 CCTGAAGGGCAGAGAGAAGAGGG + Intergenic
1110195723 13:72785661-72785683 TGTGAAATGCAAAAAGAGTAAGG - Intronic
1110345166 13:74438597-74438619 TCTGAGGAGCAGAAAGGGGAGGG - Intergenic
1110408919 13:75183061-75183083 TCTGAAAGGTAGTAAGAAGAAGG + Intergenic
1110581887 13:77139407-77139429 TCTGCAAAGCAGAAAAATGATGG + Intronic
1111172260 13:84542499-84542521 TCTAAAAGGCAAATAGAGAAAGG - Intergenic
1111225138 13:85260934-85260956 TCTTAAAGGGAGAAGGAAGAGGG + Intergenic
1111517090 13:89348686-89348708 ACTGAAAGTGAGAAACAGGATGG + Intergenic
1111995029 13:95157484-95157506 GAAGAAAGGAAGAAAGAGGAAGG + Intronic
1113186968 13:107698839-107698861 TCTGACAGAAAGAAAAAGGAGGG - Intronic
1113554065 13:111216894-111216916 TCTGAAAGGCAGAAAGAGGAAGG - Intronic
1113726626 13:112608268-112608290 TCTGAACAACAGAAAGAAGATGG + Intergenic
1113983488 13:114295583-114295605 TCAGAGACGCAGGAAGAGGAGGG - Intronic
1114034966 14:18615408-18615430 TCTCAAAGGCAGTGACAGGAAGG + Intergenic
1114123680 14:19699608-19699630 TCTCAAAGGCAGTGACAGGAAGG - Intergenic
1114146062 14:19979652-19979674 GCTGAATAGCAGAAAAAGGATGG + Intergenic
1114746380 14:25152562-25152584 TCTGAGAGGCATAAAGAGAGAGG - Intergenic
1114764920 14:25360065-25360087 TCTTGAAGGCAGAAAGAAAAAGG - Intergenic
1114823140 14:26045791-26045813 TGGGAAAGGCATAAAGAGAAGGG - Intergenic
1114832182 14:26157724-26157746 TCTTAAGAGCAGAGAGAGGATGG - Intergenic
1115215099 14:31006310-31006332 TCTGAAAGGCTGAGGCAGGAGGG + Intronic
1115696804 14:35908220-35908242 TCAGGAAGGAAGAAAGAGCATGG + Intronic
1116428038 14:44813689-44813711 CCTGAGAGGAAGAAAGAGGAGGG + Intergenic
1117500770 14:56348955-56348977 TTTAAAAGGGAGAAAGGGGAAGG + Intergenic
1118034829 14:61855544-61855566 ACTGAAAGTGAGAAACAGGATGG + Intergenic
1118537368 14:66782879-66782901 TCTGAAAGATGGAAAGAAGAAGG + Intronic
1118577851 14:67261933-67261955 TTTTAAAGGCAAAAAAAGGATGG + Intronic
1118760622 14:68878559-68878581 TCGGGAAGGCAGGAAGAGGAAGG + Intronic
1118911610 14:70066484-70066506 TCTTAAAGGCAGAAGGAAGGGGG - Intronic
1119637472 14:76288283-76288305 TCTGGAAGGCAGGTAGAGCAGGG + Intergenic
1119976599 14:79031029-79031051 AAAGAAAGGCAGAAAGGGGAAGG - Intronic
1119977071 14:79037085-79037107 TCTGAGAAGAGGAAAGAGGAAGG + Intronic
1120327644 14:83050673-83050695 TGTGGAAGGCAGAAAGGGAAGGG - Intergenic
1121233070 14:92372486-92372508 TCTGAGAGGCAGGCAGAGAATGG + Intronic
1121338440 14:93091069-93091091 AAGGAAAGGCAGGAAGAGGAAGG + Intronic
1121609386 14:95265766-95265788 TGAAGAAGGCAGAAAGAGGAAGG + Intronic
1121878400 14:97476533-97476555 ACTAAAAAGCAGAAAGAAGAAGG - Intergenic
1121954928 14:98205092-98205114 TCTGAAAGGCATGGAGAAGAAGG + Intergenic
1122053715 14:99078089-99078111 ACTGAAAGGCAGAGAGGTGAAGG - Intergenic
1122057949 14:99117861-99117883 CCTCAAAGGCAGCAAGGGGACGG - Intergenic
1122612242 14:102993488-102993510 AGTGAAAGGCAGAAAGAGAGAGG + Intronic
1122672242 14:103381759-103381781 TCTGGAAGGAATAGAGAGGAGGG - Intergenic
1123126585 14:105951075-105951097 TCTGAAGGCCACAAAGAGGGAGG + Intergenic
1123181171 14:106471951-106471973 TGAGAAAGAAAGAAAGAGGAAGG + Intergenic
1202945734 14_KI270726v1_random:24831-24853 TGAGAAAGAAAGAAAGAGGAAGG - Intergenic
1123407101 15:20027177-20027199 TCTGAAGGCCACAAAGAGGGAGG + Intergenic
1124124361 15:26924950-26924972 TCTGAATGGTAGAAAGAAGCAGG - Intronic
1124494658 15:30178948-30178970 ACTGACAGCCAGAGAGAGGAAGG + Intergenic
1124529777 15:30495535-30495557 TCTGAAAGGTGGTAAGAGGAAGG + Intergenic
1124554529 15:30712147-30712169 TCTGAAATGCAGAATGTGGCTGG - Intronic
1124676720 15:31693530-31693552 TCTGAAATGCAGAATGTGGCTGG + Intronic
1124706364 15:31969866-31969888 TCTGAAAGGTGGAGAAAGGAGGG + Intergenic
1124748912 15:32359697-32359719 ACTGACAGCCAGAGAGAGGAAGG - Intergenic
1124768882 15:32512153-32512175 TCTGAAAGGTGGTAAGAGGAAGG - Intergenic
1125622994 15:41081421-41081443 TCTGCAAGGCTGAGAGAGCAGGG + Intronic
1126197279 15:45946335-45946357 TCTGAAGGGTAGAAAAAGAAGGG + Intergenic
1126256914 15:46638512-46638534 TTTGACAGGAAGACAGAGGAGGG + Intergenic
1126297551 15:47157538-47157560 TGTGAAAGGTAGAGAGAGCAAGG + Intergenic
1126297693 15:47159435-47159457 ATTGAAAGGCAGAAAGAAAAAGG + Intergenic
1126335809 15:47585027-47585049 TAAGATAGGCAGAAAGACGATGG - Intronic
1127277405 15:57459514-57459536 TCTGAAAGGCAGGGAGAGATGGG + Intronic
1127439106 15:58988136-58988158 CCTGGAGGGGAGAAAGAGGAAGG + Intronic
1127781473 15:62320291-62320313 TCAGAAATGCAAAAACAGGAAGG - Intergenic
1128400610 15:67276355-67276377 TCTGAAAGACGGAGAGAAGAAGG + Intronic
1128654432 15:69450181-69450203 TTTGAGAGGCTGAAACAGGATGG + Intergenic
1128787054 15:70405379-70405401 TCTGAATAGCAGAGAGAGGAAGG + Intergenic
1128792769 15:70445191-70445213 TTTGAAAGGCAGAAAGGTCAAGG - Intergenic
1128848467 15:70924951-70924973 TCTTAAAGGCAACCAGAGGAAGG - Intronic
1129032521 15:72629303-72629325 CCTCACAGGCAGAAAGAGGGAGG - Intergenic
1129201403 15:74003577-74003599 TCTGAAAGTGAGAAGGAAGAGGG - Intronic
1129338721 15:74871138-74871160 GCTGAAAGGCAGAAAGGTGTGGG + Intronic
1129407291 15:75328051-75328073 CCTCACAGGCAGAAAGAGGGAGG - Intergenic
1129470477 15:75750914-75750936 CCTCACAGGCAGAAAGAGGGAGG - Intergenic
1129486448 15:75878194-75878216 TAAGAAAGTGAGAAAGAGGAAGG + Intronic
1129734526 15:77952224-77952246 CCTCACAGGCAGAAAGAGGGAGG + Intergenic
1129841064 15:78743767-78743789 CCTCACAGGCAGAAAGAGGGAGG - Intergenic
1130226482 15:82062417-82062439 GCTGAAGGGAAGGAAGAGGAGGG + Intergenic
1130392845 15:83473997-83474019 TCTGAAAGGTGGAGAGAAGAAGG - Intronic
1130995802 15:88903328-88903350 ACTGAGAGCCAGAGAGAGGAAGG - Intronic
1131030607 15:89183310-89183332 ACTGAAAGGCAGTAAAAGAAAGG - Intronic
1131090040 15:89617113-89617135 TCTGAAAGGCAGAGAGAAGAAGG - Intronic
1131213290 15:90516294-90516316 TCAGAAAGAAAGAAAAAGGAAGG + Intergenic
1131328697 15:91474326-91474348 ACAGAAAGGCAGAAGAAGGAAGG - Intergenic
1132060489 15:98688323-98688345 AGTGAAAGGCAGAGAGAGGAGGG - Intronic
1132297072 15:100746859-100746881 TCTAAAAGGAAGAAAGAACATGG - Intergenic
1133424194 16:5673444-5673466 GCTGAAAGCCAGAGAGAGGAAGG - Intergenic
1133436807 16:5786837-5786859 TCTGAAAGGTAGAATGAAGCCGG + Intergenic
1133532812 16:6671547-6671569 TCTGAGATGCAGAAAGACTAAGG - Intronic
1133657419 16:7879420-7879442 TCTGAGAGGCTGAGAGAGGAGGG - Intergenic
1133694635 16:8250224-8250246 TCTGCAATGCAGAAGGTGGAGGG + Intergenic
1133758563 16:8780463-8780485 TCTCAAAGGCATAAACAGGCCGG + Intronic
1134596288 16:15498623-15498645 AGAGAAAGGAAGAAAGAGGAAGG + Intronic
1134610601 16:15605329-15605351 TCTGAGAGGCAGAGAGAGGTGGG + Intronic
1135592975 16:23718165-23718187 ACAGAAAGGCAGAGAGAGGCCGG + Intergenic
1135973472 16:27089320-27089342 TCTGAAGGGTAGAGAGAAGAAGG + Intergenic
1136448339 16:30337573-30337595 CCTGAGACCCAGAAAGAGGAAGG - Intergenic
1136924209 16:34356432-34356454 TTTGAAAGGCAGAAAAATCAAGG + Intergenic
1136980364 16:35055374-35055396 TTTGAAAGGCAGAAAAATCAAGG - Intergenic
1137065554 16:35838438-35838460 TCTGAAAGGCAGAGGCAGGATGG + Intergenic
1137430614 16:48415343-48415365 ACTGGAAGGCAGATAGAGGATGG + Intronic
1137472948 16:48777916-48777938 TCTGATAGAAAGGAAGAGGAGGG + Intergenic
1137637006 16:49995701-49995723 TCTGAAAGACAGTAAGAAGAAGG + Intergenic
1137672415 16:50286757-50286779 ACTGAAATTCAGAGAGAGGATGG + Intronic
1137906264 16:52325199-52325221 TCAGGAAGGGAGAAAGATGAAGG - Intergenic
1139115319 16:63944166-63944188 TCGAAAAGGCAAAAAGAAGAAGG - Intergenic
1139939215 16:70592372-70592394 TCTCATGGGCAGAGAGAGGAGGG - Intronic
1139986050 16:70899458-70899480 GCTGAAGGGGAGAGAGAGGAAGG + Intronic
1140014527 16:71168702-71168724 GCTGCAGGGCAGAAGGAGGAGGG + Intronic
1140119389 16:72070489-72070511 TCCGAACAGCAGAATGAGGATGG + Intronic
1140237712 16:73173834-73173856 CCTGTATGGCAGAAAGGGGAAGG + Intergenic
1140518083 16:75558941-75558963 TCTGAATTCCAAAAAGAGGAGGG + Intergenic
1140758614 16:78091245-78091267 TTTGAAAGGAAAAAAGAAGATGG + Intergenic
1141473501 16:84255498-84255520 TCAGAAAGGACCAAAGAGGATGG - Intergenic
1142047534 16:87935258-87935280 CCTGAGACCCAGAAAGAGGAAGG + Intronic
1142599589 17:1047144-1047166 TAGGAAAGGCAGGAGGAGGAGGG - Intronic
1143288051 17:5805908-5805930 TCTGAAAGGTGGAGAGAAGAAGG - Intronic
1143801075 17:9381463-9381485 TCTGAAAGGCACAAAGGAGTTGG + Intronic
1143871064 17:9957594-9957616 TCTGAAATACATAAAAAGGAGGG - Intronic
1144016360 17:11200118-11200140 TCTTGGAGTCAGAAAGAGGATGG + Intergenic
1144030535 17:11318076-11318098 TCTGAAAGACAAAAAGACAAAGG + Intronic
1144459190 17:15444033-15444055 TCTCAAACCCAGAAAGATGAAGG + Intronic
1146227589 17:31080162-31080184 TCTGATAGGCAAAATGAGAAAGG - Intergenic
1146579506 17:34024403-34024425 CCTAAAAGGAAGAAAGAGAAGGG - Intronic
1147451669 17:40509580-40509602 TCTAAAAGTAAGAAAGAGGGAGG - Intergenic
1147652808 17:42071892-42071914 CCTGGAAGCCAGAAGGAGGAGGG + Intergenic
1148154008 17:45412328-45412350 TCTGAGAGGCACAAGGGGGAGGG + Intronic
1148253469 17:46106974-46106996 TCTGAAAGATAGAAAAGGGAAGG + Intronic
1149238297 17:54618569-54618591 TCTTAAAGGTAGTAAGAGGAAGG + Intergenic
1149526405 17:57359383-57359405 TCTTAAAGTCAGAAAGACAAAGG + Intronic
1150200396 17:63350303-63350325 TCTGAAAGGGGGAAAGCAGAGGG - Intronic
1151070988 17:71211504-71211526 TCTGAAAGGTAGAGAGAAAAAGG + Intergenic
1151183340 17:72345533-72345555 CCAGGAAGGCAGAAAGAAGAGGG + Intergenic
1151318516 17:73338512-73338534 TCTGGCAGGCAGTGAGAGGAGGG + Exonic
1152154171 17:78622160-78622182 TGTGAAATGCAGGGAGAGGAGGG - Intergenic
1152498064 17:80688555-80688577 GCTCAAAGGGAGAAAGAAGAAGG + Intronic
1152601605 17:81265061-81265083 TTTGAAAGTCAGAAAGTTGAGGG - Intronic
1152760898 17:82106531-82106553 TCTGAAAGGCAGGAGAAGGGTGG - Intronic
1153206439 18:2708349-2708371 TCTAAAAGGCAGAAAAGGCAAGG - Intronic
1153592338 18:6686873-6686895 TCTGGAAGCCAGAAAGGGCAAGG - Intergenic
1153890238 18:9507259-9507281 TCTGAAAGGTAGACAGAAGGAGG - Intronic
1153970125 18:10218554-10218576 CCTGACAGGCTGAAAGAGGAGGG + Intergenic
1154005155 18:10521063-10521085 TTTGAAAAGGAGAAAGAGAACGG - Intergenic
1154384853 18:13884025-13884047 ACTAACAGGGAGAAAGAGGAGGG + Exonic
1154463187 18:14617222-14617244 TCCGAATAGCAGAAAAAGGATGG + Intergenic
1155553340 18:26990867-26990889 CCTGAAGAGCAGAAGGAGGAAGG - Intronic
1155784145 18:29876534-29876556 TCTGAACAGCAGAAAGAGGATGG + Intergenic
1155958643 18:31975259-31975281 TCCAAACAGCAGAAAGAGGATGG - Intergenic
1156055778 18:33000570-33000592 TCTTAAAAGCAGCAAGAGAAAGG + Intronic
1156117421 18:33802776-33802798 TCTCAAAAGAAGACAGAGGAGGG + Intergenic
1157074518 18:44450384-44450406 TCTGAAAGTAAGCCAGAGGAAGG - Intergenic
1157111570 18:44825329-44825351 GCTGGAAGCCAGAAAGAGAAGGG + Intronic
1157164111 18:45342358-45342380 TCTGGAAGGCAGGAACAGCAGGG + Intronic
1157175019 18:45443702-45443724 AATGAGAGGCAGAGAGAGGAGGG + Intronic
1157240379 18:46003731-46003753 TCTGAAAGGGGGAGAGAAGAAGG - Intronic
1157877993 18:51291565-51291587 TATGAAGGAAAGAAAGAGGAAGG - Intergenic
1158207002 18:55004481-55004503 TCTCAAAGGCAGGAAGAGGCTGG + Intergenic
1158393359 18:57061486-57061508 TCTGAAAGTCACATAGAGCACGG + Intergenic
1158789159 18:60754762-60754784 ACTCAAAGGCAGACAGAAGAGGG - Intergenic
1158847691 18:61462062-61462084 TCTGCTAGGCAAAAAGGGGAGGG + Intronic
1159258663 18:65981194-65981216 AAGGAAAGGCAGAAAGAGAAAGG - Intergenic
1159842611 18:73417022-73417044 TCTGAAAGGTAGAAACAAGAAGG + Intergenic
1159946873 18:74450547-74450569 TGTGAAAAGCAGAGTGAGGAGGG + Intronic
1160266682 18:77344484-77344506 TCTGCAGGGCAGAGAGAGGTAGG - Intergenic
1161205570 19:3039488-3039510 TCTGAAAGGAAGAGAAAGGCTGG - Intronic
1161914144 19:7216320-7216342 TCTCAAAGACAAAAAGAAGATGG + Intronic
1162267861 19:9590573-9590595 TCCGCACGGCAGAGAGAGGATGG - Intergenic
1162273110 19:9632381-9632403 TCTGAATGGCTGAAAAAGGATGG + Exonic
1162509218 19:11107368-11107390 TGTGAGAGCCAGAGAGAGGAAGG - Intronic
1162888301 19:13712944-13712966 TTTGAGAAGCTGAAAGAGGAGGG + Intergenic
1162965065 19:14151615-14151637 TCTGCAGGGCAGAAAGGGGCTGG + Exonic
1163179319 19:15587831-15587853 AGTGAAAGGGAGCAAGAGGAAGG - Intergenic
1163269007 19:16238615-16238637 TCTGAAAGGCAAAAACAGGAAGG + Intronic
1163810278 19:19427092-19427114 TCTTAAAGACAGAAGGAAGAAGG + Intronic
1164243988 19:23415131-23415153 CCTGAAAGGCAAAAAGGGAAGGG - Intergenic
1164861661 19:31566537-31566559 CCTGACAGGGGGAAAGAGGAGGG + Intergenic
1164961291 19:32432991-32433013 GCTGGAAGGCAAAGAGAGGAGGG - Intronic
1165076942 19:33284800-33284822 TTGGAAAGACAGAAAGATGAAGG - Intergenic
1165307968 19:35013722-35013744 ACTGATAGGAAGAGAGAGGAGGG + Intronic
1165906842 19:39199411-39199433 TCTGAAAGGCTCAAACAGAAGGG - Intronic
1166228711 19:41413169-41413191 TCTGCAAGGCAGGAAGAAGTAGG + Intronic
1166260147 19:41633429-41633451 TCTGCAATGCAGAAAAAGGTGGG + Intronic
1166391036 19:42409054-42409076 CCTGAAAGTCAGAGAGAGGATGG + Intronic
1166437927 19:42785420-42785442 TCACAGAGGGAGAAAGAGGAGGG - Intronic
1166456881 19:42949212-42949234 TCACAGAGGGAGAAAGAGGAGGG - Intronic
1166472965 19:43096159-43096181 TCACAGAGGGAGAAAGAGGAGGG - Intronic
1166519401 19:43470261-43470283 TCTGAGACCCAGAGAGAGGAAGG + Intergenic
1167203138 19:48081421-48081443 TCAGAGATTCAGAAAGAGGAGGG + Intronic
1167649822 19:50723205-50723227 TCTGGAAAGTGGAAAGAGGAGGG + Intergenic
1168242731 19:55095509-55095531 CCTGAAAGGCGGACAGCGGAGGG - Exonic
925645014 2:6027040-6027062 ACAGAAAGGCAGAAAGAGAAAGG - Intergenic
925693851 2:6553171-6553193 TATAAAAGGGTGAAAGAGGATGG - Intergenic
925825686 2:7846578-7846600 TCTGAAAGGCAAACAGAGGGTGG + Intergenic
926456102 2:13070167-13070189 TATGAAAGGCAGGAAGAGTGAGG - Intergenic
927584178 2:24283702-24283724 TCTGGAAGGCAGGAAGCAGAAGG + Intronic
927680000 2:25132831-25132853 GCTGAAAGGCTGAACCAGGAGGG + Intronic
927830012 2:26341738-26341760 GCTGAAAGGCTGAGAAAGGAGGG - Intronic
927960755 2:27239397-27239419 TTTGAAGGGCAGAAAGTGAAGGG + Exonic
929961900 2:46503249-46503271 TCTGGAAGGTAGAAGGAGGCAGG + Intronic
930712489 2:54562019-54562041 TCTGAAAAAGAAAAAGAGGAAGG - Intronic
930853786 2:55989961-55989983 TGTGAAAGAGAGAGAGAGGAGGG - Intergenic
930855604 2:56014050-56014072 TCTCAAGGGCTGAAAGAGGTAGG - Intergenic
930862512 2:56089638-56089660 TCTGAAAATAAGACAGAGGAAGG - Intergenic
931376578 2:61713495-61713517 TCGAAAAGGCAGGAGGAGGAAGG + Intergenic
931618507 2:64186487-64186509 TCAGATAAGGAGAAAGAGGAAGG + Intergenic
931649176 2:64453756-64453778 TCTCTAGGGCAGAAAGAGAATGG - Intergenic
931886839 2:66626675-66626697 TTTGAAAGGTCAAAAGAGGACGG + Intergenic
932591245 2:73069205-73069227 TCTGACTTGCAGAAAGAGGAAGG + Intronic
932809847 2:74815965-74815987 TCTGAAAGGCTATGAGAGGAAGG - Intergenic
932831741 2:74996811-74996833 TCTGTAAGAAAGAAATAGGAGGG + Intergenic
933056878 2:77681501-77681523 TCTGAAAGATAGAAAGATGTCGG - Intergenic
933152265 2:78929972-78929994 ACTGGAAGGGGGAAAGAGGAAGG + Intergenic
933409886 2:81911744-81911766 GAGGAAAGGAAGAAAGAGGAGGG - Intergenic
933457975 2:82541214-82541236 TGTGATAGACAGGAAGAGGAAGG + Intergenic
933495203 2:83041447-83041469 ACAGAAAGGGAGAAAGATGATGG + Intergenic
933537180 2:83590772-83590794 TTTGAAAGGCAGAGGGAAGAGGG + Intergenic
934056212 2:88253395-88253417 ACTGGAAGGGAGAGAGAGGAAGG - Intergenic
934070309 2:88377838-88377860 TCTAAAAGGGAGAGAGAGAAAGG + Intergenic
935095186 2:99937297-99937319 TCTGAAAGGCTGAGAGAGAAGGG + Intronic
935126370 2:100227193-100227215 TCTGAAAGGTGAAAAGAGGAAGG + Intergenic
935272085 2:101443592-101443614 TCTGAAAGCGGGAAAGAAGAAGG + Intronic
935326438 2:101941761-101941783 TCTGAAATGTGGAAAGAGGGTGG - Intergenic
935958686 2:108402708-108402730 TTCGAACAGCAGAAAGAGGATGG + Intergenic
936372864 2:111917545-111917567 TCTGAAAGGTAGAGAGAAGCAGG - Intronic
936578619 2:113676110-113676132 TCTGAATCCCAGGAAGAGGAGGG - Intergenic
936622218 2:114112213-114112235 TCTGAAAGCCAGAAAAGGCAAGG - Intergenic
936687072 2:114840273-114840295 TTTGAAAGGAAGAAGGAGTAAGG + Intronic
937451647 2:122007247-122007269 TTTCAAAGGAAGAAAGCGGAGGG - Intergenic
937535108 2:122876677-122876699 CCTGAAAGGAAGAAAGCAGAGGG - Intergenic
937617251 2:123940738-123940760 TCTGGAAGGTGAAAAGAGGAAGG + Intergenic
937768055 2:125685021-125685043 TCTAAAAGGTAGAAAGAAGAAGG + Intergenic
937897800 2:126991570-126991592 TCAGAAAGGTGGAAAGAAGAAGG - Intergenic
937925005 2:127161309-127161331 TCTGAAGAGCAGAGAGAGGCTGG + Intergenic
938060917 2:128253611-128253633 TCTGAAAGGTGGAGAGAAGACGG + Intronic
938162958 2:129002917-129002939 TCTCACAAGCGGAAAGAGGATGG - Intergenic
938231202 2:129660712-129660734 TGTGAAAGGTAGAGAGAAGAAGG - Intergenic
938276281 2:130027439-130027461 TCTCAAAGGCAGTGACAGGAAGG - Intergenic
938439095 2:131309917-131309939 TCTCAAAGGCAGTGACAGGAAGG + Intronic
938635128 2:133216339-133216361 TCTGGACTGCAGCAAGAGGATGG + Intronic
939263447 2:139839834-139839856 TGGGAAAGGCAGTAAGAGGGTGG - Intergenic
939787658 2:146537369-146537391 TCTGAAAGAAAGAAAGAAAAAGG + Intergenic
940088964 2:149895129-149895151 CCGGAAAGGCATAAGGAGGAAGG - Intergenic
940172980 2:150848862-150848884 TCTGACAGGCAGAATGAGAGAGG + Intergenic
940393578 2:153161914-153161936 GCGGGAAGGCAGAAAGAGAAGGG + Intergenic
940738701 2:157482362-157482384 TCTGAAAGGAAGACTGAGGTGGG + Intronic
940840281 2:158571917-158571939 TCTGAAAGCCAGAAGGAAGATGG + Intronic
940853905 2:158714964-158714986 TCTGAAAGGTAGAGGGAAGAAGG - Intergenic
940939507 2:159542420-159542442 TCTTGAAGGCAGCAAGAGAAAGG + Intronic
940939865 2:159546853-159546875 TCTGAAAGGCAGAAATGATAGGG + Intronic
941435747 2:165469247-165469269 TTTGATATGCAGACAGAGGAGGG - Intergenic
941533988 2:166700693-166700715 TGCGAGAGGCAGAAAGATGAAGG - Intergenic
941823422 2:169865647-169865669 GCTGGAAAGCAGAAAGAGAAAGG - Intronic
941915922 2:170813916-170813938 GCTCAAAGGCAGAAGAAGGAGGG - Intronic
942085783 2:172442420-172442442 TCTGAAAGGAGGATAGACGAAGG + Intronic
942218922 2:173750326-173750348 GATTAAAGGCAGAAAGAGGAAGG - Intergenic
942260363 2:174154960-174154982 TTTGAAAGGCAGAAGTAAGAAGG - Intronic
943939175 2:193969028-193969050 TCTGAAAGGCGATAAGAGGAAGG - Intergenic
944253332 2:197599499-197599521 TGTGAGAAGGAGAAAGAGGAAGG + Intronic
944627549 2:201587586-201587608 TCTTAAAGGCAGCCAGAGGAGGG - Intronic
945218868 2:207464264-207464286 TGTGAAAGGTAGAGAGAGAAAGG - Intergenic
945459369 2:210087317-210087339 TCTTAAAAGCAACAAGAGGATGG - Intronic
945485274 2:210388056-210388078 GCTGCAAGGGAGAAAGAGAAGGG + Intergenic
945548085 2:211182976-211182998 TGTAAAAGCCAGAAAGTGGACGG - Intergenic
945719035 2:213395691-213395713 TCTGAAAGGTGGAAACAGGGAGG - Intronic
945766568 2:213987286-213987308 TGAGAAAGGCAGAATGAGGTAGG - Intronic
946098432 2:217296610-217296632 TCTGTTAGGCAGAAAGGGAAAGG - Intronic
946218094 2:218201889-218201911 TCTGAGAGCCAGAAAGAAAATGG + Intergenic
946530270 2:220563263-220563285 TCAGAGAGGCAGAAAGTAGACGG + Intergenic
946551282 2:220804365-220804387 TCCTAAAGGCTGAAGGAGGATGG - Intergenic
946605821 2:221402976-221402998 TCTGAAGGGCACAGAGGGGAAGG - Intergenic
946615483 2:221505009-221505031 TGATAAAGGCAGCAAGAGGATGG - Intronic
946821932 2:223639061-223639083 TTTGAAAGGCAGAAGGATGCAGG - Intergenic
947569861 2:231224832-231224854 TCTGTGAGGCAAACAGAGGAGGG + Intronic
947690573 2:232132472-232132494 TCTGAAAGGTGAAAAGAGGAAGG + Intronic
947832768 2:233153468-233153490 TCTGAAAGCCGGAAAGGAGATGG + Intronic
947857164 2:233331831-233331853 CCTCGAAGGGAGAAAGAGGAAGG - Intronic
947869272 2:233423940-233423962 CCTGAAAGGTAGAGAGAAGATGG - Intronic
948075471 2:235162331-235162353 ACTGCCAGGCAGAAAAAGGAGGG + Intergenic
948556212 2:238813267-238813289 GCTGTGAGGCTGAAAGAGGAAGG - Intergenic
1168831955 20:850526-850548 TCATACAGCCAGAAAGAGGAAGG - Intronic
1168967467 20:1907542-1907564 TCTTAAAGGCTGACAGAGGCTGG - Intronic
1169100058 20:2939741-2939763 TCTGAAAAGTAGAAAAAAGAAGG - Intronic
1169146673 20:3257141-3257163 CCTGAAAGGCAGGATGAGAAAGG + Intronic
1169398849 20:5262230-5262252 TCTGATAGGCAGTTGGAGGAGGG + Intergenic
1169469441 20:5871566-5871588 TCTGAATGGCAGAAAGAAGATGG + Intergenic
1169560767 20:6798316-6798338 TCTGAAAGGGAGAGAGAGAAAGG - Intergenic
1169677661 20:8172785-8172807 TCTGAAAGGTGCTAAGAGGAAGG + Intronic
1169710130 20:8551762-8551784 TGGGAAAGCAAGAAAGAGGATGG - Intronic
1169777828 20:9275563-9275585 TATGAAAGTAAGAAAGAGCAGGG - Intronic
1170366478 20:15603568-15603590 TCTGGATGGAGGAAAGAGGAGGG + Intronic
1170412914 20:16109673-16109695 TTGGAAAGAAAGAAAGAGGAGGG - Intergenic
1171079038 20:22159109-22159131 TCCCAAAAGCAGACAGAGGATGG + Intergenic
1171233693 20:23507981-23508003 TCTGAAAGTCAGAGTCAGGACGG - Intergenic
1171898998 20:30839423-30839445 TCTGTAAGACAGAAAAATGAGGG + Intergenic
1172119027 20:32586774-32586796 TGTGAAATGCAGAGAGAGGTTGG - Intronic
1172185697 20:33029796-33029818 TGTGCCAGGCAGAAAGAGGGAGG + Intergenic
1172354670 20:34271236-34271258 TCTGAAAAGGAGAAGGAGGTGGG - Intergenic
1172573838 20:35991665-35991687 TCTGACTGGCAGAAAGCGGGGGG + Intronic
1173224939 20:41156930-41156952 TCTGGGAGGCAGGAAGATGAAGG + Intronic
1173301798 20:41810094-41810116 ACTGAAAAGTAGAAAGAAGAAGG + Intergenic
1173310987 20:41895628-41895650 ACTGAGAGGGAGAAAGGGGAGGG + Intergenic
1173452838 20:43180388-43180410 TATGACAGGGAGAGAGAGGAAGG - Intronic
1173824456 20:46038559-46038581 TCTGGAAGTCAGAAAGACCAAGG - Intronic
1173966065 20:47113783-47113805 TCTGAAAAGCAGAAACATTATGG - Intronic
1174207424 20:48850820-48850842 TTTGCCAGGCAGACAGAGGAAGG - Intergenic
1174540626 20:51286464-51286486 TCTGAAAGCCAGACAGGGGAGGG + Intergenic
1174545196 20:51319768-51319790 TCTGAGAGAGAGAAAGAGGGTGG + Intergenic
1174934271 20:54850804-54850826 ACTGAAATTCAGAAAGAGGTAGG + Intergenic
1175396039 20:58662387-58662409 TCTGAGGGGAAGAAAAAGGAGGG - Intronic
1175654012 20:60753105-60753127 TTTGAAAAGGAGAAGGAGGAAGG - Intergenic
1176258819 20:64168099-64168121 TCTGAAAGACAGAAAAATGCCGG - Intronic
1176811334 21:13541148-13541170 TCCGAATAGCAGAAAAAGGATGG - Intergenic
1177149508 21:17440838-17440860 TCTGAGAGGCTGGAAGAGAAAGG - Intronic
1177448735 21:21237051-21237073 TCTGAAAAGCAGAGAAAGCAGGG - Intronic
1177475520 21:21615582-21615604 TCAGAAAAGCAGAAAGAGATGGG + Intergenic
1177597728 21:23267354-23267376 TCTGTCAGGCAGGCAGAGGAAGG + Intergenic
1177657238 21:24034123-24034145 TCTGAAAAACAAAAACAGGATGG + Intergenic
1178630004 21:34251434-34251456 TCTCAAATACAGAAAGAGGGAGG + Intergenic
1179166372 21:38938321-38938343 TCACAGAGACAGAAAGAGGAGGG - Intergenic
1179611251 21:42552783-42552805 GCTGAAAAGCAGGAAGAAGAGGG + Intronic
1180130914 21:45826624-45826646 TCTGAAAGGTGGGAAGAAGAAGG + Intronic
1180459086 22:15542456-15542478 TCTCAAAGGCAGTGACAGGAAGG + Intergenic
1180786930 22:18552723-18552745 TCTGACAGCCAGGAAGAGTAAGG + Intergenic
1181234810 22:21442587-21442609 TCTGACAGCCAGGAAGAGTAAGG - Exonic
1181243840 22:21492244-21492266 TCTGACAGCCAGGAAGAGTAAGG + Intergenic
1181440632 22:22933653-22933675 ACTGAAGGGCAGAGAGAGGACGG + Intergenic
1181701040 22:24621387-24621409 TTTGTTAGGCAGAGAGAGGAAGG + Intronic
1181921091 22:26320994-26321016 CCTGAAAGACAGAGAGAAGATGG + Intronic
1182051895 22:27318819-27318841 TCTGAGAAACAGCAAGAGGAAGG + Intergenic
1182164738 22:28161848-28161870 TAAGAAAGGAAGAAAGAGGAAGG + Intronic
1182166862 22:28183480-28183502 TCAGCAAAGCAGAATGAGGAGGG - Intronic
1182726858 22:32454227-32454249 TCTGAAAGGAAAAAAGAGTGTGG - Intronic
1182781241 22:32869725-32869747 TCTGGAAAGCAGCAAGAGTAGGG + Intronic
1182847459 22:33443359-33443381 TCTAAAGGGCACAGAGAGGAAGG + Intronic
1182972088 22:34588813-34588835 TCTGAAAACCAAAAATAGGAAGG + Intergenic
1183088462 22:35503626-35503648 TCTGGGAGGGAGAAAGAGGTGGG - Intergenic
1183121008 22:35730206-35730228 ACAGAAAGGCAGAAAGAAGAGGG - Intergenic
1184001160 22:41674640-41674662 GTTGAAAGGCAGAAAGAGCCAGG - Exonic
1184018933 22:41807643-41807665 TTTCAAGGGGAGAAAGAGGAAGG + Intronic
1184369507 22:44073743-44073765 TCTGAAAGGGAGAAGCAGGTAGG + Intronic
1184377403 22:44123372-44123394 TTTGAGAGGGAGAGAGAGGAAGG + Intronic
1184538012 22:45100565-45100587 TCTGAAAGGGAGAAACGGGGTGG - Intergenic
1184721187 22:46314478-46314500 TCTGAAGAGCAGAAAGGCGAAGG - Intronic
1184783455 22:46660329-46660351 TCTGGAAGCCTGAAGGAGGAGGG + Intronic
1185149177 22:49154347-49154369 TCTGAAAGGAAAAAAGAGAAGGG - Intergenic
949263948 3:2135355-2135377 TCTGAAAGTCTGAAAAAGGTAGG + Intronic
949609940 3:5693636-5693658 TTTGAACAGCAGAAAGAAGATGG - Intergenic
949781165 3:7690229-7690251 ACTTAAAGGCACAAAGACGAAGG - Intronic
950332566 3:12168195-12168217 TCTGGAAAACAGATAGAGGAGGG + Intronic
950560165 3:13716682-13716704 TCTGCCAGGAGGAAAGAGGAAGG + Intergenic
950667468 3:14506065-14506087 TCCCAAAGGCAGGAAGTGGAGGG - Intronic
950732934 3:14978421-14978443 TCTGAAAGTCAAAAACAGAATGG + Intronic
950832401 3:15887747-15887769 TCTAAAAGGGAGAAATAGGGAGG - Intergenic
951829883 3:26914797-26914819 TCTGAAAGGTAGAATGGGAAGGG + Intergenic
951870233 3:27353897-27353919 TCTAAAAGAAAGAAAGAGAAGGG + Intronic
951972575 3:28463835-28463857 TCTGAAAGAAAGAAGGAGGGAGG + Intronic
952234398 3:31463941-31463963 GCTGAAAGGTAGAAAGTGGAAGG - Intergenic
952801976 3:37302090-37302112 TTTAAAAGGCAGAAAAAGGCCGG - Intronic
953170202 3:40500188-40500210 TCAGAAAGAAAGAAAGAGGGAGG - Intergenic
953236855 3:41114432-41114454 TTTGGAAGGCAGAGACAGGAAGG + Intergenic
953290186 3:41652636-41652658 AGTGAAAAGCAGAAAGAGGTGGG + Intronic
953302284 3:41789801-41789823 TCTGGAAGGCAGTAGGAGAATGG + Exonic
953508990 3:43516312-43516334 TCTGAAGAGCAGAAATTGGATGG + Intronic
953742727 3:45551469-45551491 TCTCACAGGAAGAAAGACGAGGG - Intergenic
953765812 3:45741170-45741192 TCAGACAGGCAGAGAGAGGTTGG - Intronic
954167524 3:48772093-48772115 TCTGAAAGGTGGAAAGAAGAAGG - Intronic
954358434 3:50102902-50102924 TCAGATAGGCAGTAAGAGAATGG - Intronic
954489255 3:50886147-50886169 TCTGAAAGGCGGAAAGAAGAAGG - Intronic
955055162 3:55448135-55448157 TCTAAAAGCCAGGAAGAGGCTGG + Intergenic
955320329 3:57969937-57969959 CCTGGAAGGCAGGATGAGGAGGG - Intergenic
955467902 3:59255322-59255344 TCTAAAAGGGAGAGAGAGAAAGG - Intergenic
955786265 3:62542654-62542676 TATGAATGGCCAAAAGAGGATGG + Intronic
956515926 3:70047788-70047810 TTTGCATGGCAGAAAGCGGAAGG + Intergenic
956937870 3:74124433-74124455 TCTGAGAGTCAGAAAGCAGATGG + Intergenic
957040708 3:75333425-75333447 TCTGAAAGGAATGAAGAGGCTGG + Intergenic
957423076 3:79997676-79997698 ACTGAAAAGCAGAAAAAGCAAGG - Intergenic
957553556 3:81736941-81736963 GCAGAATGGAAGAAAGAGGATGG + Intronic
957561556 3:81828471-81828493 TCTAAGAGGCAGAAAAACGAAGG - Intergenic
957607800 3:82426122-82426144 TCTGAATGGTGGAAAGAGGAGGG - Intergenic
957652098 3:83020873-83020895 TCTGAGAGAAATAAAGAGGAAGG - Intergenic
957835128 3:85577449-85577471 GCTGCATGGCAGAAGGAGGAAGG - Intronic
957856281 3:85882506-85882528 TCTAAAAGGTAGAAAGAGTGAGG - Intronic
958802853 3:98776754-98776776 TCTAGAAGGGACAAAGAGGATGG - Intronic
958962810 3:100526083-100526105 TATGAAAGGGAGAAAGACGCTGG - Intronic
959879311 3:111424749-111424771 TCTGAAAGAGTGAAAGAGAAAGG + Intronic
959912542 3:111779806-111779828 TAGCAAAGGCAAAAAGAGGATGG - Intronic
960145049 3:114192003-114192025 GCTCAATGGCAGAGAGAGGAGGG + Intronic
960412567 3:117345812-117345834 TGTGAAAGGGAAAAAGAGGGAGG - Intergenic
960506350 3:118499564-118499586 TCTGAAAGTCACAAAGAGTCAGG - Intergenic
960876279 3:122298182-122298204 TCTGAAAGCTAGAAACAGCAAGG + Intergenic
961529273 3:127530225-127530247 CCAGAAAGGAAGAAAGATGAGGG + Intergenic
961535867 3:127570165-127570187 TCAAGAAGGCAGAAAGGGGACGG + Intergenic
962126185 3:132621292-132621314 TCTGAAAAAGAGAAAGAAGAGGG + Intronic
962248432 3:133818949-133818971 TCTGGATAGCAGAAAGGGGAAGG + Intronic
962279771 3:134040976-134040998 GCTGAAAGAGTGAAAGAGGAAGG - Intronic
963102191 3:141618386-141618408 ACTGACAGGCAGAATGTGGAAGG + Intergenic
963442398 3:145356481-145356503 TATGAACAGCAGAAAGAGGGTGG - Intergenic
963834664 3:150046057-150046079 TCTGGTTGGCACAAAGAGGATGG + Intronic
964113347 3:153110159-153110181 TCTGAAAAAAAGAAAAAGGAAGG - Intergenic
964350984 3:155803878-155803900 TCTCAAAGGAAAAAAGAGGCCGG + Intronic
964710422 3:159665937-159665959 ACTGGAAGGCAGGAGGAGGAAGG - Intronic
965186295 3:165468627-165468649 TCTGCAAAGGAGAAAAAGGAAGG - Intergenic
965373850 3:167897508-167897530 TGTGAAAGGCAAAAGAAGGAAGG + Intergenic
965704181 3:171489454-171489476 TCTCAGAGGAAGAAAAAGGAAGG + Intergenic
966211183 3:177454928-177454950 CATGAAGGGAAGAAAGAGGAAGG - Intergenic
966855830 3:184193343-184193365 GCTGGAAGGCAGAACCAGGAAGG - Exonic
967000567 3:185330276-185330298 TCTGAGATGAAGACAGAGGAAGG - Intronic
967394116 3:188987680-188987702 TCTGAAAGGCAGAGAGAAGAAGG - Intronic
967428906 3:189359176-189359198 TCTGAAAGTCTGAAAGAGCACGG + Intergenic
967475045 3:189906908-189906930 TCTGAAAGTCAAGAAGATGATGG + Intergenic
967598410 3:191355583-191355605 ACTGAAAGCCAGAAGGAAGAAGG - Intronic
967742836 3:193022028-193022050 TGAGAAAGGTAGAAAGAGGGAGG - Intergenic
967790523 3:193543941-193543963 TCTGAGACTCAGAAAGAGGCTGG + Intronic
967852352 3:194091734-194091756 TCTGAATGGAAGAAAGAACAGGG + Intergenic
967975864 3:195034592-195034614 TTTGAAAGGCAGGGAGGGGAGGG + Intergenic
968039931 3:195580300-195580322 TATCAAAAGCAGAAAGATGATGG + Intronic
968266983 3:197369933-197369955 TCAGAAAGAAAGAAAAAGGAAGG - Intergenic
969246436 4:5936263-5936285 TTAGAAAGACAGAAAGAGGATGG + Intronic
969971322 4:11051388-11051410 TCTGAAAGACAGATGGATGAAGG - Intergenic
970070174 4:12149223-12149245 TCTGAAAAGGGGGAAGAGGAGGG + Intergenic
970236531 4:13964368-13964390 GCTGAAAAGGAGGAAGAGGAGGG - Intergenic
970289391 4:14554893-14554915 CCTGTAAAGCAGAAAGGGGAGGG + Intergenic
970663955 4:18316134-18316156 TCTGAAAGGCAGAATCAGAGTGG + Intergenic
970755950 4:19427374-19427396 TGTGAAAGGCAGAAGGAAGTAGG - Intergenic
971139581 4:23909593-23909615 AGTGACAGGCAGAAGGAGGAGGG + Intergenic
971249426 4:24961165-24961187 GCTGAAGGACAGAAAGAAGAAGG + Intronic
971375171 4:26050399-26050421 TCAGAGGGGTAGAAAGAGGAAGG - Intergenic
971477784 4:27088660-27088682 TCTAGAAGGCAGGAAGAGCAGGG - Intergenic
972281447 4:37605892-37605914 AAAGAAAGGAAGAAAGAGGAAGG + Intronic
972775416 4:42235323-42235345 TATGAGAGGTAGTAAGAGGAAGG + Intergenic
972808967 4:42561995-42562017 TATAAAAAGCAGAAAGATGAGGG - Intronic
972852935 4:43072637-43072659 TCTGGACAGTAGAAAGAGGATGG + Intergenic
972894595 4:43604172-43604194 TCTGGGAGGAAGAAAGAGCAAGG - Intergenic
972938806 4:44171753-44171775 TCCAAAAGGCTGAAAGAAGAGGG - Intergenic
973108129 4:46365890-46365912 TATGAAAGGCAAATAGATGAAGG - Intronic
973108201 4:46367024-46367046 TCTGAAAAGCAGTAACAGCAGGG + Intronic
973184384 4:47307437-47307459 TCTAAAAGACAAAAATAGGAAGG - Intronic
973549654 4:52020516-52020538 TCTGCAATGCACAGAGAGGAGGG + Intergenic
973646339 4:52954605-52954627 TCAGAAAAGCAGCAAGAGAAAGG + Intronic
973742068 4:53927671-53927693 TCTGAAAGCCAGAATGGGAATGG - Intronic
974522232 4:62996536-62996558 TCTGAAATGCTGAAAGCTGAAGG - Intergenic
974963136 4:68728721-68728743 TCAGAAAGAAAGAAATAGGAAGG - Intergenic
975119366 4:70711836-70711858 TCACAAAGGCAGAATCAGGAAGG - Intronic
975489093 4:74969176-74969198 TCTGTAAGTGAGAAAGAGTAGGG - Intronic
975561183 4:75709610-75709632 TCAGAAAGAAAGAAAAAGGAAGG + Intronic
975859194 4:78658240-78658262 TCTGAGTGACAGAAACAGGAAGG - Intergenic
975869326 4:78760817-78760839 TGTGAAGGACAGAAATAGGAGGG + Intergenic
976177474 4:82369637-82369659 TCAAAATGGGAGAAAGAGGAAGG + Intronic
976617984 4:87097388-87097410 TCTGAAAGTCTGAAAGCTGATGG - Intronic
976660457 4:87535243-87535265 TCTGAAATGGAGAAAATGGAAGG + Intergenic
976720894 4:88167670-88167692 TTTAAAAGGCAGAAAGAGCCTGG - Intronic
976848986 4:89523515-89523537 ACTGAAATGCAGAAAGATGAAGG + Intergenic
977100784 4:92811935-92811957 TCTGAAAGGCAGTACCAGTAAGG + Intronic
977335280 4:95689964-95689986 TTTGAAAGGTAGAAAGAAGGAGG - Intergenic
977368079 4:96098760-96098782 TCAGAAAGCCTGAAAGAGTAAGG - Intergenic
977683072 4:99816497-99816519 TGTGTAAGACAGAAAGAAGATGG + Intergenic
977686350 4:99851332-99851354 AATGAGAGACAGAAAGAGGAAGG + Intronic
977919223 4:102625198-102625220 AGAGAAAGGGAGAAAGAGGAAGG - Intergenic
978249877 4:106617759-106617781 TCTGCAAGCCAGGAAGAGAAGGG + Intergenic
978896616 4:113896008-113896030 TCTTCTAGGCAGAAAGAGAAAGG + Intergenic
979687252 4:123524506-123524528 GAGGAAAGGAAGAAAGAGGAAGG - Intergenic
979737705 4:124108014-124108036 TTAGAAAGGCATAAGGAGGAAGG - Intergenic
980082107 4:128355079-128355101 TGAGAGAGGCAGCAAGAGGAAGG - Intergenic
980775787 4:137434433-137434455 TCTGAATGTCAGAACAAGGATGG - Intergenic
981004956 4:139865419-139865441 TATGAAAGGCAAAAGAAGGATGG - Intronic
981076627 4:140598856-140598878 TCTGGACAGCAGAAAAAGGATGG - Intergenic
981265757 4:142781398-142781420 CCTTAAAGACAGAAAAAGGAGGG + Intronic
981517089 4:145621040-145621062 TCTGAAAGGAGGACTGAGGAGGG + Intronic
981595808 4:146420522-146420544 CCTGAGAGGAAGAAAGTGGATGG + Intronic
982360968 4:154518616-154518638 TCAGAAAGGAAGAAAGTGAAAGG - Intergenic
982374888 4:154678962-154678984 TGTGAAAGAAAGAAAGAAGAGGG - Intronic
982802069 4:159718066-159718088 TCTGAAAGGATCAATGAGGAAGG - Intergenic
983139514 4:164132190-164132212 CGTGAAACGAAGAAAGAGGAAGG - Intronic
983830267 4:172318404-172318426 TTTGAAAGGCTGAATGAGGCTGG + Intronic
984116721 4:175690546-175690568 TCTGAAAGTCGGAAAGTGCAAGG - Intronic
984483094 4:180330644-180330666 TCAGAAAGGTAGTAAGAAGAAGG - Intergenic
984683480 4:182638818-182638840 ACTGAAAGTCATAAAGAGAATGG - Intronic
984729587 4:183055201-183055223 GCTGAGAGGAAGAAAGAGGAGGG - Intergenic
985684410 5:1274232-1274254 CCTGGAAGGCAGTAACAGGAAGG + Intronic
986059116 5:4171325-4171347 GCTGAAGGGAAGACAGAGGATGG + Intergenic
986263925 5:6176375-6176397 TGTGAAAGCCAGACAGAGAAAGG + Intergenic
986266173 5:6193326-6193348 GCTGAGAGGCCGAAACAGGAGGG - Intergenic
986274836 5:6264646-6264668 TCTGCAAGGCAGGAAGTGCAGGG + Intergenic
986661360 5:10062956-10062978 ACTCAGAGGCAGACAGAGGAGGG - Intergenic
986922891 5:12709216-12709238 TCTGGAAGAGAGAAGGAGGATGG + Intergenic
987127485 5:14828088-14828110 TCTGAATGGCATAAAGCAGATGG - Intronic
987182173 5:15379639-15379661 TTTGAAAGGCAGAAAGAAGAAGG + Intergenic
987244842 5:16038147-16038169 TCTTAGTGGGAGAAAGAGGAGGG + Intergenic
987701512 5:21405539-21405561 TCTGAAGGTCAAAAAGAGAAGGG - Intergenic
988236198 5:28548500-28548522 TCTGACAGACAGAAAGAAGATGG + Intergenic
988542691 5:32126013-32126035 TTTTAAAAACAGAAAGAGGAAGG + Exonic
989321607 5:40141302-40141324 TGAAAAAGGCAAAAAGAGGAAGG + Intergenic
989445533 5:41524328-41524350 ACTGGAAGGCAGGAAGTGGAAGG - Intergenic
989781332 5:45267984-45268006 TCTGGAAGGCAGAAAGCAGATGG + Intronic
990007441 5:50960510-50960532 AATGAAAGAAAGAAAGAGGAAGG - Intergenic
990044365 5:51410989-51411011 TCTGAACAGCAGAGAGACGAGGG + Intergenic
990660482 5:58009022-58009044 TCTGCATGGCAGAAAGGGAATGG - Intergenic
990706449 5:58535088-58535110 TCTGGAAGGCAGAAAGATAGAGG - Intergenic
992079379 5:73219661-73219683 CCTGAAAGGCATGCAGAGGAGGG - Intergenic
992145166 5:73839644-73839666 TCTGAATGGCAGAGAAAGGACGG - Intronic
992186868 5:74252438-74252460 TCTGCCAGCCAGAAAGATGAGGG - Intergenic
992345386 5:75870754-75870776 TCTTAAAAGCATAAAGAGAACGG + Intergenic
992376626 5:76194137-76194159 TCTGAAAGACATAAGGAGAAGGG + Intronic
992581771 5:78185266-78185288 TCTGGAAGGAAGAAAGAATATGG + Intronic
992714480 5:79496371-79496393 TCTGAAAGCCAGGAATGGGAAGG - Intronic
993227419 5:85184696-85184718 TCTGAAGGGGAGAAAGTGGAAGG - Intergenic
993811261 5:92479499-92479521 GCTGAAGAGAAGAAAGAGGAGGG + Intergenic
994007532 5:94856915-94856937 CCTTAAAAGCAGAGAGAGGAAGG + Intronic
994099462 5:95877826-95877848 TGTAAAAGGCATAAAGAGGCCGG + Intergenic
994432716 5:99689144-99689166 TCTTAAAGACAGAAAAAGAATGG - Intergenic
994493989 5:100487214-100487236 TCTGAAAGGAAGAAATAAAATGG + Intergenic
995145773 5:108785896-108785918 TCTGGAAGGTGGAAAGAAGAAGG - Intronic
995789548 5:115870604-115870626 GCTCAAAGGCAGAAAGAAGCAGG - Intronic
995807259 5:116067034-116067056 TCTGAAAGGCAGAGAGAAGGAGG - Intergenic
996165425 5:120216316-120216338 TCAGCATGGGAGAAAGAGGAAGG + Intergenic
996371926 5:122762610-122762632 TCTGAAAGGGTGAAAGGGGATGG - Intergenic
996382421 5:122875730-122875752 TCTGAAAAGCAGGAGGAGAATGG + Intronic
996921042 5:128768085-128768107 TCAGAAAGGCAGTAAGAAGCTGG - Intronic
996921980 5:128778700-128778722 ACAGAAAGAAAGAAAGAGGAGGG - Intronic
996931101 5:128888759-128888781 TATGAAAGGCTGAAAGGGGTTGG + Intronic
997113563 5:131101489-131101511 TTTCAAAGGCAAAATGAGGAAGG + Intergenic
997281794 5:132653561-132653583 TTTGAAAGGTGGAAAGTGGAGGG + Intergenic
998425644 5:142026038-142026060 ACTAAAAGGCAGCAAGCGGAGGG + Intergenic
998726121 5:145016758-145016780 TGAGAAAGGCAGAAATAGGAAGG + Intergenic
999450123 5:151671694-151671716 TCTGTAGGGCAGAAAGACAAGGG + Exonic
999501655 5:152152552-152152574 ACTGAAACACAGAGAGAGGAAGG - Intergenic
1000687667 5:164272647-164272669 GCTGAGAGGCAGAAAGAGAAAGG + Intergenic
1001197161 5:169684174-169684196 ACTGAAAGGCAGAAGGAAGAAGG - Exonic
1001314873 5:170634749-170634771 CCTGAAAGCCAAAAAGAGAAAGG + Intronic
1001691772 5:173638704-173638726 GCTGGAAGGCAGAAATAGGTGGG + Intergenic
1001745580 5:174089948-174089970 TCTGGGAGGCAGGAAGAGAAAGG + Intronic
1002029927 5:176420391-176420413 TTTTAAAGGCAAAATGAGGAAGG - Intergenic
1002103117 5:176867129-176867151 TCAGAAAGGGAGAGAGAGGCCGG - Intronic
1002177919 5:177412608-177412630 ACAGAAACACAGAAAGAGGAGGG + Intronic
1002692724 5:181061663-181061685 TTTGAAAGGGGGAATGAGGAAGG + Intergenic
1002969246 6:1997086-1997108 TCTGACAGCCAGGCAGAGGAAGG + Intronic
1003097656 6:3155382-3155404 ACTGGAAGGAAGAAAGAGCAAGG - Intronic
1003101340 6:3178689-3178711 ACTGGAAGGAAGAAAGAGCAAGG - Intergenic
1003107769 6:3228572-3228594 TCCGGAGGGCAGAAAGAGGGTGG + Intronic
1003222355 6:4172336-4172358 TCAGAAAGCGTGAAAGAGGAAGG - Intergenic
1004621318 6:17333083-17333105 TTTGAAAGACAGAGAGAGAATGG - Intergenic
1005450070 6:25963494-25963516 TAGGGAAGGCAGAAAGAAGATGG - Intronic
1005575260 6:27184101-27184123 TCTGAATGGCCGAAAAAGGATGG + Intergenic
1005964894 6:30720337-30720359 TCTGAGAGGGAGAAAGGAGAGGG - Exonic
1006166929 6:32070673-32070695 TGTGAGAGGCGGAAAGAGGCTGG - Intronic
1006267638 6:32938540-32938562 TCTGAAATGTAGAAAGACGGAGG - Intronic
1006400602 6:33814998-33815020 GCTGAAAGGGAGAGAGAGAAAGG - Intergenic
1006813305 6:36834876-36834898 TCTGACAGGCAGGGAGAGGGTGG - Intronic
1007589251 6:43011659-43011681 TCTGCAGGGGAGAGAGAGGAGGG - Exonic
1007590164 6:43016256-43016278 CCTGAAAGGCGGATAGAGGTGGG - Intronic
1007610961 6:43148499-43148521 GTTGAATGGCAGAAAGGGGATGG + Intronic
1008209676 6:48705054-48705076 TAAGAAAGAAAGAAAGAGGAAGG + Intergenic
1008518871 6:52344193-52344215 GAAGAAAGGAAGAAAGAGGAAGG + Intergenic
1009315551 6:62214659-62214681 TCTGAAAGGGAGACCTAGGAAGG + Intronic
1009416216 6:63419185-63419207 TCTGGAAGGTAGAAATAAGAAGG - Intergenic
1009834196 6:68976740-68976762 GCTGAGAAGGAGAAAGAGGAGGG + Intronic
1009950440 6:70389226-70389248 ACTGAAATTCAGAAAGATGAAGG - Intergenic
1010335889 6:74683201-74683223 GCTGAAAGGTAGAAAGAAGAAGG + Intergenic
1011172483 6:84521511-84521533 TTTAAAAGGCTGAAAGAGGGAGG + Intergenic
1011295486 6:85822586-85822608 ACTGAAAGGGAGAAAGCTGAAGG - Intergenic
1011722701 6:90175839-90175861 TCTGAGGGCCAGATAGAGGAGGG - Intronic
1012260230 6:97080241-97080263 TCAGAAGGCCAGAAAGAGAAAGG + Intronic
1012272200 6:97227309-97227331 TAAGAAAGGAAGAAAGAGTATGG - Intronic
1012497677 6:99852582-99852604 TCTGGGAGGCAGAGAGAGGAAGG - Intergenic
1012517154 6:100075639-100075661 TATAAAAGGCAGACAGAGTAGGG + Intergenic
1012845558 6:104383129-104383151 TCTTAAAGGCAGCTAGAGAAAGG + Intergenic
1014588585 6:123232513-123232535 TCTGAGAAGCAGAAAGGGCAAGG + Intronic
1015308795 6:131741696-131741718 GGAAAAAGGCAGAAAGAGGAAGG + Intronic
1015730671 6:136344710-136344732 TCAGAAAGTCAGACAGGGGAGGG + Intronic
1016092300 6:139994498-139994520 TTTGAGAGGCAGAAAGAGAATGG + Intergenic
1016572251 6:145527684-145527706 TCTTAAAGACAGAAGAAGGATGG + Intronic
1016637916 6:146316163-146316185 TCTAAAAGCCAGAAAAAGCAAGG - Intronic
1016755339 6:147678565-147678587 TCTGGTAGGCAGAAAGATGGGGG + Intronic
1016903122 6:149121471-149121493 CCTGAAAGGTAGAAAGAAGAGGG + Intergenic
1017259379 6:152369403-152369425 TCTGTAAGGTCGACAGAGGACGG + Intronic
1017473424 6:154763157-154763179 AATGAAAAGCAGAATGAGGAGGG - Intronic
1017680028 6:156854233-156854255 CCAGAAAAACAGAAAGAGGAGGG - Intronic
1017698492 6:157043270-157043292 TTTGAAATGCAGCAAGAGGAAGG - Intronic
1017753184 6:157507810-157507832 TCTGGAATGCAGGAACAGGAAGG - Intronic
1017869766 6:158477271-158477293 TATGAAAAGCAGAACTAGGAGGG + Intronic
1018097735 6:160406702-160406724 ACAGAGAGGCAGAAAGAAGAAGG - Intronic
1018179195 6:161205959-161205981 TCTGAAAGGTGGAGAGAAGAAGG + Intronic
1018762746 6:166905661-166905683 TCTGAAAGGCAGGAAGCGGCAGG + Intronic
1019057279 6:169232583-169232605 TCAGAAAAGCAGCAGGAGGAAGG - Intronic
1019957397 7:4426087-4426109 TCTGAAAGGGGGAGAGAAGAAGG - Intergenic
1019973738 7:4563364-4563386 TCTGGAAAGTGGAAAGAGGAAGG + Intergenic
1019979897 7:4613783-4613805 TCTGGAAGGGAGTAGGAGGAGGG - Intergenic
1020012474 7:4814115-4814137 TTTGGAAGGCAGAAAGCAGATGG - Intronic
1020364436 7:7365468-7365490 GCTCAAAGGCTGAAAGAGAATGG - Intronic
1020674617 7:11166740-11166762 TCTAAAAGGAAGAAAGAGATTGG + Intronic
1020716635 7:11681840-11681862 CCTGAAAGGCAGCTAGAGAAAGG + Intronic
1020745382 7:12072786-12072808 TCTCAACAGCAGAAAAAGGATGG + Intergenic
1020829492 7:13076163-13076185 TCTGAAAAACAGCAAGAAGAAGG - Intergenic
1020927825 7:14355093-14355115 GGTGAATGGCAGAAAGAGGATGG - Intronic
1021057146 7:16063269-16063291 TCACAGAGGCAAAAAGAGGAAGG + Intergenic
1021297614 7:18927834-18927856 GCTGAATGGCAGAGTGAGGATGG + Intronic
1022096904 7:27146882-27146904 TCTGAAGGGCAGAAAGGAGAGGG + Intronic
1022176084 7:27873266-27873288 TGTGGCAGCCAGAAAGAGGATGG - Intronic
1023023525 7:36031578-36031600 TCTTAAAGTCAGACAGAGAAGGG - Intergenic
1023076387 7:36486495-36486517 ACTCAAAGGCAGGCAGAGGAAGG - Intergenic
1023320138 7:38987924-38987946 TCTGGAAGGAAGAAACAAGAGGG - Intronic
1023495145 7:40787517-40787539 ACTGAAAGACAGAGAGAAGAAGG + Intronic
1024057881 7:45677109-45677131 TGTGAAAGGTGGAAAGAAGAGGG - Intronic
1024089949 7:45928536-45928558 TCCGAAAGGGAGAAATTGGAAGG - Intergenic
1024195701 7:47056855-47056877 TCTGAAAGGTAGTAAGAAGAAGG - Intergenic
1024251584 7:47509604-47509626 TCAGAAAGGCAGGGAGAGTATGG - Intronic
1024635129 7:51281244-51281266 TCTGAACAACATAAAGAGGAAGG + Intronic
1024866418 7:53908953-53908975 GATGAAAGGGAGAAAGATGAAGG - Intergenic
1025042903 7:55663150-55663172 TCTTAAAGGCAGGTAGAGAAAGG + Intergenic
1026489150 7:70847846-70847868 TATGAACAGCAGAAAGAGGGTGG + Intergenic
1026662423 7:72313886-72313908 TGTGGAAGGCACAAAGAAGAGGG + Intronic
1027129698 7:75582151-75582173 TCTGGAAGGGAGGCAGAGGAAGG + Exonic
1027171019 7:75872506-75872528 CCTGACAGGCACAGAGAGGAAGG + Intronic
1027463000 7:78478711-78478733 CCTGAAAGGTGGAAAGAAGAAGG + Intronic
1027656464 7:80936239-80936261 TCTAGAAGGCAGAAAGCAGATGG - Intergenic
1027780997 7:82520318-82520340 TCTGGAAGACAGAAAGTGGATGG + Intergenic
1027816297 7:82976342-82976364 TCTGAAGGGCAGGCAGAGGAAGG - Intronic
1027844617 7:83356833-83356855 CCTCAAATGCAGAAAGAAGAAGG + Intergenic
1028295508 7:89124897-89124919 CCTGATAGACAAAAAGAGGATGG - Intronic
1028735362 7:94205402-94205424 TCCCAAAGGCAGAAGGAGAATGG + Intergenic
1028769521 7:94601342-94601364 GCTGGAAGGCAGAAAGATCAAGG - Intronic
1028866178 7:95716361-95716383 TCTGAAAGGTGGAAAGAAGGAGG + Intergenic
1028966201 7:96804461-96804483 CCTGAAAGGCAGAATTAGAAGGG - Intergenic
1029316758 7:99723037-99723059 CCTGAAATGTAGAAACAGGAAGG - Intronic
1029634996 7:101777778-101777800 TCACAAAGGAAGGAAGAGGAAGG - Intergenic
1029889833 7:103915898-103915920 TCTGCAGAGCAGAAAAAGGATGG + Intronic
1029910833 7:104145710-104145732 TCTGAAAGGTAGAAAGAGGTAGG + Intronic
1029973191 7:104809435-104809457 CCTCAAAGGCAGAACGTGGATGG - Intronic
1030195497 7:106849277-106849299 TGTGAAAGACAGCAAGAGGATGG - Intergenic
1030290239 7:107864817-107864839 TCTGAAGGACAGAAAGTAGAGGG + Intergenic
1030766823 7:113420633-113420655 TATTAATGGGAGAAAGAGGAGGG + Intergenic
1030775746 7:113531934-113531956 TCAAGAAGGCAGAAAGAGAAAGG + Intergenic
1031029228 7:116716402-116716424 TATGAAAGAAAGAAAGAGTAAGG + Intronic
1031323357 7:120361659-120361681 TTTGAAAAGCAGAAAGGCGAAGG + Intronic
1031947135 7:127854026-127854048 CCTGAAAGGCAGAAAGCAGATGG - Intronic
1032616935 7:133482943-133482965 TGTGACAGGCTGAGAGAGGAGGG - Intronic
1032722151 7:134558976-134558998 TCTGGACAACAGAAAGAGGATGG + Intronic
1032869826 7:135972946-135972968 TCTACAAGGAAGAAACAGGATGG + Intronic
1034083437 7:148301868-148301890 TCTGAATGGAAGAGAGTGGATGG + Intronic
1034190188 7:149207781-149207803 TCAGAGAGGCTGACAGAGGAGGG + Intronic
1034192187 7:149221354-149221376 TCAGGAAGGCAGAAAAAGGTTGG + Intronic
1034290023 7:149923007-149923029 GCTGAAAGGGAGAAAGGGGGAGG + Intergenic
1034384140 7:150724291-150724313 TCTTAAAGAAATAAAGAGGAGGG - Intronic
1035156671 7:156920113-156920135 TCTGAAAAGTGGAAAGAGGAAGG + Intergenic
1036034995 8:5009022-5009044 TCTTGAAGGCAGCAAGAGTAAGG - Intergenic
1036038899 8:5052383-5052405 TTAAAAAGGCAGAAAAAGGATGG - Intergenic
1036504294 8:9341389-9341411 TTTAAAAGACAGAAAGAAGATGG + Intergenic
1037692038 8:21190045-21190067 TAGAAAAGGCAGAATGAGGACGG + Intergenic
1038550970 8:28468387-28468409 ACTGAATGGCAAAAAGAGGGTGG + Intronic
1038570467 8:28657918-28657940 ATGGGAAGGCAGAAAGAGGAAGG - Intronic
1038978079 8:32723809-32723831 GCTGAAAGGAAGAAAGAAGAAGG + Intronic
1039080476 8:33728958-33728980 TCAGAAAAGCAGCAAGAAGATGG - Intergenic
1039857997 8:41433029-41433051 ACCAAAAGGCAGAAAAAGGAAGG + Intergenic
1039869470 8:41533399-41533421 CTTGAAAGGCAGCTAGAGGATGG + Intronic
1039972600 8:42333125-42333147 TCTGAAAGGTAGAGATAAGACGG + Intergenic
1040773373 8:51008097-51008119 TCTGAAAGGGAGACAGAGAGTGG - Intergenic
1041158096 8:55008761-55008783 CTTGTAAGGGAGAAAGAGGAAGG - Intergenic
1041321526 8:56618740-56618762 TCTGAGAGACAGAAGGAAGAAGG - Intergenic
1041466568 8:58163179-58163201 TCTGAAAGAAAGAAAGAGAAAGG + Intronic
1042151431 8:65790158-65790180 TCTGAGAGACAGAAAGACCAGGG + Intronic
1042177929 8:66056076-66056098 TCTGAAAGGTAGAAAGAGAAAGG + Intronic
1042395457 8:68286420-68286442 TCTGAAAGGCAGTAAGAGGAAGG - Intergenic
1042407331 8:68421250-68421272 TCTGAAATCTAGAAAGAAGAAGG + Intronic
1042455660 8:68999518-68999540 TCTGAAAGGTAGAGAGAAGAAGG - Intergenic
1042532914 8:69833169-69833191 CCTGCAAAGCAGAAAGAGGGCGG + Exonic
1042679782 8:71370211-71370233 TCTGAAAGGCAGGACGTGTAGGG - Intergenic
1042741171 8:72048528-72048550 TGTGCAAGGCAGAAACAGGCAGG + Intronic
1043089843 8:75885478-75885500 TCTGCTAGGCAGAAAAAGTATGG - Intergenic
1043146746 8:76666730-76666752 GCTGAAAGGCAGAAAGATTTGGG + Intergenic
1043506273 8:80906448-80906470 TCTGAAAGTGAGAAAGAATAAGG - Intergenic
1043950162 8:86299780-86299802 ACTCAAAGGCAGAGAGAAGAAGG - Intronic
1044084361 8:87925840-87925862 GCTGAAAGGTAGAAAGAAGAAGG + Intergenic
1044139800 8:88636387-88636409 TCTGCAAGCCAGAAAGAGAGAGG + Intergenic
1045297848 8:100887981-100888003 AATGAAGGGCAGAGAGAGGAAGG + Intergenic
1045653050 8:104360028-104360050 ACTGAAAGTCAGAAAAAAGAAGG + Intronic
1045697885 8:104831182-104831204 TCTGAAAGAAAGAAAGTGAAGGG + Intronic
1045856796 8:106773493-106773515 TATGAATAGTAGAAAGAGGAAGG + Intergenic
1045948082 8:107819703-107819725 GCTAAGAGGCAGGAAGAGGAGGG - Intergenic
1046608493 8:116397014-116397036 TCTAAAAGACAGAAAGAATAAGG + Intergenic
1046611718 8:116432954-116432976 TTTGAAAGAAAAAAAGAGGAGGG + Intergenic
1047026192 8:120827047-120827069 TAGGAAAGGAAGAAAGAGGCAGG - Intergenic
1047137117 8:122092001-122092023 TCTGAGAGGAGGAAAGGGGAAGG - Intergenic
1047236627 8:123047460-123047482 TCAGAGAGAAAGAAAGAGGAAGG - Intronic
1047388944 8:124434348-124434370 GCAGAAAGGCAGATAGAGGGGGG - Intergenic
1048224695 8:132573967-132573989 TCTGAAGGGGTGAAAGAGGTGGG + Intronic
1048620638 8:136128921-136128943 TCTGTAAGGCAGATGAAGGAGGG + Intergenic
1048625849 8:136184208-136184230 CCTGCAAGGGAGAAAGATGAAGG + Intergenic
1048812196 8:138298827-138298849 TCTGAAATGCAAAATGAGAAAGG + Intronic
1050160270 9:2711604-2711626 TCTGAAAGGCAGAGGGAGAGAGG - Intergenic
1050412133 9:5377569-5377591 TCTGAAAGAGAGAAAGCAGATGG + Intronic
1050602063 9:7262948-7262970 ACTAAAAGACAGAAAGAGCATGG - Intergenic
1050993957 9:12189993-12190015 TCTGAAAGGCAGTAAAATAATGG + Intergenic
1051791351 9:20806322-20806344 TCTAAGAGGCCGAAAGAGGCAGG - Intronic
1052199232 9:25757649-25757671 TCTGAAAGGTGGAGATAGGAAGG + Intergenic
1052712845 9:32078170-32078192 TCACGAAGGCAGAAAGAGGAAGG - Intergenic
1053096552 9:35333545-35333567 GATGAAAGGGAGAAGGAGGAAGG - Intronic
1054869015 9:70032019-70032041 TCTGGAAGCCGGAAAGAAGATGG - Intergenic
1055037308 9:71831404-71831426 TCTAAAAGGGAGAGAGAAGATGG + Intergenic
1055114209 9:72589661-72589683 TCTCAAAATCAGAAAAAGGATGG - Intronic
1055877262 9:80958427-80958449 TCTGATAGGCAGGAAATGGATGG + Intergenic
1056218480 9:84428271-84428293 GATGAAGGGGAGAAAGAGGAGGG - Intergenic
1056618296 9:88187557-88187579 TCTGAAAGAAGGAAAGGGGAGGG + Intergenic
1056619340 9:88197815-88197837 CCTGAAAGCCAGAAAGAAGAAGG - Intergenic
1056622344 9:88224810-88224832 TCAAACAGGCAGAAACAGGATGG + Intergenic
1056692795 9:88822486-88822508 TCTGAAAGGGAGAAAGAGGAGGG - Intergenic
1056882333 9:90408202-90408224 TTTGAGGGGTAGAAAGAGGAAGG + Intergenic
1057386932 9:94612971-94612993 TCAGATAGGCAGAGAAAGGAAGG - Intronic
1057454139 9:95191960-95191982 TCCATAAGGCAGCAAGAGGAGGG + Intronic
1058339882 9:103881554-103881576 TGTGAAATACAGAAAGAGAAGGG - Intergenic
1058349926 9:104009471-104009493 TCTGAAAGGCACAGAGAGGAAGG - Intergenic
1058472939 9:105299719-105299741 TAGGACAGGCAGAAGGAGGAAGG - Intronic
1059204987 9:112456230-112456252 TCTGAAAAGGAGAAAAAAGATGG - Intronic
1059218160 9:112586419-112586441 TCTGAAAGGCAAAAGTAGAAAGG + Intronic
1060424524 9:123493400-123493422 ACTGAGAGGGTGAAAGAGGATGG + Intronic
1060755723 9:126211887-126211909 TCTGAGAGAGAGAGAGAGGATGG + Intergenic
1061229075 9:129301952-129301974 TCTGAAAGGTAGAAAGAAGAAGG - Intergenic
1061240628 9:129369581-129369603 TCTGATAGCAAAAAAGAGGAGGG - Intergenic
1062138313 9:134941535-134941557 TCAGACAAGCAGAATGAGGATGG + Intergenic
1062229224 9:135472175-135472197 CCTGAAAGGCAAAAGGAGGTTGG - Intergenic
1062437649 9:136553706-136553728 TCTGTGAGCCAGAAAGAGAACGG + Intergenic
1185573343 X:1151745-1151767 TCAGAAACGGAGAAAGAGGTGGG - Intergenic
1185615752 X:1420793-1420815 TCTGAAAAATAGAAATAGGAAGG - Intronic
1185659161 X:1713147-1713169 ACTCAAAGACAGACAGAGGAGGG + Intergenic
1186123484 X:6387472-6387494 ACAAAAAGGCAGAGAGAGGAAGG - Intergenic
1186403265 X:9279018-9279040 TCTGAAATGCTGGATGAGGAAGG + Intergenic
1186614643 X:11173842-11173864 TATGAAAGAGAGGAAGAGGAAGG - Intronic
1186778541 X:12890522-12890544 TCTGAAATGGATCAAGAGGAAGG + Intergenic
1187754978 X:22514115-22514137 ACTTAAAGGAAGAAATAGGAAGG - Intergenic
1187853091 X:23610337-23610359 ACAGAAAGAGAGAAAGAGGAAGG + Intergenic
1188197275 X:27251925-27251947 TCTGAAAGGTGGAAAGAGAAGGG - Intergenic
1189169864 X:38898505-38898527 AGTCAAAGGCAGAAAGAGGAAGG + Intergenic
1189254046 X:39623691-39623713 TCCTAAAGGGAGAAACAGGAAGG + Intergenic
1189322139 X:40093390-40093412 TCTTAAAGAAAGGAAGAGGAGGG + Intronic
1189442340 X:41048667-41048689 ACTGAAAGGCAGAGAGAAAAAGG - Intergenic
1189650593 X:43184784-43184806 TCAGTATGGCAGAAAGAGGCTGG + Intergenic
1189975474 X:46457600-46457622 TCTGAAAGGCAAACAGTAGAAGG - Intronic
1189983987 X:46537424-46537446 TCTGAAAGGCAAACAGTAGAAGG + Intronic
1190571316 X:51784967-51784989 TCTGAAAGGTAGAAAGAAGAAGG - Intergenic
1190594991 X:52043527-52043549 TCTTACAGGAACAAAGAGGAGGG - Intergenic
1190613833 X:52210546-52210568 TCTTACAGGAACAAAGAGGAGGG + Intergenic
1190692965 X:52927272-52927294 TCAGAAAGGGAGAAAGAGATGGG + Intronic
1190795442 X:53736941-53736963 TCTGAAAAGTAGAAAGAAGAAGG + Intergenic
1191112152 X:56812370-56812392 TAGGGAGGGCAGAAAGAGGAGGG - Intergenic
1191910790 X:66147225-66147247 TCTGAAAGATAGAAAGAAGAAGG - Intergenic
1191968295 X:66785567-66785589 TCTGAAAAGTGCAAAGAGGAAGG + Intergenic
1192050067 X:67716644-67716666 AATGCCAGGCAGAAAGAGGATGG + Intronic
1192206879 X:69102188-69102210 TCTTAGAGGCAGAAAGTGAAAGG - Intergenic
1192207311 X:69105076-69105098 TCTGAAAGCCAGGATGGGGAAGG + Intergenic
1192247720 X:69387529-69387551 TCTCAGAGGAAGAAAGAGGTCGG - Intergenic
1192559123 X:72113886-72113908 ACTGAGGGTCAGAAAGAGGAAGG - Intergenic
1192822939 X:74663711-74663733 TTTTAAAGGCAGGAAGAGGCTGG + Intergenic
1193439990 X:81528478-81528500 TCTTAAAGGCAGCTAGAGAAAGG - Intergenic
1193453743 X:81703059-81703081 TCAGAAAGGAGGAAAGTGGAAGG - Intergenic
1194081313 X:89468175-89468197 TCTGAAAGGTGGTAAGAAGAAGG - Intergenic
1194594980 X:95846862-95846884 TCTGAAAGCCAGAAAGAGCAAGG - Intergenic
1194685546 X:96909466-96909488 TCTGAAAGGCAGAGAAATGGTGG + Intronic
1195641787 X:107183492-107183514 TCTGAAAGGTAGAGAGAAGAAGG + Intronic
1195759236 X:108228028-108228050 GTTGAAGGGCAGAAAGAGAATGG + Intronic
1197230529 X:123999121-123999143 TCTGAAAGATAAAAACAGGATGG - Intronic
1197744373 X:129921260-129921282 TCTGAGAGTGAGGAAGAGGAGGG + Exonic
1198530431 X:137546481-137546503 TCTGCATGCCAGAAAGAGGCGGG - Intergenic
1198843843 X:140888176-140888198 CCTGATAGGCAGAAAGAAAATGG + Intergenic
1198951472 X:142077302-142077324 TCTGAAATGCAGAAAGACATTGG - Intergenic
1199178729 X:144825815-144825837 ATTGAAAAGCAGAAAGAAGATGG - Intergenic
1200066802 X:153507859-153507881 GCTGACTGGAAGAAAGAGGAGGG + Intronic
1200258989 X:154602042-154602064 ACTGAAAGACACAAAAAGGAAGG - Intergenic
1200433985 Y:3124372-3124394 TCTGAAAGGTGGTAAGAAGAAGG - Intergenic
1200498511 Y:3916155-3916177 TATGAAAGACAGGAAGAGGCAGG + Intergenic
1201054092 Y:9971181-9971203 GTTGAAAGGCTGAAATAGGAAGG + Intergenic
1201605204 Y:15776497-15776519 ACAAAAAGGCAGAGAGAGGAAGG - Intergenic
1201735799 Y:17260211-17260233 GCTGAAGAGAAGAAAGAGGAGGG + Intergenic
1201968368 Y:19763410-19763432 TCTGAAAGGCAGGAGCAGGATGG + Intergenic
1202170264 Y:22036025-22036047 TCTGAAAGGCAGAAAGAGGAAGG + Intergenic
1202203213 Y:22376437-22376459 GTTGAAAGGCTGAAATAGGAAGG - Intronic
1202221101 Y:22550348-22550370 TCTGAAAGGCAGAAAGAGGAAGG - Intergenic
1202240027 Y:22757326-22757348 GTTGAAAGGCTGAAATAGGAAGG - Intergenic
1202322011 Y:23645314-23645336 TCTGAAAGGCAGAAAGAGGAAGG + Intergenic
1202393013 Y:24391088-24391110 GTTGAAAGGCTGAAATAGGAAGG - Intergenic
1202477772 Y:25279029-25279051 GTTGAAAGGCTGAAATAGGAAGG + Intergenic
1202548756 Y:26024742-26024764 TCTGAAAGGCAGAAAGAGGAAGG - Intergenic