ID: 1113554720

View in Genome Browser
Species Human (GRCh38)
Location 13:111223538-111223560
Sequence CTACACTTCCCCAGGGAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 240
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 222}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113554720_1113554728 12 Left 1113554720 13:111223538-111223560 CCTGCTTCCCTGGGGAAGTGTAG 0: 1
1: 0
2: 1
3: 16
4: 222
Right 1113554728 13:111223573-111223595 TGCCCTCTTGTGGTCGGAGATGG 0: 1
1: 0
2: 1
3: 9
4: 115
1113554720_1113554727 6 Left 1113554720 13:111223538-111223560 CCTGCTTCCCTGGGGAAGTGTAG 0: 1
1: 0
2: 1
3: 16
4: 222
Right 1113554727 13:111223567-111223589 GTGGTTTGCCCTCTTGTGGTCGG 0: 1
1: 0
2: 2
3: 7
4: 102
1113554720_1113554731 29 Left 1113554720 13:111223538-111223560 CCTGCTTCCCTGGGGAAGTGTAG 0: 1
1: 0
2: 1
3: 16
4: 222
Right 1113554731 13:111223590-111223612 AGATGGAATTGTTCTTGTCAAGG 0: 1
1: 0
2: 0
3: 18
4: 236
1113554720_1113554726 2 Left 1113554720 13:111223538-111223560 CCTGCTTCCCTGGGGAAGTGTAG 0: 1
1: 0
2: 1
3: 16
4: 222
Right 1113554726 13:111223563-111223585 ATTGGTGGTTTGCCCTCTTGTGG 0: 1
1: 0
2: 0
3: 4
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113554720 Original CRISPR CTACACTTCCCCAGGGAAGC AGG (reversed) Intronic
900118789 1:1039949-1039971 TTGCACTTCTCCAGGGAAGCTGG + Intronic
901353505 1:8620991-8621013 CCACACTTCCACAGGGTAGGTGG - Intronic
901740135 1:11336262-11336284 CTGCCCTTCCCCAGCAAAGCAGG + Intergenic
902339255 1:15772075-15772097 CTACACATCCCCAGGGGATGCGG - Intronic
903686984 1:25139143-25139165 CTACTCGTCCCCAGGCAACCAGG + Intergenic
904998847 1:34652401-34652423 AGACAATTCCACAGGGAAGCTGG - Intergenic
905797592 1:40824240-40824262 CTACCTTTCCCCAGGGCAGAAGG - Exonic
906190900 1:43898932-43898954 TGACACTTCCCCAGGAAAACAGG - Intronic
907585822 1:55616924-55616946 CTTCACTTCCCCAACAAAGCAGG + Intergenic
912762350 1:112380241-112380263 TTTCTCTTCCCCAGGTAAGCAGG + Intergenic
913036555 1:114971362-114971384 GTACAGTTCGCCAGGGAAGTAGG + Intronic
919281633 1:195496499-195496521 ATACAGTTCACCAGGGAAGTGGG + Intergenic
921968224 1:221116283-221116305 CTGCTCCTCCCCAGGAAAGCAGG - Intergenic
922342969 1:224672240-224672262 ATACACCTCCCCAGGGAAGCAGG - Intronic
922722446 1:227905823-227905845 GGGCCCTTCCCCAGGGAAGCGGG - Intergenic
922731168 1:227949383-227949405 CCAGGCTTTCCCAGGGAAGCAGG - Intergenic
1062902382 10:1156157-1156179 CTCCACATCCCCAGGGTAGCTGG - Intergenic
1062966964 10:1615330-1615352 CTGCCCCTCCCCAGAGAAGCTGG + Intronic
1067744347 10:48924128-48924150 CTTCACCTCCCCAGGGAGTCTGG + Intronic
1069593582 10:69656421-69656443 CACCACTGCCCCAGGGAAGAGGG - Intergenic
1070162956 10:73876635-73876657 CTACCCCTCCCCAGGGCAACAGG + Intergenic
1073133298 10:101204753-101204775 AGACACTTCCTCAGGGATGCGGG - Intergenic
1075054179 10:119206161-119206183 GTATACTCCCCCAGGAAAGCAGG + Intergenic
1075539717 10:123301921-123301943 CTAGACTTCCCCAATGAAGCTGG + Intergenic
1076409002 10:130232652-130232674 TTCCCCTTCCCCAGGGCAGCTGG - Intergenic
1077600227 11:3569541-3569563 CTGCACTTCCCCAGCTCAGCGGG + Intergenic
1078186969 11:9060380-9060402 CTTCACCTCCCCAGGGAGACTGG - Intronic
1079369859 11:19842171-19842193 CTGCATTCACCCAGGGAAGCTGG + Intronic
1080115344 11:28615671-28615693 CAACTCTGCCCAAGGGAAGCTGG - Intergenic
1080539473 11:33252783-33252805 CTCCCCTTCCTCAGGGAAGTTGG - Intergenic
1081831814 11:46121218-46121240 CTCCTCTTCCCCAGGCAAGGGGG + Intergenic
1082063869 11:47883000-47883022 TTACATTTCCCCAGAGAAGTGGG + Intergenic
1083292658 11:61698577-61698599 GTGAGCTTCCCCAGGGAAGCAGG - Intronic
1086529331 11:87765138-87765160 CTTCAATTCCACAGGGAAGGAGG - Intergenic
1091273387 11:134333067-134333089 CTGCACTTCCCCTGGGAGACAGG + Intronic
1091306073 11:134536869-134536891 CTGCACTTCCCCAGCGGAGTTGG - Intergenic
1091461516 12:646848-646870 CAACCCTTGTCCAGGGAAGCAGG - Intronic
1092426372 12:8378901-8378923 CTGCACTTCCCCAGCTAAGCCGG + Intergenic
1095397414 12:41776610-41776632 CTCCACTCCCCCAGGGAAAGAGG + Intergenic
1096843614 12:54393314-54393336 CCACACTGCCCCAGGGACTCTGG + Intergenic
1097927657 12:65147772-65147794 TCAAACTTCCCCAGGGAAGATGG + Intergenic
1099041973 12:77667486-77667508 ATACAGGTCCCCAGGGAAGTGGG - Intergenic
1101823294 12:108200851-108200873 CTAGGCTTCCCCAGGGCAGAAGG - Intronic
1102254920 12:111409856-111409878 GGACACTTCCCCAGGGGAACAGG + Intronic
1102870561 12:116410821-116410843 CTGAATTTCCCCAGAGAAGCTGG + Intergenic
1103018594 12:117515374-117515396 CTACACTTGCCTAGAGGAGCAGG + Intronic
1104443507 12:128814613-128814635 CTGCATTTCCCCAAGGAGGCGGG - Intronic
1104717124 12:131023438-131023460 ACCCACTTCCCCAGGTAAGCCGG + Intronic
1104944280 12:132408777-132408799 CCACACGGCCCCAGGGGAGCAGG + Intergenic
1110474994 13:75903279-75903301 CTTCTTTTCACCAGGGAAGCTGG - Intergenic
1113554720 13:111223538-111223560 CTACACTTCCCCAGGGAAGCAGG - Intronic
1115012507 14:28566512-28566534 CTACAGATCCCAAGGGAATCTGG - Intergenic
1117624151 14:57618448-57618470 CTCCCCTACCCAAGGGAAGCCGG + Intronic
1120736373 14:88057560-88057582 ATACAGATCCCCAGGGAAGCGGG + Intergenic
1122616058 14:103018831-103018853 CTCCCCATCCCCATGGAAGCTGG - Intronic
1124168634 15:27352610-27352632 CCACACTGCCCCGGGGAGGCAGG + Intronic
1130115268 15:81000808-81000830 CTGCTCCTCCCCCGGGAAGCTGG - Intergenic
1130930907 15:88426975-88426997 TTACTCTTACCTAGGGAAGCGGG - Intergenic
1132932488 16:2466034-2466056 CTTCCCTTCCCCAGGAAGGCAGG + Intergenic
1133371950 16:5252030-5252052 CTGCACTTCCCCAGCTCAGCGGG - Intergenic
1134064512 16:11219125-11219147 CTAGACTTTGCCAGGGATGCTGG + Intergenic
1135350838 16:21727760-21727782 CTGATCTTCCCCAGGGATGCAGG - Intronic
1137034674 16:35559696-35559718 TTAAAATTCCCCAGGTAAGCAGG + Intergenic
1140093516 16:71855925-71855947 CTTCCCTACCCCAGGAAAGCTGG - Exonic
1141163385 16:81644284-81644306 CTACAATTTTCCAGGGAAGGAGG - Intronic
1141309127 16:82896131-82896153 CTATACTTCTACAGGGAAACAGG - Intronic
1141391738 16:83670441-83670463 CCACAAAACCCCAGGGAAGCAGG - Intronic
1141652000 16:85397725-85397747 CCACCAGTCCCCAGGGAAGCGGG - Intergenic
1144854177 17:18258806-18258828 CTACACTTCCCCGCGGAATGCGG - Exonic
1144949383 17:18985759-18985781 CCTCGCTTCCCCAGGGAAGGTGG - Intronic
1146100687 17:29978935-29978957 CCCCCCTGCCCCAGGGAAGCTGG - Intronic
1148131262 17:45263893-45263915 CCACTCTTCCCCAGAGCAGCAGG - Exonic
1148243319 17:46014011-46014033 CAACCCTGCCCCAGGGGAGCTGG - Intronic
1148392951 17:47286325-47286347 CTTCACTTCCTCATTGAAGCGGG - Exonic
1149112172 17:53046816-53046838 CTCCTCAGCCCCAGGGAAGCTGG - Intergenic
1152008204 17:77695470-77695492 CTCCACTTTCCCCGGGATGCTGG + Intergenic
1152239649 17:79154752-79154774 CTCCCCTTCCTCAGAGAAGCAGG - Intronic
1152553198 17:81040049-81040071 CAACACTAGCCCAGGGCAGCTGG - Intronic
1152891095 17:82882113-82882135 CTGCACTTCCTCGGAGAAGCTGG - Intronic
1152988481 18:340991-341013 CTACACTTCCCCAAACAAGACGG - Intronic
1153521091 18:5954541-5954563 ATATATTTCCCAAGGGAAGCAGG - Intergenic
1155920032 18:31594479-31594501 CTGCACTTCTCCAGGACAGCAGG - Intronic
1156904259 18:42335557-42335579 CAGCACTTTCCCAGGGAAGATGG + Intergenic
1157619969 18:49011320-49011342 CCAAACTTCCCCAGGAAAGGAGG + Intergenic
1158727203 18:59984355-59984377 AGACACTTCCCCAGGGGAGGTGG - Intergenic
1159893821 18:73978157-73978179 CTACACTTCCCCCTCGAATCTGG + Intergenic
1159937861 18:74382890-74382912 CTGCACCTCCCCAGGGGAGTGGG - Intergenic
1161794826 19:6380682-6380704 CCCCACTCCCACAGGGAAGCGGG - Exonic
1163376818 19:16938263-16938285 CTGCCCTTCCCCTGGGAAGGGGG - Intronic
1167387159 19:49170720-49170742 CTTAACTTCCCCAGGGAGGAGGG - Intronic
926092817 2:10061518-10061540 CTTCACATCCACAGGCAAGCAGG - Intronic
927847977 2:26481050-26481072 CCCCTCTTCCCCAGGGAAACTGG - Intronic
927992540 2:27458255-27458277 ATCCAATTCCCCAGGGAAGCAGG + Intronic
928472709 2:31589998-31590020 ATACATGTCACCAGGGAAGCGGG - Intergenic
929196951 2:39194512-39194534 CTACTCTTCACCAATGAAGCTGG - Intronic
931122120 2:59231501-59231523 CTCCACTGCTCCAGGGAATCTGG - Intergenic
931715030 2:65022024-65022046 TCACACCTCCCCAGGGAAGGAGG - Exonic
932741079 2:74291561-74291583 CTACACTGCCCCATTGAGGCTGG + Intronic
934885969 2:98025296-98025318 CCACCCCACCCCAGGGAAGCTGG + Intergenic
939029480 2:137054512-137054534 ATATACATCCCCAGAGAAGCAGG - Intronic
947023691 2:225712694-225712716 CTATTCTTCCCTAGGGAAGGAGG + Intergenic
947167528 2:227277454-227277476 CCACATTTCCCCAGGGATCCAGG - Exonic
947747765 2:232517944-232517966 CCTCACTTCCCCAGCCAAGCTGG - Intergenic
1168894497 20:1313752-1313774 CTTCATTTCCCAAGGGAAACTGG + Intronic
1169685298 20:8264884-8264906 CTACATTTCCCCAGGGCAGTAGG - Intronic
1171246225 20:23611824-23611846 CTACACTGTCCCAGAGAACCTGG - Intergenic
1171473435 20:25390209-25390231 CGACCCTTTCCCGGGGAAGCCGG - Intronic
1172387940 20:34547146-34547168 ATACACTTCCCTGGGGACGCGGG + Intronic
1173781412 20:45760213-45760235 TTACCCTTCCCCAGAAAAGCGGG - Intronic
1173995893 20:47338399-47338421 CTAAACTTCCCAAGAAAAGCAGG + Intronic
1174049691 20:47759030-47759052 CTCCATTTTCCCAGGGCAGCCGG + Intronic
1175836416 20:61998586-61998608 CCACAGTTCCCCAGGGACGGGGG - Intronic
1178864515 21:36316906-36316928 CTCCTCTACCCAAGGGAAGCTGG - Intergenic
1180704084 22:17798074-17798096 CTGCATTTCCCCAGGGAACACGG + Intronic
1180831514 22:18909342-18909364 CTACAGTTCCCCAGGAAGGAGGG - Intronic
1181045323 22:20211568-20211590 CTGCACTTCCCCAGGCATCCTGG + Intergenic
1181480514 22:23196226-23196248 CTACACATCCAGAGGGACGCTGG - Intronic
1182087843 22:27573764-27573786 CCTCACTTCCCCAGAGAAGCAGG + Intergenic
1203281598 22_KI270734v1_random:134613-134635 CTACAGTTCCCCAGGAAGGAGGG - Intergenic
949459605 3:4276101-4276123 ATAAATTTCCCCAGGGAAGATGG - Intronic
949925878 3:9041248-9041270 CTAAGTTTACCCAGGGAAGCTGG + Intronic
950024978 3:9813960-9813982 CTTCACTTACCAAGGGCAGCGGG - Intronic
950468876 3:13172584-13172606 CAACACTTCCCGAGGGCAGATGG + Intergenic
950484009 3:13262142-13262164 CCACACTTCCCCAGGTGAACGGG + Intergenic
950587915 3:13909250-13909272 ATACAGTTCACCAGGGAAGTTGG - Intergenic
952513314 3:34078612-34078634 CTACTCTTCCACAGGGGAGAGGG - Intergenic
953923146 3:46965988-46966010 CTACACATCCCAAGGTGAGCAGG + Intronic
954029644 3:47809634-47809656 CTCCACTCCCCAAGGGATGCTGG - Intronic
954524878 3:51261325-51261347 CTCCCCTACCCAAGGGAAGCTGG + Intronic
954619405 3:51986974-51986996 CTACACCTCCCCAGGGGTGCGGG + Exonic
954699863 3:52445539-52445561 CCACCCTTACCCAGGGGAGCTGG - Intergenic
957071055 3:75568192-75568214 CTGCACTTCCCCAGCTCAGCGGG + Intergenic
961283060 3:125778532-125778554 CTGCACTTCCCCAGCTCAGCGGG - Intergenic
961770759 3:129248378-129248400 CTTCCCCTCCCCAGGCAAGCTGG + Intergenic
962214090 3:133504788-133504810 CTACACTTTTCCAGTGAAGTGGG + Intergenic
962344200 3:134607800-134607822 CTATACTGCCCCAGGGGAGTGGG + Intronic
962928159 3:140013923-140013945 CTGCAACTCCCCAGGGAATCTGG + Intronic
964390146 3:156188164-156188186 ATAAACTTACCAAGGGAAGCTGG - Intronic
964765344 3:160173694-160173716 TTACACTTCCCCAGAGGAGGAGG - Intergenic
968557037 4:1250686-1250708 CCCCACTTCCCCAGGGGAGCTGG + Intergenic
968589341 4:1449832-1449854 CTCCACTCCCCGTGGGAAGCTGG + Intergenic
969014654 4:4095890-4095912 CTGCACTTCCCCAGCTCAGCGGG + Intergenic
969611992 4:8232592-8232614 AAACCCTGCCCCAGGGAAGCAGG - Intronic
969621344 4:8280405-8280427 CCAAACCTCACCAGGGAAGCAGG + Intronic
969739286 4:9012551-9012573 CTGCACTTCCCCAGTTCAGCGGG - Intergenic
969798467 4:9544064-9544086 CTGCACTTCCCCAGCTCAGCGGG - Intergenic
971423472 4:26494171-26494193 CTCCAAATCCCCAGGGATGCTGG - Intergenic
972728571 4:41769592-41769614 CTACACTTCCCATTGGAAGTTGG + Intergenic
973624475 4:52757646-52757668 TCACTCTTCCCCAGGGAAGGAGG + Intergenic
975427754 4:74250433-74250455 CTACATTTTCACAGGGAAGATGG - Intronic
975768038 4:77690010-77690032 CTCCACTTCCACTTGGAAGCTGG - Intergenic
975862413 4:78691585-78691607 CTTCACTCCCCCAGCCAAGCTGG + Intergenic
977082438 4:92548837-92548859 CTACACATCGCCAGAGAAGGAGG + Intronic
977777516 4:100938855-100938877 ATACAGGTCCCCAGGGAAGTGGG - Intergenic
978308123 4:107354361-107354383 CTAAACTCCCCCAGGGAAAGGGG + Intergenic
979578539 4:122325889-122325911 ATACCCTTCCCCAGGACAGCTGG - Intronic
979674222 4:123393893-123393915 CTATACTTCCCAAGAAAAGCTGG - Intergenic
981831503 4:149007125-149007147 CTCCACCTCCCCATGGAAGGAGG - Intergenic
982049844 4:151489701-151489723 CTACAGGTCATCAGGGAAGCGGG - Intronic
982660333 4:158199222-158199244 CTGCAGCTCCCCAAGGAAGCAGG - Intergenic
983900518 4:173128599-173128621 TAAGGCTTCCCCAGGGAAGCTGG - Intergenic
985355737 4:189116891-189116913 GTACAGGTCCCCAGGGAAGTGGG - Intergenic
985491930 5:185422-185444 CAGCACTTCCCCTGGGAGGCAGG + Exonic
986460346 5:7963914-7963936 CTACACCTGCCATGGGAAGCTGG - Intergenic
986737840 5:10681251-10681273 CTATCCTTCCGCAGGGACGCTGG - Intronic
986876026 5:12110988-12111010 CTGGACTTCCCCAGAGAGGCAGG + Intergenic
987745637 5:21968237-21968259 CTGCACTTCCCCAGGGATTGTGG + Intronic
988538131 5:32087153-32087175 CATCTCTTCCCCAGGGAAGAAGG + Exonic
991765835 5:69978364-69978386 CTGCACTTCCCCAGGGATTGTGG + Intergenic
991781487 5:70139798-70139820 CTGCACTTCCCCAGGGATTGTGG - Intergenic
991845071 5:70853436-70853458 CTGCACTTCCCCAGGGATTGTGG + Intergenic
991873930 5:71140112-71140134 CTGCACTTCCCCAGGGATTGTGG - Intergenic
994139804 5:96329525-96329547 CTGCAGCTCCCCAGGGAAACTGG - Intergenic
995976321 5:118039609-118039631 CCACTCGTCCCCAGGGAAGTAGG - Intergenic
996508076 5:124289713-124289735 CTGGACTTTCCCAGGAAAGCAGG - Intergenic
1001312491 5:170621313-170621335 CTACACTAGCCCTGGAAAGCAGG - Intronic
1001983312 5:176051944-176051966 CAACACCTCGCCTGGGAAGCGGG + Intronic
1002234153 5:177792108-177792130 CAACACCTCGCCTGGGAAGCGGG - Intronic
1004224245 6:13771688-13771710 CTACTCTTCTCCAGCAAAGCAGG - Intergenic
1005581289 6:27237826-27237848 CTGCACTCCCGCAGGGAAGAAGG + Intergenic
1005668538 6:28081378-28081400 TTACTCTTCCCAAGGGAAGCAGG - Exonic
1006315974 6:33291970-33291992 CTTCACTGCCCCAGGGTGGCTGG + Exonic
1010518487 6:76803344-76803366 ATACAGGTCCCCAGGGAAGTGGG + Intergenic
1010536182 6:77034074-77034096 CCAGACTTCCTCAGGGAAGTGGG + Intergenic
1013612678 6:111809656-111809678 CCACACCTCCCCAGTGAAGAGGG - Intronic
1014372394 6:120626819-120626841 CTCCAAGTCCCCAGGGAGGCAGG - Intergenic
1015701994 6:136046628-136046650 CTGCAATTCCCCAGGGTATCAGG + Intronic
1016560575 6:145391781-145391803 TTACTCTTCCCCAGTGCAGCTGG - Intergenic
1017958925 6:159204926-159204948 CTTCATCCCCCCAGGGAAGCAGG - Intronic
1020153169 7:5699623-5699645 GTACAATTCCCCTGGGAAGATGG - Intronic
1020992414 7:15216313-15216335 TAACAATTCCCCAGGAAAGCAGG - Intronic
1022602753 7:31777265-31777287 CCACTCTTCCCCAGGGATTCTGG - Intronic
1022812201 7:33880705-33880727 TTACATTTCCCCAGAGAAGGGGG - Intergenic
1023091776 7:36624583-36624605 CTCCAGTTCCCAAGGGAACCTGG - Intronic
1029073330 7:97917519-97917541 CTGCACTTCCCCAGCTCAGCCGG + Intergenic
1033131610 7:138750185-138750207 CCACGCTTCCCCATGGAAACTGG + Intronic
1033463350 7:141567685-141567707 ATAATCTTCCCCAGGGAAGCTGG - Intronic
1035534933 8:383755-383777 CTACACCTCCCAAAGGAGGCTGG - Intergenic
1036244359 8:7103771-7103793 ATGCACTTCCCCAGCTAAGCCGG - Intergenic
1036256385 8:7209968-7209990 ATGCACTTCCCCAGGTCAGCTGG + Intergenic
1036308435 8:7668553-7668575 ATGCACTTCCCCAGGTCAGCTGG + Intergenic
1036361100 8:8077524-8077546 ATGCACTTCCCCAGGTCAGCTGG - Intergenic
1036494808 8:9260611-9260633 CTACTCTTTCCCAGGGACACTGG - Intergenic
1036553703 8:9838577-9838599 CTCCCCTACCCAAGGGAAGCCGG + Intergenic
1036897475 8:12647638-12647660 CTGCACTTCCCCAGGTCAGCTGG + Intergenic
1037443742 8:18943878-18943900 CTATACTTCACCATGCAAGCAGG + Intronic
1038676370 8:29626195-29626217 CCACACTTCCCTAGGGCTGCAGG - Intergenic
1039816655 8:41100519-41100541 CTGCCCTTTCCCAGGGAGGCTGG + Intergenic
1040066762 8:43151339-43151361 CTTCTCTTCCCCTGTGAAGCTGG + Intronic
1040357856 8:46637057-46637079 CTACAATTGCCAAAGGAAGCAGG - Intergenic
1040377576 8:46841363-46841385 CTACAATTACCAAAGGAAGCAGG - Intergenic
1040379789 8:46861297-46861319 CTACAATTACCAAAGGAAGCAGG - Intergenic
1040564372 8:48552903-48552925 CTGCACTGCCCATGGGAAGCTGG + Intergenic
1041109239 8:54469791-54469813 CAGCACTTGCCCAGGTAAGCAGG - Intergenic
1048301295 8:133253131-133253153 ATACCCTTCCCGAGGGTAGCTGG + Intronic
1050325461 9:4492849-4492871 CTCCACTTCCACAGGGAATCAGG - Intronic
1052719526 9:32156274-32156296 CTACACTTCTCAAGAGAGGCCGG - Intergenic
1057528719 9:95825321-95825343 CTGTGCTTCCCCAGGGAAGCAGG - Intergenic
1057909191 9:99004956-99004978 CTCCACTTCCCCAGGCATGCTGG - Exonic
1060510919 9:124231535-124231557 CTTCACTTCCCCTTCGAAGCTGG - Intergenic
1060932558 9:127498012-127498034 CACCTCTTCCCCAGGGAGGCAGG - Intronic
1062235920 9:135507552-135507574 CCACACGTGCCCAGGAAAGCAGG - Intergenic
1062568033 9:137171878-137171900 CTCCCCTTCCCCAGGCAAGGTGG - Exonic
1185748918 X:2594736-2594758 CTGCACCTGCCCAGGGACGCTGG + Intergenic
1189551627 X:42099430-42099452 CTACTCTTCCCCGGAGAAGAAGG - Intergenic
1189663418 X:43327424-43327446 GTATACTTCACCAGGGAAGTGGG + Intergenic
1192853366 X:74981098-74981120 GTACACTTCGTCAGGGAAGTAGG - Intergenic
1193924072 X:87464269-87464291 GTATAGTTCACCAGGGAAGCGGG - Intergenic
1196893465 X:120311242-120311264 CTAGACTTACCCATGGAATCGGG + Exonic
1197335043 X:125203157-125203179 CTGCAGTTCCCCCGGGAACCCGG + Intergenic
1198638338 X:138725614-138725636 CTGTACTTCTTCAGGGAAGCTGG + Intronic
1199953618 X:152725275-152725297 CCACATTTCCCCAGGCAGGCTGG + Intergenic
1199956064 X:152743175-152743197 CCACATTTCCCCAGGCAGGCTGG - Intergenic
1200902885 Y:8450738-8450760 CTACAATCCCCAATGGAAGCAGG - Intergenic
1202252895 Y:22891372-22891394 CTACAATTACCAAAGGAAGCAGG + Intergenic
1202255400 Y:22915347-22915369 CTACAATTACCAAAGGAAGCAGG - Intergenic
1202405884 Y:24525121-24525143 CTACAATTACCAAAGGAAGCAGG + Intergenic
1202408391 Y:24549096-24549118 CTACAATTACCAAAGGAAGCAGG - Intergenic
1202462391 Y:25120984-25121006 CTACAATTACCAAAGGAAGCAGG + Intergenic
1202464896 Y:25144961-25144983 CTACAATTACCAAAGGAAGCAGG - Intergenic