ID: 1113555692

View in Genome Browser
Species Human (GRCh38)
Location 13:111232215-111232237
Sequence CTGTCTCTCAATGGTTTTAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 156}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113555692_1113555699 6 Left 1113555692 13:111232215-111232237 CCCATAAAACCATTGAGAGACAG 0: 1
1: 0
2: 0
3: 11
4: 156
Right 1113555699 13:111232244-111232266 CCACCCCATAGAACCAGTGATGG 0: 1
1: 0
2: 0
3: 5
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113555692 Original CRISPR CTGTCTCTCAATGGTTTTAT GGG (reversed) Intronic
902171434 1:14614730-14614752 CTGTCTCTCAATGTTTCTCTGGG - Intronic
909657610 1:78048141-78048163 TTGACTCACAATGGATTTATTGG + Intronic
909803195 1:79840609-79840631 CTCTCTCTCAAAAGTTTTAAAGG - Intergenic
915023342 1:152802923-152802945 CTGTCTATCAATAATTTTAAAGG + Intronic
915655752 1:157358993-157359015 CTGTTTCCCAAGGGCTTTATTGG - Intergenic
915821407 1:159028184-159028206 TTGTATCTCAGAGGTTTTATAGG + Intronic
916806904 1:168268463-168268485 CTGTCTATCACTGATTTGATGGG - Intergenic
916812876 1:168321009-168321031 CTGTCTCTCACTTTTTTTTTTGG + Intergenic
916874750 1:168957512-168957534 CTGTCACTTAAGAGTTTTATGGG + Intergenic
917254905 1:173103851-173103873 CTGTGTCTCAGAGTTTTTATAGG + Intergenic
919216351 1:194561138-194561160 CTGTCTTTCAAGGGTAATATAGG - Intergenic
919393743 1:197019628-197019650 TTTTCTCTCAATTATTTTATTGG + Intergenic
919508155 1:198426376-198426398 ATTTCTTTCAAAGGTTTTATAGG + Intergenic
921206269 1:212852037-212852059 CTGTCTTTGAATGATTTTTTTGG + Intergenic
921901393 1:220455317-220455339 CAGTGTCTAAATGGTTTTTTTGG + Intergenic
923177479 1:231480956-231480978 CGGTCTCTCAAAGGGATTATAGG + Intergenic
1068443235 10:57087145-57087167 CTGTCTTTGAATGATTTTTTTGG - Intergenic
1068968864 10:62941723-62941745 CTCTGTCTTAATGGTTTTATTGG + Intergenic
1075773239 10:124959080-124959102 ATGTCTCTCAAAGAGTTTATAGG + Intronic
1081216556 11:40405946-40405968 CTTTCTCTGTATGGTTTCATAGG + Intronic
1081272206 11:41098299-41098321 CTGTTTCTCAATTCTTTCATTGG + Intronic
1082139259 11:48588397-48588419 CTTTCTCTCCATGGATTTCTTGG + Intergenic
1084796526 11:71509658-71509680 CTGTCTATCAATGGATGAATGGG + Intronic
1086313082 11:85558115-85558137 CTGTTTCTTAATGGGATTATTGG - Intronic
1087126607 11:94633406-94633428 CTGTATCTCCATTGCTTTATTGG - Intergenic
1092728506 12:11507436-11507458 CTGTGGCTCCATGGTTTCATCGG - Intergenic
1092857961 12:12692845-12692867 CTGTCTTTAAAGGTTTTTATGGG - Intronic
1093190200 12:16065526-16065548 CTGTGTCTCCATGGTTTTGCAGG + Intergenic
1093297960 12:17415467-17415489 CTTTCTCTGACTGCTTTTATAGG + Intergenic
1097423027 12:59404552-59404574 GTGTTTCTCAATGATTTTTTGGG - Intergenic
1097852119 12:64422407-64422429 ATATCTCTTAATGGTTTTGTAGG + Intronic
1097937253 12:65266665-65266687 CTGTCTCTCAATGGAAGGATTGG - Intergenic
1099942569 12:89206250-89206272 CTGTCTCCCAATGGACTTCTGGG + Intergenic
1101776289 12:107797273-107797295 CTCTCTCTCATTGTTTTTGTGGG - Intergenic
1104349746 12:128034743-128034765 CTGGCTTTGAATTGTTTTATTGG - Intergenic
1106367687 13:29098552-29098574 CAGTCTCTAAATTGTTTTCTAGG - Intronic
1109237071 13:59835886-59835908 CTTTCTCTCAATGAATTTACTGG + Intronic
1110870292 13:80444440-80444462 CTGTCACTCCACTGTTTTATGGG - Intergenic
1111584460 13:90266814-90266836 TTGTTTTTCAATAGTTTTATGGG - Intergenic
1112044741 13:95584958-95584980 GTGTCCCTCAATCATTTTATTGG + Intronic
1112584667 13:100707750-100707772 CTGTCTCGCAGTGGGGTTATTGG + Intergenic
1113095214 13:106656172-106656194 CTGTCTCTAAATGGTAGCATTGG + Intergenic
1113198699 13:107839736-107839758 TTGTCTCCCAAATGTTTTATGGG - Intronic
1113555692 13:111232215-111232237 CTGTCTCTCAATGGTTTTATGGG - Intronic
1113555709 13:111232343-111232365 CTGTCTCTCCATAGTTCTATGGG - Intronic
1113555726 13:111232432-111232454 CTGTCTACCAATGGTTCTACGGG - Intronic
1114166962 14:20229479-20229501 CTTTTTCTCAATGATTTTGTTGG + Intergenic
1115316294 14:32028439-32028461 CTGTCTCGCAATGTTGTCATGGG - Intergenic
1116900054 14:50353174-50353196 CTGTCTCTCCAAGTTTTTAGGGG + Intronic
1117244410 14:53869963-53869985 CTGGATCACAATGGTTTCATGGG + Intergenic
1117916955 14:60687838-60687860 CTGTCTCTCCATTGTTTGAGTGG - Intergenic
1120663286 14:87276098-87276120 CTGTCTCTCACTGGTCAGATTGG - Intergenic
1123800688 15:23816964-23816986 CTGTCCCTCAATGGCTTTGATGG - Intergenic
1124589661 15:31041772-31041794 CTGTCTCTCAGAGGTGTTTTTGG - Intronic
1124593023 15:31070022-31070044 CTTTCTCACCATGGCTTTATTGG + Exonic
1125307780 15:38340831-38340853 CTTTCTTACAATGTTTTTATTGG + Intronic
1128881195 15:71244876-71244898 CTTTCTCTCTATGGTTTGCTTGG - Intronic
1130174897 15:81558349-81558371 CTGTTTCTCAGAGGTTTTGTAGG + Intergenic
1130519599 15:84652172-84652194 TCTTCTCTCAATGATTTTATTGG + Intronic
1130749525 15:86695764-86695786 CTGTATCTCAGAGGTTTTAATGG + Intronic
1131221981 15:90592164-90592186 CTGTGACGCAATGTTTTTATAGG - Intronic
1131295300 15:91142954-91142976 CTTTCTTTCAACGGTTTTTTAGG + Intronic
1131548054 15:93332603-93332625 TTTTCTCTCACTGGTTTTAAGGG - Intergenic
1133690808 16:8213234-8213256 CCGGCTCTCAGGGGTTTTATAGG - Intergenic
1136588587 16:31203037-31203059 CTGGCTCTCACTGGGTTTATTGG + Exonic
1138205930 16:55125081-55125103 CTGTTTCTCATTGGTTCAATGGG + Intergenic
1139459551 16:67110664-67110686 CTGTCTCCCACTGCTTTTCTGGG + Intronic
1140040544 16:71404690-71404712 CTGTCTCTCATTGGTTGTGTTGG - Intergenic
1140483519 16:75276325-75276347 ATGTCTCTGAATTGTATTATAGG - Intergenic
1141521857 16:84585685-84585707 CAGTCTCTGCATGGTTTTAGCGG + Intronic
1141591262 16:85070376-85070398 CTGTCTCAAAATGCATTTATGGG + Intronic
1143309297 17:5975329-5975351 CTGTCTCTCCATGCTTCTCTTGG - Intronic
1153261808 18:3231436-3231458 TTTTCTCTCAAGGGTTTCATGGG - Intergenic
1155460553 18:26077124-26077146 CTATCACTTAATGGTTTTAATGG - Intronic
1155613817 18:27699133-27699155 CTCTATCTCTATGATTTTATGGG + Intergenic
1155793463 18:30003826-30003848 CTTTCTTTCAATGGTTTTGGTGG - Intergenic
1156824703 18:41416953-41416975 CTGTGTCTAAATGATTTTGTTGG + Intergenic
1157046042 18:44103041-44103063 TTGTTTCCTAATGGTTTTATGGG + Intergenic
1160306019 18:77737730-77737752 CGGTCTCTCTCTGTTTTTATTGG + Intergenic
926160516 2:10485697-10485719 AGGTCTCAAAATGGTTTTATAGG + Intergenic
927067131 2:19484351-19484373 TTGTCTCTAATTTGTTTTATTGG + Intergenic
929613794 2:43292355-43292377 CAGTCTCCCAAAGGTATTATGGG - Intronic
929728837 2:44463793-44463815 CAGCCTCTCAATCCTTTTATGGG - Intronic
934591745 2:95558632-95558654 CTGTATCTCAGTGGGTTTAGTGG - Intergenic
934621438 2:95811260-95811282 CTGTAGCTCAATGGTTTTGGTGG - Intergenic
938877540 2:135548506-135548528 CTATATCTCAATGGATGTATGGG - Intronic
938946826 2:136220046-136220068 CAGTCTCTTAATGGTTCTTTGGG + Intergenic
1173944230 20:46937591-46937613 CTGTTTCTCCTTGGTTTTCTGGG + Intronic
1174427501 20:50442812-50442834 CTCTGTCTTCATGGTTTTATGGG + Intergenic
1180171851 21:46063663-46063685 TTGTTTTTCAATGGGTTTATTGG - Intergenic
1181594124 22:23903332-23903354 CTGTCTCTCTTTGGATTAATAGG - Intergenic
949373135 3:3356830-3356852 CAGTCTTTCTATGGTTATATTGG + Intergenic
950797801 3:15524541-15524563 CTGACTTTGAATGGCTTTATTGG - Intergenic
950966124 3:17147207-17147229 CCGACTCTCAGTGGTGTTATAGG + Intergenic
953402485 3:42637520-42637542 CTGTCACTCAGTGGTATTACAGG - Exonic
956369766 3:68546229-68546251 CTGTCTCTGGATGCTTTTATAGG - Intergenic
957881131 3:86214159-86214181 CTGCCTCTAAATGCTTTTGTCGG - Intergenic
959784608 3:110279959-110279981 CTGTCTTTCAGTGATCTTATTGG + Intergenic
961969823 3:130950113-130950135 CTTTCTCTCTAGTGTTTTATGGG + Intronic
963987831 3:151617460-151617482 CTGTCTCACAATTGTATTTTTGG + Intergenic
965548438 3:169938882-169938904 CTGCCTCTCTGTGGTTTCATTGG - Exonic
965869053 3:173244679-173244701 CTGTATTTCAATGGTTTTGGGGG + Intergenic
967602677 3:191408024-191408046 CTTTATCTCATTGGTTTTAGAGG + Intergenic
968408386 4:363174-363196 CTGTCTGTTACTGGTGTTATAGG + Intronic
968478238 4:822650-822672 CTGTTTCTCAATAGTTCTCTTGG + Intronic
971618293 4:28822803-28822825 CTGTCCTTGAATGGCTTTATGGG - Intergenic
972039631 4:34576485-34576507 TTTTCTCACAATTGTTTTATGGG + Intergenic
972085705 4:35211614-35211636 CTGTGACTCAATTGTCTTATTGG + Intergenic
972556308 4:40184575-40184597 CTGTCTCTGAATGGTAAAATTGG - Intergenic
972818451 4:42671238-42671260 CTTTCTCTCTATTGTTTTTTCGG + Intergenic
977237781 4:94529120-94529142 CTTTCTCGCAATGTTTTCATAGG - Intronic
978172610 4:105691924-105691946 CAGTCTGTCAATGTTTTTGTTGG - Intronic
978713458 4:111813417-111813439 CTGGCACTCATTTGTTTTATTGG + Intergenic
979633783 4:122933917-122933939 CTGTCTCCAGATGGTGTTATAGG + Intronic
980830283 4:138123182-138123204 CTGTCTCTCTTTCTTTTTATTGG + Intergenic
983615366 4:169698432-169698454 CTCTCTCTCTGTGGTTTTCTAGG + Intronic
983645159 4:169982078-169982100 CTGCTTCTCAAGGGTTTTCTAGG + Intergenic
988408982 5:30861501-30861523 CTGTCTCTTAATGCTTTGTTTGG - Intergenic
988902765 5:35751831-35751853 CTGTGTTTCAATGGTCTTGTCGG + Intronic
989561933 5:42862309-42862331 CTGTATCCCAGAGGTTTTATAGG + Intronic
990949376 5:61281536-61281558 CAGTCTCCCAATGGATTTGTTGG + Intergenic
992331292 5:75719467-75719489 CTTTCTCTCTATAGTTTTACAGG - Intergenic
995120134 5:108527377-108527399 ATGTCTCTCCATGTGTTTATTGG + Intergenic
997798067 5:136831270-136831292 CTGTATCTCAGAGGTTTGATAGG + Intergenic
1002147944 5:177200739-177200761 CTCTCTCTCAATTTTTTTAAAGG + Intronic
1003476761 6:6490845-6490867 TTGTACCTCCATGGTTTTATAGG - Intergenic
1009902198 6:69821164-69821186 CAGTATCTCACTGGCTTTATGGG + Intergenic
1010146064 6:72670923-72670945 CTATCTCTAAATAGTTATATTGG + Intronic
1010839603 6:80633310-80633332 TAGTCTTTAAATGGTTTTATTGG + Intergenic
1013631715 6:111992220-111992242 CTGTCTTTGAATGATTTTTTTGG + Intergenic
1014796796 6:125734409-125734431 CTGTTTCTCTGTGGTTTTCTAGG + Intergenic
1018399041 6:163404243-163404265 CTTTCTCTCAGTGGTTTTCAAGG - Intergenic
1023648890 7:42348008-42348030 CAGTCTCTCAATTGGTTTGTGGG - Intergenic
1024779083 7:52825255-52825277 ATGTCTCTGAATGGTTATATTGG - Intergenic
1028007413 7:85592465-85592487 CTGTTTTTCAATGTTTTTCTTGG + Intergenic
1028859343 7:95630827-95630849 CTCTCTCTCATTGGTGATATTGG - Intergenic
1029675268 7:102064343-102064365 CCGGCTCTAAATGGTTTTAAGGG + Intronic
1030585573 7:111414353-111414375 ATGTCTTTCCATGGCTTTATAGG - Intronic
1030850221 7:114474890-114474912 CTGTTTTTGAATTGTTTTATGGG + Intronic
1033581500 7:142741186-142741208 CTGTATCTGATTGTTTTTATTGG - Intergenic
1033879687 7:145865184-145865206 CTGTATCTGAATGTATTTATTGG + Intergenic
1036019387 8:4826727-4826749 CTGTCTCTCCATTGGGTTATGGG - Intronic
1041741756 8:61164256-61164278 CTGTCTCTCATTGCTATTATAGG + Intronic
1042454232 8:68981820-68981842 CTGTCTCTGGATTGTTTTTTTGG - Intergenic
1044276220 8:90302339-90302361 CTGGCTCTCAAAGGCTTTATAGG + Intergenic
1044427701 8:92071934-92071956 CTTTCTCTGGATGTTTTTATAGG - Intronic
1044670353 8:94674103-94674125 CTGTTTCTTAAAGGTTTTGTTGG + Intronic
1045598613 8:103687057-103687079 CTGGTTCCCAATGGTTTCATTGG - Intronic
1048310447 8:133318533-133318555 GTGTCTCTCAATGATTTTTTGGG + Intergenic
1050861915 9:10445625-10445647 CTCTATCTTAATGGTTTCATTGG - Intronic
1051659833 9:19415670-19415692 CTGTCCCGCAATGGCTTTCTTGG - Intronic
1051761836 9:20475684-20475706 CATTCTCACATTGGTTTTATGGG + Intronic
1052900208 9:33787119-33787141 CTGTATCTGATTGTTTTTATTGG - Intronic
1053333843 9:37244989-37245011 CTTTTTCTCACTGATTTTATGGG + Intronic
1057358664 9:94353536-94353558 GTGTCTCACTATGGTTTTTTTGG - Intergenic
1057400384 9:94718165-94718187 ATGTCTCTAAATGATTTTTTAGG - Intergenic
1057649087 9:96904074-96904096 GTGTCTCACTATGGTTTTTTTGG + Intronic
1059338902 9:113586328-113586350 CTGTATATAAATAGTTTTATTGG - Intronic
1061968515 9:134030093-134030115 CTGCCTTTAAATGGTTTTTTGGG + Intergenic
1185547849 X:959964-959986 ATGTTCCACAATGGTTTTATTGG - Intergenic
1194217970 X:91154685-91154707 CTGTCTCTCCATGTTTGTCTGGG - Intergenic
1194553689 X:95332229-95332251 CTGTCTCTCAATGTTTGTAGAGG - Intergenic
1199411034 X:147523366-147523388 CATTATCTCAATGGTTTTAATGG - Intergenic
1199475859 X:148244465-148244487 CTGTCTCTCAAAGGAGTTCTGGG - Intergenic
1199640981 X:149860818-149860840 CTGTTTTTCATTTGTTTTATAGG - Intergenic
1200554475 Y:4618470-4618492 CTGTCTCTCCATGTTTGTCTGGG - Intergenic
1201674810 Y:16569061-16569083 CTGTCTCTCTCTGTTTTTGTAGG - Intergenic
1202595675 Y:26537079-26537101 CTGACACTCAATGTTATTATTGG - Intergenic