ID: 1113556078

View in Genome Browser
Species Human (GRCh38)
Location 13:111236160-111236182
Sequence TGCACCACAGGAGTCCCAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 268
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 238}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113556078 Original CRISPR TGCACCACAGGAGTCCCAGA AGG (reversed) Intronic
900116932 1:1033013-1033035 TACGCGTCAGGAGTCCCAGATGG + Intronic
900153733 1:1194900-1194922 TGCATAATGGGAGTCCCAGAAGG - Intronic
900431528 1:2605244-2605266 TGCAGCACCGGATTCCCAGGAGG - Intronic
901024279 1:6270852-6270874 TGCCCCAAAGGAGGGCCAGATGG + Intronic
901909504 1:12444488-12444510 TGCATAACTGGAGTCACAGAAGG - Intronic
902845077 1:19104023-19104045 TGCACCTCGGCAGCCCCAGAAGG + Intronic
903211491 1:21821782-21821804 AGCACCAGAGGAGGCCCAGGAGG - Intronic
903401153 1:23050472-23050494 TGGACCACAACAGACCCAGAAGG + Exonic
904014256 1:27407969-27407991 TGAACCTCAGGAGCCCCACAGGG + Exonic
905301923 1:36991466-36991488 AGCACCCCAGCTGTCCCAGAGGG + Intronic
909809627 1:79916663-79916685 TGCATAACAGGAGTCTCGGAAGG - Intergenic
910623520 1:89282545-89282567 TGCATTATAGGAGTTCCAGATGG + Intergenic
912420788 1:109540940-109540962 TGGACATCAAGAGTCCCAGACGG - Intronic
914952924 1:152133119-152133141 TCCATCATAGGATTCCCAGAAGG + Intergenic
915166679 1:153951879-153951901 TGCACCCCAGGATTCCCTCACGG - Intronic
915822143 1:159035506-159035528 TGGAGCACAGGAATCCCAGGAGG + Intronic
917178079 1:172261678-172261700 TGGACCACTTGGGTCCCAGATGG - Intronic
917229052 1:172816114-172816136 TGTACCATGGGAGTCCTAGAAGG + Intergenic
921194805 1:212745215-212745237 TGCATAACAAGAGTCTCAGAAGG + Intronic
921399476 1:214704853-214704875 AGAACCACAGAAGACCCAGATGG - Intergenic
924656976 1:245981352-245981374 TGCAGCCCAGGGCTCCCAGAGGG - Intronic
1063376653 10:5558217-5558239 AGCACCACAGCATTCCCTGATGG - Intergenic
1064568109 10:16663999-16664021 TACACTCCAGGAGTCACAGAAGG + Intronic
1065548576 10:26847195-26847217 GGAACCACAGGAGTTCCAAAAGG - Intronic
1065604252 10:27400187-27400209 TATACAACAGTAGTCCCAGAAGG - Intronic
1065711665 10:28523898-28523920 TGCATGAGGGGAGTCCCAGAAGG - Intergenic
1067337834 10:45379024-45379046 TGCACCACAGGTGTGCTGGAGGG + Intronic
1068670682 10:59719680-59719702 AGCACCACAGGAGTTCCATTAGG - Intronic
1069262497 10:66415410-66415432 TGCACCACAAGGGACCTAGAGGG + Intronic
1069601097 10:69708688-69708710 TCAACCTCTGGAGTCCCAGAGGG - Intergenic
1070042430 10:72794723-72794745 TGTTCCACAGTAGTCTCAGAGGG - Intronic
1070214591 10:74363681-74363703 TGCAACACAGGAGATCCTGAGGG - Intronic
1070241955 10:74690812-74690834 TGCACCAAAGGAGTCAAAGATGG - Intronic
1070346576 10:75548557-75548579 TTCAGCACAGGAGCCCCAGATGG + Intronic
1070499448 10:77056952-77056974 TGCATCATAGGAATCCTAGAAGG + Intronic
1071266260 10:83967465-83967487 TGCAACACAGGGGGCCCAGGTGG - Intergenic
1072501500 10:96022844-96022866 TGCACAGCAGGAGGCCCTGAGGG + Intronic
1073485878 10:103818901-103818923 TGCAGCACTGGAGACTCAGATGG + Intronic
1074419342 10:113295245-113295267 TTCACCACAGAATACCCAGATGG + Intergenic
1074435532 10:113431177-113431199 TGCTCAACAGGAGACTCAGAAGG - Intergenic
1075102329 10:119515303-119515325 TGCCCCACAGGAGTCCCCCCAGG - Intronic
1075467571 10:122663111-122663133 TGCAGCACAGGAGACCAAGATGG + Intergenic
1078449453 11:11429463-11429485 TGCACGGCGGGAGCCCCAGAGGG - Intronic
1080311638 11:30900365-30900387 TTCACCACAAGACACCCAGATGG + Intronic
1081879111 11:46432905-46432927 CGAACCACAGGATGCCCAGAAGG + Intronic
1083941151 11:65896641-65896663 AGCCCCACGGGAGGCCCAGAGGG - Intronic
1084099610 11:66937551-66937573 TGCATCATGAGAGTCCCAGAAGG - Intronic
1084747271 11:71181142-71181164 TGCAGCACAGAAGTGCAAGAAGG + Intronic
1084925988 11:72511805-72511827 TGTATAATAGGAGTCCCAGAAGG - Intergenic
1086058057 11:82671549-82671571 TGAAAAACAGGAGACCCAGAGGG + Intergenic
1087877697 11:103377224-103377246 TGCACTACATGAGTGCAAGAGGG - Intronic
1089855558 11:121541243-121541265 TGCACCACTGCAGTCCCACCTGG - Intronic
1089904774 11:122027302-122027324 TGCTCCACATGAGTTCCAGTGGG + Intergenic
1090150797 11:124381686-124381708 TGCACCTCAGGATTCCAATAAGG - Intergenic
1090863988 11:130679344-130679366 TGCACTGCGCGAGTCCCAGAAGG + Intronic
1092811834 12:12278148-12278170 TGCATAACAGGAATCCCAGAGGG + Intergenic
1093034110 12:14316880-14316902 TTCACCCCATGGGTCCCAGATGG - Intergenic
1093896406 12:24579582-24579604 TGCATCACTGGAATACCAGAAGG + Intergenic
1094485894 12:30926174-30926196 TGCTCCACAGGACTCTAAGAGGG + Intergenic
1096762130 12:53850650-53850672 TGCACCACAGGTGTCTGATATGG + Intergenic
1097228732 12:57495749-57495771 AGCACCTCAGGAGGCCCAGGCGG + Intronic
1100809551 12:98324981-98325003 TGGACCACTTGGGTCCCAGAGGG - Intergenic
1101476638 12:105055934-105055956 TGCATAAAAGGAATCCCAGAAGG + Intronic
1101660042 12:106757649-106757671 TGCACCAAAGTACTGCCAGAGGG - Intronic
1101784411 12:107870430-107870452 TGCACAACAGGAGTACTACAGGG + Intergenic
1101805768 12:108062326-108062348 TACAGCACTGGAGTCTCAGAAGG + Intergenic
1102087745 12:110157634-110157656 TGCACTGTGGGAGTCCCAGAAGG - Intronic
1102219960 12:111187661-111187683 GGCACCTCAGGAGACCCAGCCGG - Intronic
1102233236 12:111277867-111277889 TGCAGAACAGAAGTCCAAGATGG + Intronic
1102603657 12:114052489-114052511 TAGACCACAGCAGTCCCCGATGG + Intergenic
1105847811 13:24308307-24308329 TGCACCGCAGGCGGCCCCGACGG - Intronic
1106186269 13:27412584-27412606 TGCACCCCAGGGCACCCAGAAGG + Intergenic
1107390263 13:39956212-39956234 TCTATCACAGGAGACCCAGAGGG + Intergenic
1109809503 13:67493427-67493449 TGCACCTCTGTAGTCCCAGCTGG + Intergenic
1111765580 13:92523208-92523230 AGCAACACACGAGTTCCAGAAGG - Intronic
1113089496 13:106602405-106602427 TGCACCTCCGGAGCTCCAGATGG - Intergenic
1113556078 13:111236160-111236182 TGCACCACAGGAGTCCCAGAAGG - Intronic
1113913227 13:113854543-113854565 TGCACCACAGGACACCCTGCTGG - Intronic
1114741328 14:25100857-25100879 TTCACCAAAGGAGACACAGATGG + Intergenic
1115750633 14:36486328-36486350 ATCACCACAGGAGTCACACAAGG - Intronic
1117479920 14:56132460-56132482 CCCACGACAGGAGTCCCACAGGG - Intronic
1118520538 14:66578344-66578366 TGCATTATAGGAGTTCCAGAAGG + Intronic
1118601271 14:67472801-67472823 AGCACCACGGGGGCCCCAGAAGG + Exonic
1119471805 14:74905204-74905226 TGAAGCACAGAAGTTCCAGAAGG + Exonic
1121511135 14:94514361-94514383 TGCAGCACACGAGTCCCATCTGG - Intronic
1121682639 14:95806680-95806702 TGCATCATAGGAATCCCAGAAGG - Intergenic
1121839018 14:97117437-97117459 TGCACCAGAGGACACCAAGAAGG - Intergenic
1122827259 14:104376326-104376348 AGGACCAGAGGAGCCCCAGATGG - Intergenic
1124417808 15:29488446-29488468 TACATAACAGGAATCCCAGAAGG + Intronic
1127671278 15:61197456-61197478 TGCACCTCAGGTTTGCCAGATGG + Intronic
1129446951 15:75625457-75625479 TGCCCCACAGAAGTCCCTGAGGG + Exonic
1129717989 15:77862952-77862974 GGCCCAACAGGAGGCCCAGATGG + Intergenic
1131029732 15:89176400-89176422 TGCAAGAGATGAGTCCCAGATGG + Intronic
1131640648 15:94289046-94289068 TGTATCACTGGAGTGCCAGAAGG + Intronic
1132558558 16:583376-583398 TCCACCACAGCAGCCCCAGGTGG + Exonic
1133039921 16:3055197-3055219 AGCCCCACAAGATTCCCAGAGGG - Intronic
1133884840 16:9816930-9816952 TGGTTCACAGGAGTCCCACAAGG + Intronic
1135182860 16:20290623-20290645 TCCACCGTGGGAGTCCCAGAAGG - Intergenic
1136927399 16:34388112-34388134 TGCACCCCAGGGTACCCAGAGGG + Intergenic
1136977175 16:35023694-35023716 TGCACCCCAGGGTACCCAGAGGG - Exonic
1137404801 16:48180972-48180994 TGCACCACAGGAGACTCTAATGG - Intronic
1141252348 16:82369960-82369982 TGCCACCCAGGAGTCCCAGCTGG - Intergenic
1142380740 16:89730561-89730583 TGCACTCCTGGGGTCCCAGAGGG - Intronic
1142912578 17:3108036-3108058 TGTATCACTGGAGTCCCAGAAGG - Intergenic
1145158297 17:20557201-20557223 GGCACCTCAGGAGGCCCAGGCGG - Intergenic
1145236000 17:21208835-21208857 TGAGCCACAGGAGTCACAGGAGG + Intronic
1145270655 17:21402991-21403013 TGCATCACAGAAGTCCCAGGTGG - Intronic
1145308860 17:21690381-21690403 TGCATCACAGAAGTCCCAGGTGG - Intergenic
1146576746 17:34000690-34000712 TGCATTATAGGAGTCCCTGAAGG - Intronic
1147464249 17:40598543-40598565 TCCCCGACAGGATTCCCAGAGGG + Intergenic
1148093208 17:45034975-45034997 TCCACCAGAGGAGTGCCAGAAGG + Exonic
1148849456 17:50547746-50547768 GGCCCCACAGGAGTCCCAGCAGG + Exonic
1150450042 17:65258992-65259014 TGCACCACAGGACTCCAACCTGG + Intergenic
1151157281 17:72134193-72134215 AGCAGGACAGGAGTCCAAGAGGG - Intergenic
1151190722 17:72395875-72395897 TGCACCTCAGTAGCCCCACAGGG + Intergenic
1151527051 17:74677692-74677714 TCAGCCAAAGGAGTCCCAGACGG - Intronic
1151809027 17:76425116-76425138 AGCACTTCAGGAGGCCCAGACGG - Intronic
1152283251 17:79397711-79397733 TGCATCACAGGAGTCACGGCAGG + Intronic
1152352230 17:79790358-79790380 ACCAGCACAGGAGCCCCAGAGGG + Intergenic
1153501665 18:5755916-5755938 TGCACCCTAGAAGTCCCAAAGGG - Intergenic
1154132979 18:11751927-11751949 CGCGCCACCGGGGTCCCAGAGGG - Intronic
1155188751 18:23410985-23411007 ACCAGCACAGGAGGCCCAGATGG - Intronic
1156232990 18:35173148-35173170 TGCACCACTGTAGTCCCACCTGG - Intergenic
1157541783 18:48515845-48515867 TGCCCCAAAGGGGACCCAGAGGG + Intergenic
1159111903 18:64069495-64069517 TGAACCACTTGGGTCCCAGAAGG - Intergenic
1160001410 18:75027751-75027773 GGCAGCACAGGAGTACGAGAAGG + Intronic
1160524660 18:79527897-79527919 TGAACCCCAGGGGTGCCAGAAGG - Intronic
1160899749 19:1421745-1421767 GGCACGGCAGGAGTCCCAGCAGG - Intronic
1162119259 19:8452354-8452376 TCCACCAGAGGATTCACAGATGG - Intronic
1163447033 19:17352919-17352941 GGCACAGCAGGAGTCCCTGATGG - Intronic
1163541102 19:17911095-17911117 TGCATCAGAGGAATCCCAGCTGG - Intergenic
1163600035 19:18243550-18243572 AGCATCACATGAGTCCCAGATGG + Intronic
1164585940 19:29476143-29476165 TGCCCCAGGGGAGTCCCAGGAGG + Intergenic
1165260653 19:34614220-34614242 TGGAACTCAGAAGTCCCAGAAGG - Intronic
925119050 2:1403327-1403349 TGTCCCACTGGAGGCCCAGATGG + Intronic
925227390 2:2195931-2195953 TGCAAAACAGGAGTCCCATAAGG + Intronic
926688538 2:15717170-15717192 TGTACCACAGGAATGCAAGAGGG - Intronic
927516946 2:23677379-23677401 TGGACCACAGGAAAGCCAGAAGG + Intronic
927958396 2:27224222-27224244 TGCACCTCAGGAGGAGCAGAGGG - Intronic
928005868 2:27561081-27561103 TGCACTTCAGGAGACCAAGAAGG + Intronic
928014405 2:27641844-27641866 AGCACTACAGGAGGCCCAGCAGG - Intronic
928287846 2:30008933-30008955 TGCACCACAGGAGACCTGGGGGG - Intergenic
929020674 2:37549569-37549591 TTCACCACAGGGGACCCAGATGG - Intergenic
929875293 2:45791786-45791808 TGCTCCACTGGAGTTACAGATGG - Intronic
932865822 2:75340758-75340780 TGCCCCACAGGATTCCCCCAGGG + Intergenic
933095658 2:78175908-78175930 TGAACCAAAGGAATCCCAGCTGG + Intergenic
934648788 2:96075369-96075391 TGTATAACTGGAGTCCCAGAAGG - Intergenic
936869474 2:117117671-117117693 TTTACCACAGGCTTCCCAGATGG - Intergenic
938001714 2:127746117-127746139 AGAACCACAGGAGTGCCAGAAGG - Intronic
938739488 2:134217793-134217815 TCCACCAGATGAGTCCCTGAGGG + Intronic
939645166 2:144688683-144688705 TGTAACACATGAGTCCCTGAGGG + Intergenic
941583711 2:167331444-167331466 TGGACCACATGGGTCTCAGAGGG - Intergenic
942792849 2:179780341-179780363 TAAGGCACAGGAGTCCCAGAGGG + Intronic
944924068 2:204445314-204445336 TGCATAATAGGCGTCCCAGAAGG + Intergenic
945546181 2:211154891-211154913 TGCAACACAGGAGGCCGAGGTGG - Intergenic
946479536 2:220040805-220040827 AGCCCCACAGGAGACCCAGAAGG - Intergenic
948137285 2:235646027-235646049 AGCACTTTAGGAGTCCCAGATGG + Intronic
948483914 2:238267988-238268010 TGAACCACAGGAGTAACTGAGGG + Intronic
948642709 2:239385667-239385689 GCCACCCCAGGAGCCCCAGAAGG + Intronic
948873461 2:240815443-240815465 AGCCCCACGGGAGGCCCAGAGGG + Intronic
1168944405 20:1739668-1739690 GGGACCAAAGGAATCCCAGAGGG - Intergenic
1171091846 20:22292858-22292880 TGCTCCCCGGGAGTCCCAGGAGG + Intergenic
1171240245 20:23561886-23561908 TGCAATACAGGTGTCCCAGAAGG - Intergenic
1172112376 20:32554664-32554686 TGCCTCCCAGGAGGCCCAGAGGG + Intronic
1172272081 20:33660383-33660405 TGGCCCACAGGAGTACGAGAGGG - Exonic
1173430845 20:42985967-42985989 TGAACCACAGGAGCCTCAAAAGG + Intronic
1173856253 20:46252267-46252289 TACAGCACCTGAGTCCCAGAGGG + Intronic
1175666340 20:60863475-60863497 TGCACCAAAGATGTCCCAGGAGG + Intergenic
1176113798 20:63422450-63422472 CCCACCACAGGCGTCCCAGGAGG + Intronic
1179069207 21:38055748-38055770 TGCACCACCTGAGTTCAAGAGGG + Intronic
1180939509 22:19648337-19648359 TGCATAATAGGAGTGCCAGAAGG + Intergenic
1183068577 22:35380716-35380738 TGCACCCCAGGCGTCCCAGAAGG - Intronic
1183678335 22:39312267-39312289 TGCACCAGCCAAGTCCCAGAAGG + Intergenic
1184986956 22:48142294-48142316 TGTACCTCAGGAGTCACAGGTGG - Intergenic
949992100 3:9588066-9588088 TGCACTTCAGGAGTCCATGATGG - Intergenic
950337841 3:12213076-12213098 TGCATCTTAGGAGTCCCAGACGG - Intergenic
950697321 3:14713267-14713289 TGAATAATAGGAGTCCCAGAAGG - Intronic
950995891 3:17495167-17495189 TCCTCCACAGGAGCCACAGATGG + Intronic
952521788 3:34167835-34167857 TGCATAATAGGAGTTCCAGATGG - Intergenic
953049215 3:39325502-39325524 TTCATCACAGGAGTCCCAGGAGG - Intergenic
953190558 3:40683344-40683366 TGCACCACTGCAGTCCAACATGG - Intergenic
953789215 3:45934172-45934194 TGTATCACTGGAGTCCCAAATGG + Intronic
955406991 3:58631742-58631764 TACACTCCAGGATTCCCAGAGGG - Intergenic
958100587 3:89004112-89004134 TGCACAGCAGCAGTCCCAGAAGG + Intergenic
959619916 3:108388870-108388892 AGAACGGCAGGAGTCCCAGAAGG + Intronic
960948731 3:122984521-122984543 TGGAGCAGAGGAGCCCCAGAGGG - Intronic
964499345 3:157331193-157331215 TCCACCACATGAGTCCAGGAGGG + Intronic
965724831 3:171704185-171704207 ACCACCACCGAAGTCCCAGAAGG + Intronic
968588182 4:1443641-1443663 TGTGTCACTGGAGTCCCAGAAGG - Intergenic
968888605 4:3353175-3353197 TCCAGCAAAGTAGTCCCAGAGGG - Intronic
969348748 4:6585714-6585736 TGCCCCACCTGACTCCCAGATGG - Intronic
969350399 4:6594926-6594948 TGCACCACCTGATTCCCACAGGG + Intronic
977324685 4:95560370-95560392 TGCAGCAAAGGAGACCTAGAAGG + Intergenic
980430967 4:132694751-132694773 TGCACAATAGGAGTTTCAGAAGG + Intergenic
982668318 4:158292305-158292327 GGCACCACAGGGGACCAAGAAGG - Intergenic
982935927 4:161475361-161475383 TGCACTGCGGCAGTCCCAGAAGG - Intronic
985862668 5:2486716-2486738 AGCACTACAGGAGGCCAAGATGG + Intergenic
988703698 5:33701991-33702013 TGCACCACCAGAGTCCCTTAAGG - Intronic
992093975 5:73343212-73343234 TGCACCATGGGAGTGTCAGAGGG - Intergenic
997575723 5:134975567-134975589 TGCACCACTGCACTCCCAGCTGG + Intronic
997639956 5:135442620-135442642 TGCCCCTCAGGAGTCCCTGCAGG + Intergenic
998312167 5:141144444-141144466 TGTGTCACTGGAGTCCCAGAAGG + Intronic
998339995 5:141408968-141408990 TGCAACACAGGGGACCCAGGGGG - Exonic
1001339743 5:170832267-170832289 TGCACCACAGGATGCCCAGTTGG - Intergenic
1002371343 5:178757482-178757504 TGCACCACAGGATGCCCAGCTGG + Intergenic
1003181303 6:3794179-3794201 TGCACCAGGGGAGTTCCAGCAGG - Intergenic
1003215976 6:4112640-4112662 TGCATAATGGGAGTCCCAGAAGG - Intronic
1003329590 6:5118953-5118975 TGCAACAGAGGAGTGCCTGAAGG + Intronic
1003373585 6:5552381-5552403 TGCACAATAGGATTCCCAAATGG - Intronic
1003914236 6:10770894-10770916 TGAACCACAGCAGTGGCAGAGGG + Intronic
1004174194 6:13324784-13324806 TGCAAAAAATGAGTCCCAGAGGG + Intronic
1005798194 6:29390809-29390831 TGGACTACACGGGTCCCAGAGGG - Intronic
1006248750 6:32762514-32762536 TACACCTCCGGAGTCCTAGAAGG + Intronic
1006263527 6:32896154-32896176 TGCATCCCAGCAGTCCCAAAGGG + Intergenic
1006804155 6:36777601-36777623 CTCACCAAAGGACTCCCAGAAGG - Intronic
1007343085 6:41205433-41205455 TGCATCATCAGAGTCCCAGAAGG - Intergenic
1008807165 6:55443430-55443452 GCAACTACAGGAGTCCCAGAAGG + Intronic
1011171354 6:84507737-84507759 TGCATAATGGGAGTCCCAGAAGG - Intergenic
1014239473 6:118999116-118999138 TACAAGACAGGAGTCCAAGATGG + Intronic
1014822220 6:126003191-126003213 TGGACCACATGTGGCCCAGATGG + Intronic
1017058666 6:150460330-150460352 TGCAGGACTGGAGTCCCAGAGGG + Intergenic
1018937474 6:168283260-168283282 TGTCCTACAGGAGGCCCAGAGGG - Intergenic
1019295796 7:273557-273579 TGCATAATAGGAGACCCAGAAGG - Intergenic
1019364281 7:623863-623885 TGAACCTATGGAGTCCCAGAAGG + Intronic
1022243316 7:28533527-28533549 AGCACCACAGGATTTCCGGAAGG + Intronic
1023272870 7:38484148-38484170 TGCATTATGGGAGTCCCAGAAGG + Intronic
1023972489 7:45001266-45001288 AGCACCACAGGACTCCCTGAAGG - Intronic
1024110767 7:46144347-46144369 TGTACCATCAGAGTCCCAGAGGG + Intergenic
1024640589 7:51325520-51325542 GGAACCACAGGAGTCTCTGAAGG - Intergenic
1026061027 7:67026318-67026340 AGCACCACAGGAGGCCAAGGCGG - Intronic
1026717335 7:72801079-72801101 AGCACCACAGGAGGCCAAGGCGG + Intronic
1029221131 7:98991294-98991316 AGCACCGCAGGAGTCCGTGAAGG + Intronic
1030180506 7:106703637-106703659 TGCATAACAGGAATACCAGAAGG - Intergenic
1030183518 7:106736059-106736081 TGCATTACGGGAATCCCAGAAGG - Intergenic
1030672556 7:112353181-112353203 TGATTCACAAGAGTCCCAGAAGG + Intergenic
1032989574 7:137377894-137377916 TGCATCATGGGAGTCCCAGAAGG - Intergenic
1034329810 7:150272732-150272754 TGCACCACTGTAGTCCCACCTGG - Intronic
1035004879 7:155649106-155649128 TGCATTATGGGAGTCCCAGAAGG - Intronic
1035227761 7:157443019-157443041 TGCAGCACTGGAGTCTCACAGGG - Intergenic
1035563887 8:628578-628600 ATCACCCCAGGAGTTCCAGAAGG - Intronic
1037134698 8:15446476-15446498 GGCACCTCAGGAGGCCCAGGCGG + Intronic
1038067514 8:23978303-23978325 AGCACTTCAGGAGTCCCAGTGGG - Intergenic
1039108127 8:34011716-34011738 TACAATACAGAAGTCCCAGAGGG - Intergenic
1039296989 8:36167866-36167888 TGCACCACAGCACTCCAGGATGG - Intergenic
1039391022 8:37180831-37180853 GGCAGCCCAGGAGCCCCAGAGGG + Intergenic
1040351222 8:46571075-46571097 TGCACAACAGCAGACACAGAGGG + Intergenic
1041474253 8:58246473-58246495 TGTGCAACTGGAGTCCCAGAAGG + Intergenic
1042645640 8:70983297-70983319 TCTAGCAGAGGAGTCCCAGAAGG - Intergenic
1044079654 8:87867794-87867816 TGCAACACAGGAGCACCAGGTGG + Intergenic
1045235678 8:100351005-100351027 GGCACCTCAGGAGGCCCAGGCGG - Intronic
1046973862 8:120251517-120251539 TGCCACTAAGGAGTCCCAGATGG - Intronic
1047231476 8:123001430-123001452 TGTAACACAGAAGACCCAGAGGG + Intergenic
1048833229 8:138496396-138496418 TTCCCCCCAGGAGTCCCAGATGG - Intronic
1052517577 9:29503112-29503134 GGCACCACAGGAGTCATAGGAGG - Intergenic
1052731460 9:32291228-32291250 TGCCCCACAGCAGCCCCAGCAGG - Intergenic
1056504645 9:87246658-87246680 TGCAACACAGAAAACCCAGATGG + Intergenic
1057374041 9:94502276-94502298 AGCACCTCAGGAGGCCAAGATGG - Intergenic
1062063460 9:134512648-134512670 GGCAGCACAGGAATCCCACATGG + Intergenic
1062212570 9:135372776-135372798 CCCACCAGGGGAGTCCCAGAAGG + Intergenic
1203360625 Un_KI270442v1:217451-217473 GGCACAACAGGTGCCCCAGAGGG + Intergenic
1185836645 X:3350819-3350841 TGCAGCCCAGGAGACCCAGGAGG + Intergenic
1186077051 X:5891892-5891914 TGTCCCACAGAAGACCCAGACGG - Exonic
1186740412 X:12511678-12511700 TGCATGATGGGAGTCCCAGAAGG + Intronic
1192049132 X:67707809-67707831 TGCACTACAGGAGCTCCTGAAGG - Intronic
1197937513 X:131754419-131754441 TGCACCACAGAAGGCTCAGAAGG - Intergenic
1198222277 X:134613496-134613518 TTCACCAAAGGAGTCACAGAGGG - Intronic
1200150567 X:153949429-153949451 TGCACCACTGGAGGCCCTGCTGG + Intronic
1201239970 Y:11949232-11949254 TGCAGCCCAGGAGACCCAGGAGG - Intergenic