ID: 1113556943

View in Genome Browser
Species Human (GRCh38)
Location 13:111244319-111244341
Sequence AACACTCAGGTTGGTATAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 93
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 86}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113556940_1113556943 5 Left 1113556940 13:111244291-111244313 CCAAGTAAGTAAGATGCTAAAAA 0: 1
1: 0
2: 1
3: 13
4: 257
Right 1113556943 13:111244319-111244341 AACACTCAGGTTGGTATAATTGG 0: 1
1: 0
2: 0
3: 6
4: 86

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113556943 Original CRISPR AACACTCAGGTTGGTATAAT TGG Intronic
900354397 1:2253281-2253303 AGCACCCAGGTTGGTATCATGGG + Intronic
903630164 1:24762646-24762668 AACACTCAGCTTGATACAACTGG - Intronic
910971823 1:92863690-92863712 AAGACTTAAGTTGGTATAAAGGG + Intronic
911677199 1:100672528-100672550 AACACTAAAGTTCATATAATTGG - Intergenic
913159008 1:116128637-116128659 AGCACTCAGGTTGGTTTGGTGGG - Intronic
918797447 1:188919995-188920017 TACACTGAGGTTGCTAAAATAGG + Intergenic
924637434 1:245801746-245801768 AAAACTCAAGTTGGAAAAATGGG + Intronic
1068893367 10:62171809-62171831 AACACTCAGACTGGTAAAGTTGG + Intergenic
1069014138 10:63408918-63408940 TACATTCAGGTTTGTATATTAGG - Intronic
1070582275 10:77731168-77731190 AACACTCAGGTTTATAGAATTGG - Intergenic
1072356066 10:94612250-94612272 AACACTGAGTTTCTTATAATAGG - Intronic
1073915644 10:108400120-108400142 AATACTGAGGATGGTATCATGGG + Intergenic
1078024959 11:7686112-7686134 ACCTCTCAGGTGGGTATATTCGG - Intergenic
1084234840 11:67780625-67780647 AACATTCACTTTGGTGTAATGGG + Intergenic
1094460228 12:30689329-30689351 AACACTTAGGTTTTTAAAATAGG + Intronic
1098900733 12:76109530-76109552 AACACTTTGGTGGGTAGAATTGG + Intergenic
1100066072 12:90646696-90646718 AACACTCAGGTTTGTTACATAGG - Intergenic
1101016865 12:100510892-100510914 GAAACCCAGGTTGGAATAATAGG - Exonic
1103822577 12:123710885-123710907 AAAACTCAGTTTGGCAGAATGGG + Intergenic
1106695604 13:32169466-32169488 AAGCCTCAGATTGGTAAAATGGG - Intronic
1109788799 13:67220064-67220086 AACACCCAGACTGGTATAGTGGG + Intronic
1111924021 13:94443682-94443704 AACAGTCAGGTTGGTGTGATCGG - Intronic
1113206198 13:107919551-107919573 AATACTCAACTTGGTAAAATAGG - Intergenic
1113556943 13:111244319-111244341 AACACTCAGGTTGGTATAATTGG + Intronic
1115623767 14:35168683-35168705 AAGATTCAGGTTGGTATTTTTGG + Intronic
1115917837 14:38336896-38336918 AACACGGAGGAGGGTATAATGGG - Intergenic
1117344891 14:54822154-54822176 AACACTAAGGTTGATAGAAGAGG + Intergenic
1122596470 14:102896550-102896572 CACACACACGTTGGTATAAGTGG + Intronic
1133411108 16:5569683-5569705 ACCACTCAGCTTGGTAGAGTGGG + Intergenic
1137341543 16:47611958-47611980 ACCGCTCATGTTGGTACAATTGG + Intronic
1139108850 16:63863924-63863946 ACCACCCAAGTTAGTATAATTGG - Intergenic
1139803738 16:69545986-69546008 AACACTCAGTTTTTTATAAAAGG - Intergenic
1141893585 16:86944327-86944349 AACACTCAGTTGGTTATCATGGG - Intergenic
1146224004 17:31050355-31050377 GACGCTGAGGTTTGTATAATTGG + Intergenic
1151071798 17:71222465-71222487 AACATTCAGGGTGAAATAATAGG - Intergenic
1155216485 18:23647872-23647894 TACATTCAGATTGGGATAATTGG + Intronic
1158608654 18:58918907-58918929 AACACTCAGGTTTATAGAACTGG - Exonic
1165403712 19:35617711-35617733 AGCCAGCAGGTTGGTATAATTGG + Intronic
1167177401 19:47874694-47874716 AACACTCAGGAGGGAATAATTGG + Exonic
927583825 2:24280899-24280921 AAGACTCAGGGTGTAATAATGGG - Intronic
928893789 2:36237867-36237889 AAAATTCAGGTTGGAATAAATGG - Intergenic
931761395 2:65420294-65420316 AACACGGAGGTGGGTACAATGGG - Intronic
931911014 2:66899971-66899993 AACACTTAGCTTGGTCTGATGGG - Intergenic
941369099 2:164642430-164642452 AACACTCAGCAGGGTATAAGTGG + Intergenic
941818438 2:169821724-169821746 GAAACTCAGGTTTGTATAAAAGG + Intronic
944778378 2:202992965-202992987 AACACTGAGGTTTGTATTGTAGG - Intronic
946560445 2:220906436-220906458 AACAGTCAGGAGGGTATGATGGG + Intergenic
947459844 2:230294173-230294195 AACACTCAGGTAGAAATATTTGG + Intronic
1168730911 20:79962-79984 AACACACAAGTTGGAATATTGGG + Intergenic
1169256515 20:4104080-4104102 AACAATCAGGTTGACAAAATGGG - Intergenic
1170292980 20:14791426-14791448 AACACCCAGGATGGAATAGTGGG + Intronic
1172288752 20:33759691-33759713 AAACCTCAATTTGGTATAATTGG + Intronic
1178243684 21:30931665-30931687 AAAACTCATGTTGCTCTAATAGG + Intergenic
1178419490 21:32432227-32432249 AACATTCACTTTGGTGTAATGGG - Intronic
951179933 3:19647701-19647723 AAGAGTCAGGTTGGTCTCATGGG - Intergenic
955589217 3:60515997-60516019 AACACTCAAGTTGATATAGTGGG + Intronic
958209543 3:90453219-90453241 AACACTCTGTTTTGTAGAATCGG - Intergenic
960271664 3:115680908-115680930 AACACACAGCTTGGTAGAAGTGG - Intronic
960950960 3:122998147-122998169 AAAGATCAGGTTGGTATAAGAGG - Intronic
961884471 3:130087160-130087182 AACATTCACTTTGGTGTAATGGG + Intronic
966204005 3:177387470-177387492 AACACCAATGTGGGTATAATCGG + Intergenic
966686296 3:182699267-182699289 AACTCTGTGGTTGGTATAAGAGG + Intergenic
969820308 4:9715127-9715149 AACATTCACTTTGGTGTAATGGG - Intergenic
988224808 5:28399423-28399445 AACACTCAGCATTGTATAAGTGG - Intergenic
993543427 5:89181225-89181247 AACACTCAGGTTTGAATCCTGGG - Intergenic
998064750 5:139148887-139148909 GAGACTCAGGATGGAATAATTGG - Intronic
1004703616 6:18102314-18102336 CACACTCAGGTTGATTTGATGGG - Intergenic
1007022832 6:38539318-38539340 AAAACTGAAGTTGGTATTATTGG - Intronic
1010798350 6:80144795-80144817 ATCACTCAGACTGGTAAAATTGG - Intronic
1013435004 6:110094942-110094964 ACCACTCAGGCTGTTAGAATGGG - Intergenic
1014038389 6:116794829-116794851 TACTCTCAGGTTGGAATAAATGG + Intronic
1016105027 6:140150955-140150977 AATTCTCAGGATGGTATAAAAGG - Intergenic
1016363662 6:143293407-143293429 AATACGCAGATTGGAATAATGGG - Intronic
1017255584 6:152329716-152329738 ACCAGACAGGTGGGTATAATAGG - Exonic
1023598813 7:41861102-41861124 AGCATTCAGGTTGGAATATTTGG + Intergenic
1024436805 7:49365996-49366018 AACAGTCAGGTTGGACTAAGGGG - Intergenic
1028445481 7:90917375-90917397 CACTCTCGGGTTGATATAATAGG + Intronic
1028931075 7:96413869-96413891 AACGATGAGATTGGTATAATTGG + Intergenic
1036122079 8:6029631-6029653 AATACTCAGGTTGCCTTAATGGG + Intergenic
1039841956 8:41300258-41300280 AACACTAAGGTTAGTCAAATAGG - Intronic
1047570597 8:126094719-126094741 CACACTCAGGTTTGGCTAATGGG + Intergenic
1051455473 9:17251791-17251813 CACACTCAGGTTCCTATACTTGG - Intronic
1052587204 9:30443975-30443997 AACAATCAAGTTTGAATAATTGG + Intergenic
1054942618 9:70759915-70759937 AACATTCAGGTTTGTTAAATAGG - Intronic
1056025417 9:82489819-82489841 AAGACACAGGTTGGTAAAATTGG - Intergenic
1058609567 9:106760729-106760751 AACACTAAGGTTTGTAGAACAGG + Intergenic
1186533453 X:10321625-10321647 AACACTAAGTTTGGGGTAATTGG - Intergenic
1189604668 X:42663828-42663850 AACACCCAGGGAGGTATGATTGG + Intergenic
1191706483 X:64099533-64099555 AACACTGAGCTTGGTATTAATGG + Intergenic
1194105703 X:89763952-89763974 AACATTCAGGTTGTTCTATTTGG + Intergenic
1196140614 X:112258895-112258917 ATAACTGATGTTGGTATAATTGG - Intergenic
1197047567 X:122017134-122017156 AAAAATCAGGTTGGTATATCTGG + Intergenic
1200457666 Y:3411781-3411803 AACATTCAGGTTGTTCTATTTGG + Intergenic