ID: 1113562128

View in Genome Browser
Species Human (GRCh38)
Location 13:111289971-111289993
Sequence CTGGGTAACCCATCAGAAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 140}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113562128 Original CRISPR CTGGGTAACCCATCAGAAGG TGG Intronic
900156957 1:1206990-1207012 CTGGGGAACCCCACAGAATGGGG + Intergenic
901390190 1:8940484-8940506 CTGGGGAACTCATCACCAGGAGG + Intergenic
906707891 1:47908281-47908303 GTGGGTATCCCACCAGATGGTGG + Intronic
907118217 1:51988314-51988336 CTGGGAAAACAATGAGAAGGTGG - Intronic
922611751 1:226935492-226935514 CAGGGCAACCCATAAGAAAGAGG + Intronic
924206382 1:241715435-241715457 TTGGATCACACATCAGAAGGAGG + Intronic
1066421349 10:35267496-35267518 CTGTGTATCCCAGCAGAACGGGG - Intronic
1071505404 10:86228755-86228777 CTGGGTCACCCCTCAGGAAGTGG + Intronic
1072771156 10:98139491-98139513 GTGGGTAGCACAACAGAAGGAGG - Intronic
1073805310 10:107091269-107091291 CTGGGGAACCCATAAGCAGGTGG - Intronic
1074082603 10:110179583-110179605 ACGGGAAACCCTTCAGAAGGTGG + Intergenic
1074420734 10:113306783-113306805 ATGGGTAAGGCATCAGTAGGTGG - Intergenic
1080698156 11:34620981-34621003 CTGGGTAGCCAATCAGAAGAGGG + Intergenic
1081771489 11:45652855-45652877 CTGGGGAACCTACCAGATGGGGG - Intronic
1081782729 11:45724342-45724364 CAGGGTAACCCATCTGTAGTAGG - Intergenic
1087564179 11:99833193-99833215 CTGGGTAGCCTATCAGTAAGTGG + Intronic
1087716296 11:101612619-101612641 CAGGGTCACCCATCGGAAGTTGG - Intronic
1091090224 11:132764073-132764095 CTGGGTAGCTGATCAGCAGGAGG + Intronic
1092734266 12:11565319-11565341 CTGGGCCACACAGCAGAAGGTGG + Intergenic
1093711166 12:22331831-22331853 CTGGGCAACCCATGAGAATTTGG - Intronic
1102997962 12:117364285-117364307 CTGGGGAAACCACCAGAGGGAGG - Intronic
1113562128 13:111289971-111289993 CTGGGTAACCCATCAGAAGGTGG + Intronic
1121573534 14:94965300-94965322 CTGGGTGACAGAACAGAAGGAGG - Intergenic
1121970172 14:98348801-98348823 CTGGGTAACCTTGCAGAAAGTGG + Intergenic
1130533184 15:84763373-84763395 CTGGATAACCCAACAGAAACTGG + Intronic
1130894573 15:88160170-88160192 CTGGGGAACCCAGAGGAAGGAGG + Intronic
1131962347 15:97802972-97802994 GTGGGTTCCCCAGCAGAAGGCGG - Intergenic
1138874196 16:60928960-60928982 CTGGGAGACCCATCAGAGGCAGG + Intergenic
1139940450 16:70601723-70601745 CTGGGAAACCCAGCAGGAGCTGG - Intronic
1142193032 16:88726587-88726609 CTGGATGACCCAGCAGAAGCCGG + Exonic
1143736438 17:8914865-8914887 GAGGGAAACCTATCAGAAGGAGG + Intronic
1144434723 17:15230424-15230446 CTGGGTCACCCACCAGAAAAGGG + Exonic
1146000231 17:29126375-29126397 CTGGAGAACCCATAAGCAGGTGG - Intronic
1146178961 17:30685157-30685179 CAGGGTGACCCTTCTGAAGGGGG + Intergenic
1147620109 17:41860713-41860735 CTGGGTCATCAATGAGAAGGTGG - Intronic
1151334549 17:73432201-73432223 CTGGGTCCCCCTGCAGAAGGAGG - Intronic
1157552515 18:48591295-48591317 GTGGGTACCACATCAGAGGGTGG - Intronic
1158390155 18:57038590-57038612 CAAGTTAAACCATCAGAAGGAGG - Intergenic
1158626633 18:59077373-59077395 CTGGTTAACCCATCAGGACATGG - Intergenic
1159522717 18:69546898-69546920 CTGGGTAATTCATAAGAAGGAGG + Intronic
1160159381 18:76459748-76459770 GTGGGTATCCCATCACAACGCGG + Intronic
1160384149 18:78484920-78484942 CTTGGACACCCATCAGGAGGAGG - Intergenic
1160384165 18:78485004-78485026 CTTGGCCACCCATCAGGAGGAGG - Intergenic
1160384175 18:78485047-78485069 CTTGGCCACCCATCAGGAGGAGG - Intergenic
1160384184 18:78485088-78485110 CTTGGCCACCCATCAGGAGGAGG - Intergenic
1160384203 18:78485172-78485194 CTTGGCCACCCATCAGGAGGAGG - Intergenic
1160384211 18:78485213-78485235 CTTGGACACCCATCAGTAGGAGG - Intergenic
1160384232 18:78485340-78485362 CTTGGCCACCCATCAGGAGGAGG - Intergenic
1160384242 18:78485383-78485405 CTTGGCCACCCATCAGGAGGAGG - Intergenic
1160384251 18:78485424-78485446 CTTGGCCACCCATCAGGAGGAGG - Intergenic
1160384260 18:78485465-78485487 CTTGGCCACCCATCAGGAGGAGG - Intergenic
1160384277 18:78485549-78485571 CTTGGCCACCCATCAGGAGGAGG - Intergenic
1160384286 18:78485590-78485612 CTTGGCCACCCATCAGGAGGAGG - Intergenic
1160384295 18:78485631-78485653 CTTGGCCACCCATCAGGAGGAGG - Intergenic
1160384304 18:78485674-78485696 CTTGGCCACCCATCAGGAGGAGG - Intergenic
1160384312 18:78485715-78485737 CTTGGCCACCCATCAGGAGGAGG - Intergenic
1160384328 18:78485799-78485821 CTTGGCCACCCATCAGGAGGAGG - Intergenic
1160384347 18:78485883-78485905 CTTGGCCACCCATCAGGAGGAGG - Intergenic
1160384356 18:78485926-78485948 CTTGGCCACCCATCAGGAGGAGG - Intergenic
1160384364 18:78485967-78485989 CTTGGCCACCCATCAGGAGGAGG - Intergenic
1160384380 18:78486051-78486073 CTTGGCCACCCATCAGGAGGAGG - Intergenic
1160384390 18:78486094-78486116 CTTGGCCACCCATCAGGAGGAGG - Intergenic
1160384399 18:78486135-78486157 CTTGGCCACCCATCAGGAGGAGG - Intergenic
1160384409 18:78486178-78486200 CTTGGCCACCCATCAGGAGGAGG - Intergenic
1160384418 18:78486221-78486243 CTTGGCCACCCATCAGGAGGAGG - Intergenic
1160384426 18:78486262-78486284 CTTGGCCACCCATCAGGAGGAGG - Intergenic
1160384442 18:78486346-78486368 CTTGGCCACCCATCAGGAGGAGG - Intergenic
1160384452 18:78486389-78486411 CTTGGCCACCCATCAGGAGGAGG - Intergenic
1160384461 18:78486430-78486452 CTTGGCCACCCATCAGGAGGAGG - Intergenic
1160384471 18:78486473-78486495 CTTGGCCACCCATCAGGAGGAGG - Intergenic
1160384491 18:78486562-78486584 CTTGGCCACCCATCAGGAGGAGG - Intergenic
1160384500 18:78486605-78486627 CTTGGCCACCCATCAGGAGGAGG - Intergenic
1162963932 19:14146730-14146752 CTGGGTTCCCCATCATTAGGAGG + Intergenic
1162979652 19:14230397-14230419 CAGGGTGACCCTTCTGAAGGGGG - Intergenic
1163637574 19:18444530-18444552 CTGGGGAGCCCATCATAAGCAGG + Exonic
1163737998 19:18993459-18993481 CTTGGTTCCCCTTCAGAAGGTGG - Exonic
1164055449 19:21618246-21618268 CTGGTTAGCCAATCAGATGGTGG + Intergenic
1164589610 19:29499481-29499503 CTGGTATACCCATCAGAAGCCGG + Intergenic
1167063502 19:47166691-47166713 CTGGGAATGCCATCAGAATGAGG - Intronic
925154376 2:1638632-1638654 CTGGGTTTCCCAGCAGATGGGGG - Intronic
926652986 2:15366789-15366811 CTGGGTAAGGCATCAGATGAAGG + Intronic
932870186 2:75390677-75390699 CTGAGAAACCCACCAGGAGGTGG + Intergenic
937481422 2:122264092-122264114 CTGGGTAACCCACAAAAAGAGGG + Intergenic
938582761 2:132662180-132662202 CTGGGCCACCCTTCAGAAGCAGG + Intronic
940099925 2:150023335-150023357 CAGGGTAATGCCTCAGAAGGTGG - Intergenic
940867301 2:158830022-158830044 CAGGGAAACACAGCAGAAGGAGG + Intronic
943688190 2:190841467-190841489 CTGGGTGAGCCTTCAGAAAGAGG - Intergenic
947023627 2:225712011-225712033 CTGGTTATACCCTCAGAAGGTGG + Intergenic
1170308373 20:14965133-14965155 CTGGCTGACCAATCAGAAGTAGG - Intronic
1170959843 20:21015711-21015733 CTAGGAAACCAATCAGAAAGTGG - Intergenic
1173733891 20:45346400-45346422 CTGGGTGACCCATCAGCTGCAGG - Intronic
1174691998 20:52515827-52515849 CTGGGTGAGCCATCAGACTGTGG + Intergenic
1176249739 20:64114842-64114864 CAGGGCAGCCCATCAGCAGGAGG - Intergenic
1179781250 21:43702379-43702401 CTGGGAAGCCCGTCAGCAGGCGG + Intergenic
1180588338 22:16913992-16914014 CTGGGGAAGGCATCAGGAGGAGG - Intergenic
1181440139 22:22931480-22931502 CTGGGCAGCCCCTGAGAAGGGGG - Intergenic
1181910506 22:26234621-26234643 CTGGGCATCTCAGCAGAAGGTGG + Intronic
1185153592 22:49180125-49180147 CTGGGTGAGCCATCAGGAGCTGG + Intergenic
950629822 3:14274998-14275020 CTGGGTGACACCTCAGCAGGAGG + Intergenic
952694440 3:36249351-36249373 CAGGGGCACACATCAGAAGGAGG + Intergenic
955484769 3:59424336-59424358 CTGGAAATCCCATCAGAACGAGG - Intergenic
955905567 3:63804164-63804186 CTGGGCCACACAACAGAAGGTGG - Intergenic
956836355 3:73099392-73099414 CTTGGTTACCCATCAGAATTAGG - Intergenic
957119798 3:76075196-76075218 CTGGATGAGCCATCACAAGGTGG - Intronic
964553711 3:157912663-157912685 CAGGGTAATCTATCAGGAGGAGG - Intergenic
967182524 3:186918808-186918830 ATGTGAAACCAATCAGAAGGAGG - Intergenic
968461422 4:727119-727141 CTAGTTAGTCCATCAGAAGGCGG - Intronic
968978395 4:3833821-3833843 ATGAGTAACCAAGCAGAAGGTGG - Intergenic
973872691 4:55182123-55182145 CTGTGCAAGCCATCAGAAGAAGG + Intergenic
974665812 4:64959969-64959991 CTGGGAAACCAATCAAAAGGCGG + Intergenic
974968630 4:68797802-68797824 CTGAGTAACTCCTCAGCAGGAGG - Intergenic
986752459 5:10801044-10801066 ATGGGTGACCCAGCAGAAGTAGG + Intergenic
987488786 5:18551775-18551797 CTGGGGAGCCCACCAGTAGGGGG + Intergenic
989243285 5:39224370-39224392 CTGGGTGAGCAAGCAGAAGGTGG - Intronic
991342791 5:65629936-65629958 CTGGGTAAACAATCAGAAAAGGG + Exonic
993462737 5:88204465-88204487 CTGGGTAAACCATCGGATGTGGG + Intronic
997625829 5:135330012-135330034 CTGGGTCCCCCATCAGACGCTGG + Intronic
998065761 5:139157020-139157042 CAGGGTCACCCATCAGATAGTGG - Intronic
999186540 5:149714863-149714885 CAGGGTTACACTTCAGAAGGAGG - Intergenic
999221611 5:149984039-149984061 CTGGAAAATCCCTCAGAAGGAGG + Exonic
1000578725 5:163009418-163009440 CTGGGTGATCTATTAGAAGGAGG - Intergenic
1001970253 5:175949621-175949643 CAGGGAACCCCAGCAGAAGGAGG - Intronic
1002247185 5:177894143-177894165 CAGGGAACCCCAGCAGAAGGAGG + Intergenic
1003875516 6:10432878-10432900 CTTGGAAACCCATGAGAAGTTGG + Intergenic
1004977175 6:20981093-20981115 CTGGGTAACTGAGCAGGAGGAGG + Intronic
1005952616 6:30642860-30642882 CTGGGAAACTCACCAGAACGAGG + Exonic
1007105912 6:39282710-39282732 CTGGGCAAACCCTGAGAAGGAGG + Intergenic
1010919736 6:81666610-81666632 CTTGGTAACAGAGCAGAAGGGGG + Intronic
1012441133 6:99263466-99263488 CTGTGGAACCCATCAAAAAGGGG - Intergenic
1012862295 6:104574244-104574266 CTGAGAAAGCCATCAGAAGGGGG - Intergenic
1013686834 6:112594895-112594917 CTGAGAAACTAATCAGAAGGTGG - Intergenic
1014250403 6:119110135-119110157 CTGGGCTACCCATCTGTAGGTGG - Intronic
1019999682 7:4748571-4748593 CTGGGAATCCCCTCAGGAGGTGG + Intronic
1030313600 7:108092127-108092149 CTGGGTATCCCACCACAAGCTGG - Intronic
1032262159 7:130346651-130346673 CTGGGTGTCCCAGCAGGAGGTGG + Intronic
1036383358 8:8254671-8254693 CTGGGCAGCCCTTCAGAATGTGG + Intergenic
1042457011 8:69017095-69017117 CTGGTCAAGGCATCAGAAGGAGG + Intergenic
1044922559 8:97181291-97181313 CTGGGGAAACAAACAGAAGGAGG + Intergenic
1047024334 8:120810776-120810798 CTGGGCAGCCCAGCAGAAGAGGG - Intronic
1051865781 9:21680671-21680693 CTGGGTAACAAATCACAGGGGGG - Intergenic
1052347592 9:27425970-27425992 CTGATTCACCCAGCAGAAGGAGG + Intronic
1055269062 9:74535331-74535353 CTGAGTAACCTAGAAGAAGGTGG - Intronic
1059355405 9:113695740-113695762 CTGGGAACCCCTACAGAAGGAGG - Intergenic
1186856180 X:13628378-13628400 CAGTTTGACCCATCAGAAGGTGG + Intronic
1189715302 X:43858656-43858678 CTAGATCACCCATAAGAAGGAGG + Intronic
1190315474 X:49147813-49147835 GTGGGTTGGCCATCAGAAGGAGG - Intergenic