ID: 1113563617

View in Genome Browser
Species Human (GRCh38)
Location 13:111303784-111303806
Sequence TGCCGTATGGGCCTTCCTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 59
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 55}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113563617_1113563620 -3 Left 1113563617 13:111303784-111303806 CCTCAAGGAAGGCCCATACGGCA 0: 1
1: 0
2: 0
3: 3
4: 55
Right 1113563620 13:111303804-111303826 GCACTGCCGCATCCACCTAGAGG 0: 1
1: 0
2: 0
3: 5
4: 247

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113563617 Original CRISPR TGCCGTATGGGCCTTCCTTG AGG (reversed) Intronic
907380154 1:54080525-54080547 TGCCCTTTTGGCCCTCCTTGGGG + Intronic
908585824 1:65566788-65566810 TTCCCTATAGGTCTTCCTTGTGG + Intronic
909550514 1:76894517-76894539 TGCCAAATGGGCCTTCCCTGAGG + Intronic
912332795 1:108834842-108834864 AGCCTCATGGGCCTTCCTGGAGG + Intronic
915199877 1:154219820-154219842 TGCCCTAAGGACCTACCTTGGGG + Exonic
917683629 1:177393687-177393709 TGTCTTCTGGGCCTTCCTGGAGG + Intergenic
1069589208 10:69631284-69631306 TGCAGGATGGGCCTTCCACGGGG + Intronic
1073720411 10:106162981-106163003 TGACATCTGGGCCTTCCTAGAGG - Intergenic
1077459386 11:2700962-2700984 GGCCGTTTGGCCCTTCCATGTGG + Intronic
1083581432 11:63827720-63827742 TTCCGTCTGGGCCATCATTGGGG + Intergenic
1085052452 11:73386859-73386881 AGCCCTCTGGGCCTACCTTGGGG + Intronic
1085270114 11:75265235-75265257 TGCCTTATGTCCCTTCCTTGTGG - Exonic
1086457084 11:86969618-86969640 TGCTGTTTAAGCCTTCCTTGAGG + Intergenic
1089831923 11:121336515-121336537 TGCCATTTGGGCATTCTTTGTGG - Intergenic
1112467369 13:99655676-99655698 AGCTGTGTGGGCCTTGCTTGTGG + Intronic
1113563617 13:111303784-111303806 TGCCGTATGGGCCTTCCTTGAGG - Intronic
1121774645 14:96582716-96582738 TGCCCTTTGGGCGTTCCTGGGGG + Intergenic
1122283972 14:100639981-100640003 TGCCATATGGCCCAGCCTTGAGG - Intergenic
1123403462 15:20006864-20006886 TGCCGACTGTGCCATCCTTGGGG + Intergenic
1123512801 15:21013518-21013540 TGCCGACTGTGCCATCCTTGGGG + Intergenic
1124781615 15:32641732-32641754 TGCGGTATGGGCCTTGGTGGGGG - Exonic
1130626294 15:85518953-85518975 TGAAGTCTGGGCCTTCCTTTGGG - Intronic
1140196760 16:72861556-72861578 AGGCGTTTGGGGCTTCCTTGGGG - Intronic
1141615057 16:85205716-85205738 TGTCCCATGGGCCTGCCTTGTGG + Intergenic
1142358298 16:89614262-89614284 TGCCGGCTGTTCCTTCCTTGTGG + Intronic
1157892410 18:51430284-51430306 TGCCGTTTATCCCTTCCTTGTGG - Intergenic
1161243507 19:3236013-3236035 TGACATATGGGGGTTCCTTGAGG - Intronic
1162561955 19:11422242-11422264 TGACGTCTTGGGCTTCCTTGGGG + Intronic
926721638 2:15965626-15965648 TTCAGAGTGGGCCTTCCTTGGGG + Intergenic
927521002 2:23698120-23698142 GCCTGTATGGGCCTTCCCTGGGG + Intronic
931516434 2:63053002-63053024 TGCCGTATGGGGGTTGTTTGAGG - Exonic
933351867 2:81163250-81163272 TGCTGCATGGGACTTCCTTTAGG + Intergenic
1169083755 20:2814794-2814816 TGCCCTAGGGCCCTCCCTTGGGG - Intergenic
1172288991 20:33761769-33761791 TTCTTTCTGGGCCTTCCTTGTGG + Intronic
1173922451 20:46756760-46756782 TGCCCTATGGCCCTCCCCTGGGG - Intergenic
1175895906 20:62335501-62335523 TGGGGTATGGGATTTCCTTGGGG - Intronic
953648646 3:44779142-44779164 TGCCCAATGGGCCCTCCTTGAGG + Intronic
962927034 3:140004442-140004464 TGCTGTATGGGGTTTCCCTGTGG - Intronic
968425705 4:521931-521953 AGCCGTACGTACCTTCCTTGGGG - Exonic
969184176 4:5463290-5463312 TGCTGTCTGAGCCTTCCCTGAGG + Intronic
972043449 4:34633727-34633749 TGCAGAATAGGCCTTCCCTGAGG - Intergenic
977520664 4:98079302-98079324 TGCCCTTTGGGCCTACCTGGAGG - Intronic
985132897 4:186757030-186757052 GGCACTCTGGGCCTTCCTTGAGG + Intergenic
985576276 5:674889-674911 TGCAGTACAGGCCTTGCTTGTGG - Intronic
990483553 5:56235474-56235496 AACTGTATTGGCCTTCCTTGAGG + Intergenic
998098862 5:139415385-139415407 TGCACTTTGGGCCTTACTTGGGG - Intronic
1001807488 5:174600219-174600241 TGCCTTAGAGGGCTTCCTTGCGG - Intergenic
1002203556 5:177546890-177546912 TGCGGCTTGGGCCCTCCTTGTGG - Intronic
1006349936 6:33513534-33513556 TGCAGTATGTGCCTTGCTTCTGG - Intergenic
1013314426 6:108927431-108927453 TGCAGTGTGCTCCTTCCTTGTGG - Intronic
1023086982 7:36580766-36580788 AGCTGTCTGGGCCTTTCTTGGGG + Intronic
1023483766 7:40662522-40662544 TGCCACATTGGCCTTCCTTTTGG + Intronic
1034095112 7:148400458-148400480 TGCCGTACGGCTCTTCGTTGAGG - Intronic
1041207023 8:55510132-55510154 TGCAGTATTGACCTTCCCTGAGG - Intronic
1049356087 8:142189079-142189101 TCCCTTATGGGCCTTCATGGGGG - Intergenic
1051209095 9:14722614-14722636 TGCCGTGTGGTCTTTCCTAGAGG + Exonic
1059024486 9:110610940-110610962 TGCCATATGGGCCTTTCCTTAGG - Intergenic
1060887622 9:127166872-127166894 TGCTGGATGGGCCATCCATGTGG + Intronic
1061878562 9:133557078-133557100 TGCTGAGTGGGTCTTCCTTGGGG + Intronic