ID: 1113563664

View in Genome Browser
Species Human (GRCh38)
Location 13:111304225-111304247
Sequence TCTGCACTGGAACACAGTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 172}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113563664_1113563675 18 Left 1113563664 13:111304225-111304247 CCCCCACTGTGTTCCAGTGCAGA 0: 1
1: 0
2: 0
3: 15
4: 172
Right 1113563675 13:111304266-111304288 CACCGCGGCTCGCTGGGCCCAGG 0: 1
1: 0
2: 2
3: 19
4: 203
1113563664_1113563672 11 Left 1113563664 13:111304225-111304247 CCCCCACTGTGTTCCAGTGCAGA 0: 1
1: 0
2: 0
3: 15
4: 172
Right 1113563672 13:111304259-111304281 CTGTCCTCACCGCGGCTCGCTGG 0: 1
1: 0
2: 0
3: 7
4: 106
1113563664_1113563670 3 Left 1113563664 13:111304225-111304247 CCCCCACTGTGTTCCAGTGCAGA 0: 1
1: 0
2: 0
3: 15
4: 172
Right 1113563670 13:111304251-111304273 GACGAAGCCTGTCCTCACCGCGG 0: 1
1: 0
2: 0
3: 9
4: 68
1113563664_1113563677 22 Left 1113563664 13:111304225-111304247 CCCCCACTGTGTTCCAGTGCAGA 0: 1
1: 0
2: 0
3: 15
4: 172
Right 1113563677 13:111304270-111304292 GCGGCTCGCTGGGCCCAGGCTGG 0: 1
1: 0
2: 3
3: 43
4: 368
1113563664_1113563673 12 Left 1113563664 13:111304225-111304247 CCCCCACTGTGTTCCAGTGCAGA 0: 1
1: 0
2: 0
3: 15
4: 172
Right 1113563673 13:111304260-111304282 TGTCCTCACCGCGGCTCGCTGGG 0: 1
1: 0
2: 1
3: 5
4: 46
1113563664_1113563678 28 Left 1113563664 13:111304225-111304247 CCCCCACTGTGTTCCAGTGCAGA 0: 1
1: 0
2: 0
3: 15
4: 172
Right 1113563678 13:111304276-111304298 CGCTGGGCCCAGGCTGGCTCTGG 0: 1
1: 0
2: 2
3: 50
4: 421

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113563664 Original CRISPR TCTGCACTGGAACACAGTGG GGG (reversed) Intronic
903574279 1:24328719-24328741 GCTGACCTGGAACACAGTGATGG + Intronic
904036149 1:27559810-27559832 TCTGTACTGGAGCCCAGAGGGGG + Intronic
907164317 1:52396961-52396983 TCTGGGCAGGAGCACAGTGGTGG - Intronic
907483847 1:54763201-54763223 TGTGCAGTGGAGCACAGAGGAGG - Intronic
908136345 1:61137379-61137401 TCAGGACTGGAACTCAGTGTTGG + Intronic
909293032 1:73908569-73908591 TCTTTACTGAGACACAGTGGAGG - Intergenic
912154708 1:106903715-106903737 TGTGTACTTGTACACAGTGGTGG + Intergenic
912913817 1:113791032-113791054 TATGTACTGGAGCACAGTGGAGG + Intronic
913565897 1:120071599-120071621 GCGGCAGTGGAAGACAGTGGAGG - Intergenic
913632236 1:120721954-120721976 GCGGCAGTGGAAGACAGTGGAGG + Intergenic
914286483 1:146230963-146230985 GCGGCAGTGGAAGACAGTGGAGG - Intergenic
914547514 1:148681705-148681727 GCGGCAGTGGAAGACAGTGGAGG - Intergenic
914618998 1:149388648-149388670 GCGGCAGTGGAAGACAGTGGAGG + Intergenic
915081508 1:153355723-153355745 GCTGCACTGGCACACAGGGTTGG + Intergenic
919193577 1:194254571-194254593 TCTGGACTCGAACATATTGGTGG - Intergenic
920787089 1:209051773-209051795 TCTGCAATGGCAGTCAGTGGGGG - Intergenic
921613965 1:217244873-217244895 TATGCATTGAGACACAGTGGAGG + Intergenic
922504694 1:226119718-226119740 CCTGCCCTGGCACACAGTGAGGG - Intergenic
924025205 1:239825050-239825072 TCAGCACTGGGTTACAGTGGTGG + Intronic
1063617016 10:7609005-7609027 TATGGACCGTAACACAGTGGTGG - Intronic
1065447226 10:25815320-25815342 TCTGTACTGGAACTCAGTGTAGG + Intergenic
1067202072 10:44181754-44181776 TGTTCACTGAAAGACAGTGGAGG + Intergenic
1069077707 10:64055381-64055403 ACTGCAGAGGAACAGAGTGGGGG + Intergenic
1070099906 10:73375135-73375157 GCTGAACTTAAACACAGTGGTGG + Intronic
1073344953 10:102776053-102776075 GCTGCACTGGAATACTGAGGAGG - Intronic
1074281831 10:112059317-112059339 TCTGTGCTGGTATACAGTGGTGG - Intergenic
1075677831 10:124308550-124308572 CCTTCACTGGAGCACAGTGTGGG + Intergenic
1078054070 11:7992863-7992885 TGTGAAATGGAACACAGTGGTGG - Intronic
1079205624 11:18412206-18412228 TCTGCCCTGGAGCGCAGTGTGGG - Intergenic
1081329460 11:41786626-41786648 GCTGCACTGGAACACAGAGAAGG - Intergenic
1083096417 11:60255641-60255663 TCTGGAGTGGAGCACATTGGTGG + Intergenic
1083278926 11:61613609-61613631 TCTGCACTGTTACACAATGGAGG + Intergenic
1088418598 11:109617810-109617832 GCTGGGCTGGAATACAGTGGGGG - Intergenic
1088753535 11:112866031-112866053 TCCACACTGGAAGCCAGTGGTGG - Intergenic
1091530489 12:1350272-1350294 CCAGCACTGAGACACAGTGGTGG + Intronic
1091848816 12:3678791-3678813 CCTGCACTGGAATGCAGTGCAGG - Intronic
1098234700 12:68407280-68407302 TCTGCCCTGGCCCACCGTGGAGG + Intergenic
1100260425 12:92928535-92928557 TCTCCTTTGGACCACAGTGGAGG - Intronic
1100914928 12:99409961-99409983 TGAGGACTGGACCACAGTGGAGG - Intronic
1101882800 12:108637452-108637474 TCTACACTGGAGCCCAGTAGTGG + Intergenic
1102144431 12:110644237-110644259 TCTTCAGTGGAACACAGTTTGGG + Intronic
1102240687 12:111322720-111322742 GCTGCACTGGAACATGGCGGGGG + Intronic
1104116661 12:125755622-125755644 TCTGCCCAGAAACACAGTGCTGG - Intergenic
1108215549 13:48180536-48180558 TCTGGACTGGAGTGCAGTGGTGG + Intergenic
1111077006 13:83249584-83249606 TTTGCACTGGAATGCAGTGATGG - Intergenic
1113355647 13:109577476-109577498 TCTTCCCAGGAACCCAGTGGAGG + Intergenic
1113563664 13:111304225-111304247 TCTGCACTGGAACACAGTGGGGG - Intronic
1114523914 14:23356269-23356291 TCTGAACTGAAACCCAGAGGAGG - Intergenic
1115195825 14:30798335-30798357 TTTGCCCAGGATCACAGTGGGGG + Intergenic
1115812829 14:37129387-37129409 TCTGGATTAGAACACAGTTGTGG + Intronic
1115941717 14:38617726-38617748 TCTGCACAGGAAGAGAGTAGTGG - Intergenic
1116999791 14:51360861-51360883 TCTACACTGGAACACAGGATGGG - Intergenic
1117666201 14:58058902-58058924 TCTGCAATGAAAAACAATGGTGG - Intronic
1119550730 14:75511996-75512018 CAGGCACTGGAGCACAGTGGTGG - Intergenic
1120500695 14:85293904-85293926 TCTTCACTGGAACAGAATGAGGG - Intergenic
1121505364 14:94473012-94473034 TGTGCCCTGGAACCCACTGGGGG + Intronic
1121738655 14:96236262-96236284 TCTGGACTGGAGCACTGTGATGG - Intronic
1122687523 14:103517049-103517071 TCTGCACAGGACCCCAGAGGAGG + Intergenic
1124841230 15:33244007-33244029 ACTGCAGTGGATCAAAGTGGAGG - Intergenic
1131264384 15:90906990-90907012 TCTGCTCTGAAGAACAGTGGGGG - Intronic
1131396059 15:92087225-92087247 TGTGCACTGCAAAACAGTTGGGG - Intronic
1132470692 16:101292-101314 TCACCACTGGAACACTCTGGGGG - Intronic
1137559639 16:49494444-49494466 TCTGCACTGGCACAGTGAGGGGG + Intronic
1144057213 17:11554013-11554035 TATGTCCTGTAACACAGTGGTGG + Intronic
1145404715 17:22577398-22577420 TGTGCACTGAAACACAAAGGAGG - Intergenic
1145820241 17:27827418-27827440 GCTGCAGTGAGACACAGTGGTGG + Intronic
1147125643 17:38366265-38366287 TCTGCAGGGCAAGACAGTGGTGG - Exonic
1148645353 17:49217112-49217134 TGTGCGCTAGAACACTGTGGCGG - Intronic
1149584434 17:57776096-57776118 TCTGAACTGAAACAAAGAGGAGG - Intergenic
1150310228 17:64122239-64122261 TCTGCTCTGGAAGACAGAGCAGG + Intronic
1150429743 17:65105623-65105645 TGTGCTCTGGTAAACAGTGGTGG + Intergenic
1151724504 17:75876492-75876514 TCTGCACAGGACGACAGTAGAGG + Exonic
1153090168 18:1333841-1333863 TATGCACAGGATCACAGTGGTGG + Intergenic
1153227933 18:2911983-2912005 TCTGCTCTGGAAAACAGAAGAGG - Intronic
1154369381 18:13745200-13745222 AGTGCACTGGAGCCCAGTGGAGG + Intronic
1155938303 18:31777065-31777087 TGTGAACTGGAACACAGGGGAGG + Intergenic
1157370633 18:47108337-47108359 TCTTCACTGGAAAACAGGGAGGG - Exonic
1158328712 18:56338083-56338105 TCTCTCCTGGAACACTGTGGTGG + Intergenic
1159964254 18:74580302-74580324 TCTGCACTGGGACTCAGGGGTGG + Intronic
1161885954 19:6995813-6995835 TCCCCACAGGAACACAGTAGTGG + Intergenic
1162641088 19:12010853-12010875 ACTGGACTGGAGTACAGTGGCGG + Intergenic
1166130072 19:40740685-40740707 TCAGCCCTGGAAGACAGTGTGGG - Exonic
1166839261 19:45686629-45686651 CCTGCACTGCAACACAGGGCTGG + Intergenic
925860670 2:8172612-8172634 TCTGGAGAGGAAGACAGTGGTGG - Intergenic
926021642 2:9501656-9501678 TATGCACTGGAATAGTGTGGAGG - Intronic
926719674 2:15950374-15950396 TCTGCAGTGCTACACAGGGGTGG - Intergenic
927430063 2:23019956-23019978 TCTGCAGTGGGAAATAGTGGTGG - Intergenic
928174664 2:29025655-29025677 ACCCCAGTGGAACACAGTGGGGG - Intronic
928571051 2:32608920-32608942 CCTGTGCTGGAATACAGTGGCGG + Intronic
935720133 2:105972680-105972702 GATGCACAGGAACAGAGTGGAGG + Intergenic
937356443 2:121200900-121200922 TCAGCCATGGAACTCAGTGGTGG + Intergenic
937404803 2:121617150-121617172 TCTGCAGTGGAAGACAGGGAAGG - Intronic
938639008 2:133260385-133260407 TTTACACTGGAACACAGTGAAGG + Intronic
941929285 2:170924491-170924513 TCTGGTGTGGAACACAGTTGTGG - Intergenic
942129328 2:172862911-172862933 TGTGCAGTGGAGCACAGGGGAGG + Intronic
942523891 2:176832524-176832546 ACTGCACTTGAACACAGGTGTGG - Intergenic
944539113 2:200740000-200740022 TCTGGACTGGAACACAGGTGAGG - Intergenic
944792594 2:203146748-203146770 TCTACACTGGAGTGCAGTGGTGG - Intronic
944985886 2:205175972-205175994 TCTGCACAGAGACACACTGGTGG + Intronic
946196518 2:218035538-218035560 ACAGCAGTGGGACACAGTGGAGG - Intronic
946200797 2:218069702-218069724 ACAGCAGTGGGACACAGTGGAGG - Intronic
946250057 2:218406308-218406330 TCTGCCCTGGAGCAGAGGGGCGG + Intergenic
946708463 2:222482669-222482691 TCTGAACTGAAAGACAGTTGAGG - Intronic
948798849 2:240421013-240421035 TCTGCCCAGGAACACAGCAGTGG + Intergenic
1172167373 20:32907474-32907496 GCTGCAGAGGAGCACAGTGGCGG - Intronic
1172285046 20:33734374-33734396 GCTGCTCTGGAACAGACTGGAGG + Intronic
1175811783 20:61862225-61862247 TCAGAACTGGAACCCGGTGGTGG - Intronic
1177020388 21:15848505-15848527 TTTGAACAGGAACACAGAGGAGG + Intronic
1178235367 21:30835383-30835405 TCTGCACTGGAACTCCCTGAAGG + Intergenic
1178478415 21:32957563-32957585 CCTTCACTGGAAGACAGTCGTGG + Intergenic
1179137673 21:38694949-38694971 TCTGGACAGGCACTCAGTGGTGG + Intergenic
1183407686 22:37638556-37638578 TCTGCACCGGCACACAGTAGTGG + Intronic
1184637039 22:45841076-45841098 TCTATACTGGCACAAAGTGGGGG + Intronic
949213012 3:1528228-1528250 TAGGCACTGGAACAGAATGGAGG - Intergenic
952755558 3:36863072-36863094 TCAGCTCTGGAAGACAGTTGAGG + Intronic
953079434 3:39601813-39601835 TATGCTCAGGAACACAGTAGGGG - Intergenic
953879042 3:46682089-46682111 GTTCCCCTGGAACACAGTGGAGG + Exonic
954711603 3:52507728-52507750 TCTGCCCTGGGTCACAGGGGTGG + Intronic
954975437 3:54689577-54689599 TTTGCTCTCGAACACACTGGGGG - Intronic
955198761 3:56830595-56830617 TGTGCAGTGGAAGCCAGTGGAGG - Intronic
956805038 3:72801641-72801663 TATTCACTGAAACACAGTGAGGG - Intronic
959520939 3:107322234-107322256 GCTCCATTTGAACACAGTGGTGG + Intergenic
960200321 3:114826616-114826638 TGTGCACTGAAAAAAAGTGGAGG - Intronic
961076363 3:123986632-123986654 TCTGCAGTGGCAGTCAGTGGGGG + Intronic
961104037 3:124225793-124225815 TGTGTACTGCAACACAGTAGAGG + Intronic
961382257 3:126503520-126503542 TCTGCCCTGGAGCACAGGGAGGG + Intronic
963377770 3:144491772-144491794 TCTGCACTGTAACTCAGAGGTGG - Intergenic
966849778 3:184157027-184157049 TCTGCCCTGGAACTCAGGGTTGG + Intronic
967697415 3:192548687-192548709 TCTGCTCTGAAACACAATGGTGG - Intronic
969891941 4:10268043-10268065 CCTGCACTGGTACACAGGTGAGG - Intergenic
970644508 4:18104949-18104971 TGTGCACTGGGACACAGGGTGGG + Intergenic
973533540 4:51857496-51857518 TCTGTACAGGAAAACATTGGTGG - Intronic
975110930 4:70625706-70625728 TCTGAGCTAGAACTCAGTGGTGG - Intergenic
976271518 4:83235256-83235278 TCTGCAATGGAACAAGCTGGAGG + Intergenic
976603568 4:86961556-86961578 TTTGCACTGGGGCATAGTGGGGG + Intronic
981273013 4:142866764-142866786 TCTGCATTGGCAAACAGTGCGGG - Intergenic
981529248 4:145735964-145735986 GCTTCACTGGAACAGAGTGTAGG - Intronic
982277813 4:153654849-153654871 TATGCAGTTGAACACAGTGTTGG - Intergenic
983266425 4:165512808-165512830 TCTGCAGTGGAGCACAGGTGAGG + Intergenic
983484428 4:168317511-168317533 TCTGTATTGGAACAGAATGGTGG + Intronic
984608142 4:181808072-181808094 TAGGCACTGGAAGGCAGTGGTGG - Intergenic
985907250 5:2849504-2849526 TCTGAGCTGTAACCCAGTGGTGG + Intergenic
989335708 5:40314602-40314624 TCTTCACTGGCACAAAGAGGAGG + Intergenic
991994063 5:72370115-72370137 TCTGCCCTGGAACACTGAGCTGG + Intergenic
996577002 5:124986739-124986761 GTTGCACAGGTACACAGTGGTGG - Intergenic
998690301 5:144580530-144580552 ACTGCCCTGGCAGACAGTGGAGG + Intergenic
1000763191 5:165252219-165252241 GCTCCACTGGCCCACAGTGGTGG + Intergenic
1003068357 6:2921972-2921994 TGTATACTGGGACACAGTGGAGG - Intergenic
1003408412 6:5841659-5841681 TCTTCACAGGAACACAGCGCTGG - Intergenic
1006560917 6:34911438-34911460 TGTGCACAGGATAACAGTGGGGG + Intronic
1006620270 6:35359113-35359135 CCTGCACTGGGACACAGCTGAGG + Intronic
1012676206 6:102115842-102115864 TCTGCTCTGGAGCACAGTAGGGG - Intergenic
1013150280 6:107439124-107439146 TCTGTACAGGAAGAAAGTGGAGG - Intronic
1016075406 6:139789226-139789248 TCTGCAGTGGAGCACAGTCAAGG - Intergenic
1018911319 6:168102015-168102037 CCTGCCCTGGGGCACAGTGGCGG + Intergenic
1019310780 7:359671-359693 TCTGCACAGGTACAAGGTGGCGG + Intergenic
1028489662 7:91397051-91397073 ATTGCACTGGGACACATTGGTGG - Intergenic
1029183538 7:98721810-98721832 TTTGCACTGGGACACTGTTGGGG - Intergenic
1030152878 7:106424210-106424232 TCTATGCTGGAGCACAGTGGAGG + Intergenic
1031824264 7:126543463-126543485 TAGGATCTGGAACACAGTGGTGG - Intronic
1032138904 7:129308354-129308376 TTTGCATTGGAACTCAGTGCTGG - Intronic
1033508434 7:142029807-142029829 TCTCCAATGGAATAGAGTGGGGG - Intronic
1033595068 7:142853599-142853621 TTTGCCCTGAAACTCAGTGGTGG - Intergenic
1035981175 8:4374171-4374193 CCTGGACTGGAACTCAGAGGGGG - Intronic
1036034199 8:5001543-5001565 TGTGAACTGTAACTCAGTGGAGG + Intergenic
1036397160 8:8379098-8379120 TCTGAACTGGATCAGAGTGAGGG + Intronic
1038661512 8:29501509-29501531 GCTTCCCTGGACCACAGTGGAGG - Intergenic
1038938129 8:32275155-32275177 GCTCCACAGGAACACAGAGGCGG - Intronic
1041248242 8:55909283-55909305 TCTGCACTGGACCCCAGTCCTGG + Intronic
1041591926 8:59597631-59597653 TCTGCTATGTAACACAGAGGCGG + Intergenic
1045320795 8:101080333-101080355 TCTGCCCTGGGCCACACTGGTGG - Intergenic
1050448519 9:5754149-5754171 TCTGCACAGCAACCCAGTGAAGG + Intronic
1055981451 9:82006595-82006617 TCTGAACTGTATCACAGTGTTGG + Intergenic
1058989182 9:110238722-110238744 TTTCCACTGTAACCCAGTGGGGG + Intergenic
1060109938 9:120899656-120899678 TCTGCTCTGGAGCTCAGTAGAGG + Intergenic
1060435204 9:123586858-123586880 TCTGCATGGGAACCAAGTGGGGG + Intronic
1062187985 9:135228791-135228813 CCTGCCCTGGCACACTGTGGGGG + Intergenic
1062690016 9:137836885-137836907 TCTGCACAGGGCCACAGGGGAGG + Intronic
1187569295 X:20484617-20484639 TCTGTACTGGGGCACATTGGGGG - Intergenic
1189876364 X:45440601-45440623 TCTGCAGAGCCACACAGTGGTGG - Intergenic
1191111274 X:56804578-56804600 CCAGCACAGGAACACAGAGGAGG - Intergenic
1194460013 X:94154540-94154562 TCTGCATTGTAACAGGGTGGAGG - Intergenic
1194663893 X:96656112-96656134 TCTGCAATGGCAGTCAGTGGCGG - Intergenic
1195255596 X:103086366-103086388 TCTGCACTGGAGTGCAGTGGCGG - Intronic
1196357468 X:114810534-114810556 TTTGCATTGGAACTCAGTGCTGG - Intronic
1197183598 X:123562822-123562844 CCTGCACTGGTACACAGGCGAGG + Intergenic
1197422774 X:126258717-126258739 TCTGCAGTGGAGCACAGCGAGGG - Intergenic
1200712060 Y:6494397-6494419 TCTACACTGGCCCACAGTGTGGG - Intergenic