ID: 1113564994

View in Genome Browser
Species Human (GRCh38)
Location 13:111314420-111314442
Sequence AGCCACACGCGTCCATGGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 64
Summary {0: 1, 1: 1, 2: 1, 3: 5, 4: 56}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113564981_1113564994 24 Left 1113564981 13:111314373-111314395 CCACACGCATCCGTGGAAGGGTG 0: 1
1: 1
2: 1
3: 12
4: 59
Right 1113564994 13:111314420-111314442 AGCCACACGCGTCCATGGAAGGG 0: 1
1: 1
2: 1
3: 5
4: 56
1113564984_1113564994 14 Left 1113564984 13:111314383-111314405 CCGTGGAAGGGTGGAGAGGACAC 0: 3
1: 0
2: 5
3: 32
4: 231
Right 1113564994 13:111314420-111314442 AGCCACACGCGTCCATGGAAGGG 0: 1
1: 1
2: 1
3: 5
4: 56

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113564994 Original CRISPR AGCCACACGCGTCCATGGAA GGG Intergenic
900097744 1:947102-947124 AGCCACACGTGTGCATTGCATGG + Intronic
904118483 1:28179343-28179365 TGCCACATGCGCGCATGGAAGGG - Intronic
906720840 1:48003325-48003347 ACCCACTCGCATGCATGGAAGGG + Intergenic
909530372 1:76675296-76675318 AGCCACAGGCTACCCTGGAAGGG + Intergenic
915358929 1:155273734-155273756 AGCCACACGTCTCCATGCAAAGG - Intronic
920308352 1:205033015-205033037 AGCCACAGGCTGCCAAGGAAGGG + Intergenic
922797164 1:228345900-228345922 AGCCACACGCTTTCATGGTGTGG + Intronic
922861434 1:228820038-228820060 AGACACAAGCATCAATGGAACGG - Intergenic
923539445 1:234877494-234877516 AGCCCCACTGGGCCATGGAACGG - Intergenic
1076633094 10:131864254-131864276 AGACACATGGGTCAATGGAACGG + Intergenic
1089364038 11:117910101-117910123 AGCAAAGCCCGTCCATGGAAGGG - Intronic
1090575145 11:128094351-128094373 AGCAACACTCGTCCATCAAATGG + Intergenic
1090650008 11:128798399-128798421 AGCCTCACGTGGCCATGGCAAGG + Intronic
1101044051 12:100786427-100786449 AGCCACACCTGTTCTTGGAATGG + Intronic
1107530936 13:41281685-41281707 GGCCACCTGGGTCCATGGAATGG - Intergenic
1109925434 13:69131386-69131408 CGCCACACGTGCTCATGGAAGGG - Intergenic
1110302522 13:73945921-73945943 ACCCACAGGCCTCCATGAAAGGG - Intronic
1113564980 13:111314371-111314393 AGCCACACGCATCCGTGGAAGGG + Intergenic
1113564994 13:111314420-111314442 AGCCACACGCGTCCATGGAAGGG + Intergenic
1113565008 13:111314469-111314491 AGCCACACGCATCCATGGAAGGG + Intergenic
1119145590 14:72310818-72310840 AGTCACATGGGTCCCTGGAAGGG - Intronic
1122251705 14:100444504-100444526 ACCCAGACGTGTCCATGGAAAGG - Intronic
1124014332 15:25863088-25863110 GGCGACACGCGGCCATGGAGCGG - Exonic
1131246099 15:90795114-90795136 AGCCACAAGTGACCATGGTATGG + Intronic
1132006691 15:98233710-98233732 AGTGACACGTGTCCTTGGAAGGG - Intergenic
1139960477 16:70714658-70714680 AGCCAAACAAGTCCATGGCAGGG + Intronic
1140957881 16:79884077-79884099 AGCCACACATGGCAATGGAAAGG - Intergenic
1141781399 16:86164018-86164040 AGCCACACCCAACCCTGGAAGGG - Intergenic
1141964618 16:87433420-87433442 AGCCACACCTGGCAATGGAAGGG + Intronic
1141982294 16:87558065-87558087 ATCCACAGGCTTCAATGGAATGG + Intergenic
1151657609 17:75503028-75503050 AGCTACAGGCGGCCATGGCAGGG - Exonic
1152584774 17:81183978-81184000 TGCCACACTCGCCCCTGGAATGG - Intergenic
1155920732 18:31600474-31600496 AGCAACATGGGTCCATTGAAGGG + Intergenic
1157155040 18:45256954-45256976 AGCAACACTGGTCCATGTAAAGG - Intronic
935067109 2:99658763-99658785 AGCCACAGGAGTCCATGGTGAGG - Intronic
937302881 2:120853956-120853978 AGCCACAGGCCACCATGGACAGG - Intronic
945083469 2:206108846-206108868 AGCCACACCCTTTCATGGGATGG - Intergenic
1170608642 20:17894011-17894033 AGCCACAGGCACACATGGAATGG + Intergenic
1172909272 20:38394518-38394540 AGCCTCATGCATCCCTGGAATGG - Intergenic
1176058865 20:63163255-63163277 ACCCACATTGGTCCATGGAATGG + Intergenic
1181013825 22:20057125-20057147 AGCCCCAGGCGTCCCTGGAGGGG + Intronic
950284799 3:11736250-11736272 AGCCACATGTGCCCATGGAAAGG + Intergenic
968393759 4:213929-213951 GGCCACACGCGTCCTAGGACAGG + Intergenic
974877916 4:67720479-67720501 TGCCACAGGCCTCCATGGCAAGG - Intergenic
976784552 4:88803077-88803099 AGCCACAAGCAGCCATGGAGCGG - Intronic
985587102 5:746139-746161 AGCCACGAGCTTCCATGGAGGGG + Intronic
985601673 5:838322-838344 AGCCACGAGCTTCCATGGAGGGG + Intronic
986894209 5:12346340-12346362 ATCCCCACACGTCCATGGGAGGG + Intergenic
988984830 5:36607295-36607317 AGCGACACACATCCATGGTACGG + Intronic
997251173 5:132389765-132389787 AGTCACCCGCTTCCAAGGAATGG + Intronic
999102820 5:149040952-149040974 AGCCACACAGGTCCATGGTGTGG + Intronic
999368304 5:151037304-151037326 AGCCACACATGTTCAGGGAAGGG - Intronic
1004205713 6:13589906-13589928 GTCCACAGGCGTCCCTGGAAGGG - Intronic
1008430138 6:51406760-51406782 AGCAACACGTGTACATAGAAAGG - Intergenic
1026605686 7:71813996-71814018 AGCTACACGGGTCCCAGGAAGGG + Intronic
1047318434 8:123755397-123755419 AGCCACAAGAGGCCAGGGAAAGG + Intergenic
1053475570 9:38379758-38379780 AAACACACACGTCCAAGGAAAGG - Intergenic
1061594291 9:131618982-131619004 AGGCACACGCTTCCAAGGAACGG + Intronic
1062205230 9:135332816-135332838 ACCCACACTCGACCTTGGAAAGG + Intergenic
1062670527 9:137706112-137706134 AGGCACACGGGGCCATGGCAGGG + Intronic
1186463080 X:9764145-9764167 AGCCACACGCCACCATGCTAGGG - Intronic
1187171877 X:16860177-16860199 AGCCACTGGAGTCCATGGAATGG - Intronic
1188198492 X:27269453-27269475 AGCCACACTCTTCCATTTAACGG + Intergenic
1199641616 X:149867919-149867941 AGCCAGACTAGACCATGGAAGGG - Intergenic