ID: 1113565008

View in Genome Browser
Species Human (GRCh38)
Location 13:111314469-111314491
Sequence AGCCACACGCATCCATGGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 2, 2: 0, 3: 9, 4: 102}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113564998_1113565008 14 Left 1113564998 13:111314432-111314454 CCATGGAAGGGTGGAGAGGACAC 0: 3
1: 0
2: 5
3: 32
4: 231
Right 1113565008 13:111314469-111314491 AGCCACACGCATCCATGGAAGGG 0: 1
1: 2
2: 0
3: 9
4: 102
1113564995_1113565008 24 Left 1113564995 13:111314422-111314444 CCACACGCGTCCATGGAAGGGTG 0: 1
1: 1
2: 2
3: 3
4: 43
Right 1113565008 13:111314469-111314491 AGCCACACGCATCCATGGAAGGG 0: 1
1: 2
2: 0
3: 9
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113565008 Original CRISPR AGCCACACGCATCCATGGAA GGG Intergenic
901023816 1:6268760-6268782 AGCCACACGCAGCAGTGGAGCGG + Intronic
902908582 1:19578208-19578230 AGACCCAGGCATCCATGGAGAGG + Intergenic
906720840 1:48003325-48003347 ACCCACTCGCATGCATGGAAGGG + Intergenic
909530372 1:76675296-76675318 AGCCACAGGCTACCCTGGAAGGG + Intergenic
912556341 1:110518772-110518794 AGCCACACACATCCATTCTAGGG + Exonic
913420781 1:118666327-118666349 AGACACACAGACCCATGGAACGG + Intergenic
915358929 1:155273734-155273756 AGCCACACGTCTCCATGCAAAGG - Intronic
919319982 1:196023826-196023848 AGACATAGGAATCCATGGAAGGG - Intergenic
920308352 1:205033015-205033037 AGCCACAGGCTGCCAAGGAAGGG + Intergenic
921385053 1:214560439-214560461 AGTAAAATGCATCCATGGAAAGG + Intergenic
922797164 1:228345900-228345922 AGCCACACGCTTTCATGGTGTGG + Intronic
922861434 1:228820038-228820060 AGACACAAGCATCAATGGAACGG - Intergenic
1069329998 10:67280455-67280477 AGGCACACAGATCCATTGAAAGG + Intronic
1072966134 10:99974321-99974343 AGCCACATGCATCAAGGTAATGG - Intronic
1075052873 10:119195821-119195843 TGCCACAGGCATTCAGGGAAAGG - Intergenic
1078730517 11:13969978-13970000 AGGCACATGCATGCATTGAATGG + Intronic
1084081878 11:66832611-66832633 AGGCACAGCCAGCCATGGAAGGG - Intronic
1084430695 11:69109316-69109338 AGGAACACACATCCAAGGAAAGG + Intergenic
1089290714 11:117436503-117436525 ACACACACACATCCATTGAAGGG - Intronic
1094850637 12:34380811-34380833 GGCCCCACGCATGCATGGTAGGG + Intergenic
1099154458 12:79157286-79157308 AGCCACCTGCATCAATGCAAAGG - Intronic
1104375185 12:128259696-128259718 ACCCACACGCAGCCTGGGAATGG - Intergenic
1106230377 13:27816783-27816805 AGCCACACCCATCTATGCACTGG - Intergenic
1109917233 13:69005717-69005739 AGGCACAGGTATCCATAGAAGGG - Intergenic
1110302522 13:73945921-73945943 ACCCACAGGCCTCCATGAAAGGG - Intronic
1111037292 13:82693108-82693130 AGACACACAAATCAATGGAAGGG + Intergenic
1112006152 13:95255462-95255484 AGACACAGGCATCGCTGGAATGG + Intronic
1112369967 13:98785625-98785647 AGCCAGACGCAGTGATGGAAGGG - Intergenic
1113564980 13:111314371-111314393 AGCCACACGCATCCGTGGAAGGG + Intergenic
1113564994 13:111314420-111314442 AGCCACACGCGTCCATGGAAGGG + Intergenic
1113565008 13:111314469-111314491 AGCCACACGCATCCATGGAAGGG + Intergenic
1115614638 14:35082892-35082914 AGCTACATGGATTCATGGAATGG + Exonic
1116142985 14:41024287-41024309 AGACACACAGATCAATGGAACGG - Intergenic
1120036890 14:79707928-79707950 AGCCATACAAATCCATGAAATGG - Intronic
1122251705 14:100444504-100444526 ACCCAGACGTGTCCATGGAAAGG - Intronic
1126532415 15:49725455-49725477 AGCCACATCCAACCATGGTAAGG + Intergenic
1129677501 15:77640185-77640207 AGCCACACCTATCTAGGGAAAGG - Intronic
1131499195 15:92945211-92945233 GGCAAAACGCATCCATGGAGTGG + Intronic
1133629958 16:7610769-7610791 AGGCACCTGCATCTATGGAATGG + Intronic
1134093445 16:11403747-11403769 AGAAACAGGCATCCCTGGAAGGG - Intronic
1135965825 16:27034228-27034250 AGACACACCCATGCATGGGAGGG - Intergenic
1137714225 16:50588144-50588166 GGCCACATTCATACATGGAAAGG + Intronic
1137774611 16:51044688-51044710 AGCTCCACCCATCCAGGGAAAGG - Intergenic
1141781399 16:86164018-86164040 AGCCACACCCAACCCTGGAAGGG - Intergenic
1141982294 16:87558065-87558087 ATCCACAGGCTTCAATGGAATGG + Intergenic
1142496270 17:307657-307679 AACCACACGGATCCCTGGCAAGG - Intronic
1144866914 17:18341815-18341837 GGCAGCACGCATTCATGGAAGGG + Intronic
1157777811 18:50410003-50410025 AGGCACACGAATACATTGAAGGG + Intergenic
1158089746 18:53696859-53696881 CGACACAAGCATTCATGGAAAGG - Intergenic
1158384031 18:56968753-56968775 AACCACACACATCCTTGGCATGG + Intronic
1161055678 19:2189670-2189692 AGCCAGCCGCATGCATGGGAGGG - Intronic
1161172987 19:2822589-2822611 CGCCACACACATCCATGGCCAGG - Intronic
935786343 2:106552173-106552195 AGGGAAATGCATCCATGGAAAGG + Intergenic
937302881 2:120853956-120853978 AGCCACAGGCCACCATGGACAGG - Intronic
943698788 2:190966594-190966616 ACACACACACATCCATGGATAGG + Intronic
945037587 2:205717255-205717277 AGACACACACATAGATGGAAGGG - Intronic
945083469 2:206108846-206108868 AGCCACACCCTTTCATGGGATGG - Intergenic
1168911320 20:1449506-1449528 AGCCACACGCATCTGTTCAAAGG + Intronic
1169246666 20:4031023-4031045 AGACACACAGATCAATGGAACGG - Intergenic
1170608642 20:17894011-17894033 AGCCACAGGCACACATGGAATGG + Intergenic
1172749403 20:37239511-37239533 ATGCTCACACATCCATGGAAAGG - Intronic
1172909272 20:38394518-38394540 AGCCTCATGCATCCCTGGAATGG - Intergenic
1178735173 21:35142559-35142581 AGCCACACGGAGCCATCCAAGGG - Intronic
1183272000 22:36868112-36868134 AGCCACAGCCATCCAGGAAAGGG + Intronic
1183663738 22:39235622-39235644 GGCCACACCCATCCAGGGCAGGG - Intronic
950284799 3:11736250-11736272 AGCCACATGTGCCCATGGAAAGG + Intergenic
950947795 3:16968103-16968125 AGACACATGGATCAATGGAATGG - Intronic
953798443 3:46003004-46003026 GGCCACAGGAATACATGGAAAGG + Intergenic
954676276 3:52317385-52317407 AGCCACACCCACCCATTGCACGG - Intronic
955381231 3:58439958-58439980 GGCCTCACGGATCCAAGGAATGG + Intergenic
960179138 3:114554076-114554098 AGCCTCACGTATTCATGGATGGG + Intronic
969144532 4:5110411-5110433 AGACACATGTATCAATGGAATGG + Intronic
973590870 4:52440124-52440146 AGCCACATGCATCCTGAGAAAGG + Intergenic
974877916 4:67720479-67720501 TGCCACAGGCCTCCATGGCAAGG - Intergenic
976294438 4:83455678-83455700 AACCACATTCATCCATGGCAAGG + Exonic
976784552 4:88803077-88803099 AGCCACAAGCAGCCATGGAGCGG - Intronic
985587102 5:746139-746161 AGCCACGAGCTTCCATGGAGGGG + Intronic
985601673 5:838322-838344 AGCCACGAGCTTCCATGGAGGGG + Intronic
987417234 5:17675737-17675759 AGCCAGAAGCATAAATGGAATGG - Intergenic
988984830 5:36607295-36607317 AGCGACACACATCCATGGTACGG + Intronic
990051143 5:51503310-51503332 TCCCACACTCATCCATGGCAGGG - Intergenic
997251173 5:132389765-132389787 AGTCACCCGCTTCCAAGGAATGG + Intronic
1013176234 6:107679710-107679732 ATCCACACACATCCTTAGAATGG + Intergenic
1013189375 6:107789313-107789335 ACCCACAAACATCCAAGGAAGGG - Intronic
1014770914 6:125457443-125457465 GGCCACAAGCATCCATGTGAGGG + Intergenic
1014955405 6:127608867-127608889 AAGCACAGGCATCCAGGGAAGGG - Intergenic
1018717907 6:166548492-166548514 AGACACACAGATCAATGGAATGG + Intronic
1019704936 7:2493128-2493150 GCCCACAGGCAGCCATGGAAGGG + Intergenic
1027251893 7:76404089-76404111 AGGTAAACGCACCCATGGAATGG - Intronic
1030299805 7:107963680-107963702 AGTCACAAGGATTCATGGAAAGG - Intronic
1037592808 8:20327733-20327755 AGCCACAGGCATAGAGGGAAGGG - Intergenic
1041694616 8:60722238-60722260 AGCCACAGGCATCCTTGACAGGG - Intronic
1044599419 8:93988880-93988902 AGCCAGAAACATCCATGGCATGG - Intergenic
1049184229 8:141240938-141240960 AGCCGCCCGGATCCATGGGAGGG + Intronic
1049296736 8:141844670-141844692 AGCCACAGTCATTCCTGGAAGGG - Intergenic
1050154593 9:2652549-2652571 AGCCACATCCATCCAGGCAAGGG - Intronic
1051107113 9:13592981-13593003 AGCTACACACATACATGCAACGG - Intergenic
1051764148 9:20503343-20503365 AGACACACAGATCAATGGAATGG + Intronic
1061594291 9:131618982-131619004 AGGCACACGCTTCCAAGGAACGG + Intronic
1061652857 9:132065352-132065374 AGACACACGCAAACAGGGAAAGG + Intronic
1062115931 9:134808947-134808969 ATCCACACTCATCCTAGGAAAGG - Intronic
1186463080 X:9764145-9764167 AGCCACACGCCACCATGCTAGGG - Intronic
1187171877 X:16860177-16860199 AGCCACTGGAGTCCATGGAATGG - Intronic
1187821543 X:23293241-23293263 AGCAATAGGCATCCATGGGATGG - Intergenic
1188198492 X:27269453-27269475 AGCCACACTCTTCCATTTAACGG + Intergenic
1192980742 X:76337858-76337880 AGACACACAGATCAATGGAACGG + Intergenic
1194415200 X:93603509-93603531 AGACCCATGCATGCATGGAATGG + Intergenic
1194593404 X:95829482-95829504 AGACACATAGATCCATGGAAAGG + Intergenic
1194939232 X:99989234-99989256 GGCCACATGAAGCCATGGAAAGG - Intergenic
1195133164 X:101874971-101874993 AGACACATGGATCAATGGAATGG + Intergenic
1195740982 X:108064186-108064208 AGCCAGACACATACATGGAGGGG - Intronic
1195897482 X:109761358-109761380 AACCAGACTCATACATGGAAGGG + Intergenic
1198925894 X:141794933-141794955 AGCCAAATGCATCCAAAGAAAGG + Intergenic
1200139863 X:153894699-153894721 ACCCACACGCATCCAGAAAATGG + Intronic