ID: 1113565641

View in Genome Browser
Species Human (GRCh38)
Location 13:111318116-111318138
Sequence GCTGAGAGCAGGGGATTCGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 247
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 230}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113565641_1113565652 6 Left 1113565641 13:111318116-111318138 CCCCCGAATCCCCTGCTCTCAGC 0: 1
1: 0
2: 1
3: 15
4: 230
Right 1113565652 13:111318145-111318167 GAGCTGCTCTGCTGGGAGTCAGG 0: 1
1: 0
2: 0
3: 31
4: 336
1113565641_1113565651 -1 Left 1113565641 13:111318116-111318138 CCCCCGAATCCCCTGCTCTCAGC 0: 1
1: 0
2: 1
3: 15
4: 230
Right 1113565651 13:111318138-111318160 CCTGGCTGAGCTGCTCTGCTGGG 0: 1
1: 0
2: 1
3: 36
4: 347
1113565641_1113565649 -2 Left 1113565641 13:111318116-111318138 CCCCCGAATCCCCTGCTCTCAGC 0: 1
1: 0
2: 1
3: 15
4: 230
Right 1113565649 13:111318137-111318159 GCCTGGCTGAGCTGCTCTGCTGG 0: 1
1: 0
2: 2
3: 37
4: 352

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113565641 Original CRISPR GCTGAGAGCAGGGGATTCGG GGG (reversed) Intronic