ID: 1113567105

View in Genome Browser
Species Human (GRCh38)
Location 13:111325692-111325714
Sequence CGGTGGGTGTGGAGGGAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 617
Summary {0: 1, 1: 0, 2: 10, 3: 43, 4: 563}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113567105 Original CRISPR CGGTGGGTGTGGAGGGAAAA TGG Intronic
900269219 1:1778573-1778595 CGGCGGGCGTGGCGGGAAAGAGG + Intronic
900312507 1:2040972-2040994 AGCTGGGTGTGGAGGGAAAGGGG - Intergenic
901421055 1:9151516-9151538 TCGTGGGTGCGGAAGGAAAAAGG - Intergenic
901478375 1:9506446-9506468 CCATGGGTGTGGAAGGAAATGGG - Intergenic
901521628 1:9789284-9789306 CGGTTGGTGGGAATGGAAAATGG - Intronic
901641891 1:10696832-10696854 AGGAAGGTGTGGAGGGGAAAAGG + Intronic
901706362 1:11076488-11076510 CAGTGGTGGTGGAGGAAAAACGG - Intronic
902218531 1:14950071-14950093 GGGTGGGTGTGGAGGGTGCAGGG - Intronic
902236445 1:15060462-15060484 CGATGGATGTGGGGAGAAAAAGG + Intronic
902431526 1:16367227-16367249 GGGTGGGGGAGGAGGGAAAGCGG + Exonic
902638657 1:17751747-17751769 TGGTGGGTGTAGAGGGCACAGGG - Intergenic
902822186 1:18950208-18950230 TGTTGGGGGTGGAGGGAGAACGG - Intronic
903277896 1:22233249-22233271 GGCTGGGTGTGGGGGCAAAACGG + Intergenic
903649566 1:24914510-24914532 CGGTGGCTGGGCAGGGAAACGGG + Intronic
904229744 1:29058670-29058692 CTGAGGGGGTGGAGGGAAAGAGG - Intronic
904623415 1:31789040-31789062 CAGTTGGTATGGAGGGAAACGGG - Intergenic
905309082 1:37037196-37037218 CAGTGGGTGTGGAGAGCAAGAGG - Intergenic
905805474 1:40873954-40873976 CTGTGGGTAGGGAGGGACAACGG + Intergenic
906468703 1:46108743-46108765 TGGTGGGTGTGGAGGCAAGAAGG - Intronic
906583580 1:46956313-46956335 AGCTGGGTGTAGAGGGACAACGG - Intergenic
907186318 1:52612136-52612158 CAGTGGGTATGGAGGGAGGAAGG - Intergenic
907528601 1:55070284-55070306 AGGTGGGTGCGGAGAGAATATGG + Intronic
908318735 1:62960598-62960620 GGGTGGGTGAGGAGTGTAAAAGG - Intergenic
908669853 1:66533976-66533998 CGATGGGGGTGGAGGGGAATGGG + Intronic
909362033 1:74772050-74772072 CGGTGGGTAAAGAAGGAAAAAGG + Intergenic
909982287 1:82116981-82117003 TGGTGTGTGTAGAGTGAAAAGGG + Intergenic
910450049 1:87335223-87335245 AGGTGGGGGTGGAGGAAAGACGG - Intronic
912685172 1:111756251-111756273 CGGGGGGTGGGGTGGGAGAAGGG + Intronic
912869657 1:113292345-113292367 CGGAGGGGGAGGAGGGGAAAAGG + Intergenic
913013966 1:114713979-114714001 CTGGGGGTGTGGAGGGTAAGGGG + Intronic
913162510 1:116157073-116157095 AGGTGGGAGTGGAGGGGCAAGGG - Intergenic
913206981 1:116547932-116547954 GCATGGGTGTGGTGGGAAAAGGG - Intronic
915319071 1:155046269-155046291 AGGTGAGGGTGGAGGGTAAAAGG + Intronic
915367476 1:155324032-155324054 AGGTGGGTCTGGAGGGAGAGGGG - Intronic
916415498 1:164588820-164588842 TGGTGGGGGCGGAGGGATAAAGG - Intronic
917172260 1:172190155-172190177 CGGTGGGGGTGCAGGGAAAAGGG - Intronic
917310185 1:173670347-173670369 CGATGGAGGTGGAGGGACAAGGG + Intergenic
917961597 1:180149948-180149970 ATGTGTGTGTGGAGGGAGAAGGG - Intergenic
920337802 1:205256959-205256981 GGGTGGGGGTGGGGGGCAAAGGG - Intronic
920567201 1:206983660-206983682 GGGTGGGTGAGGGGGAAAAAAGG - Intergenic
921265015 1:213414962-213414984 GGGTGGGTGTGGAGGCCAGAGGG + Intergenic
923220526 1:231888631-231888653 CGGTGGCTGAGGTGGGAGAATGG + Intronic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
924226480 1:241926393-241926415 GTGGGGATGTGGAGGGAAAAAGG - Intergenic
1063362402 10:5469160-5469182 GGGAGGGAGTGGAGGGAGAAAGG - Intergenic
1063522861 10:6757036-6757058 GTGGGGGTGTGGAGGGACAAGGG + Intergenic
1064286798 10:13998671-13998693 GATTGGGTGTGGAGGGAGAAAGG - Intronic
1064364435 10:14694350-14694372 CGGTGAGAGTGCAGAGAAAAGGG - Intronic
1064584437 10:16825270-16825292 CGTGGGGAGTTGAGGGAAAATGG + Intronic
1065130251 10:22613080-22613102 CAATGGGAGTGAAGGGAAAAGGG + Intronic
1065804044 10:29378630-29378652 CGGGGGGTATGAAGGGACAAAGG + Intergenic
1065997622 10:31074102-31074124 TTGTGGATGTGGAGGGAAGACGG - Intergenic
1066463572 10:35633683-35633705 CGGTGGCTGTAGAAGGCAAAAGG + Intergenic
1067199525 10:44155333-44155355 GGGTGGGTGGGGTGGGGAAATGG + Intergenic
1067668867 10:48301804-48301826 CAGTGGGTGTGGATGGAGAGAGG + Intergenic
1069302583 10:66927027-66927049 CTGTAGGTGTGAAGGCAAAATGG + Exonic
1070574432 10:77666865-77666887 TGGTGGGTGGAGAGGGAAATTGG - Intergenic
1071275351 10:84049103-84049125 CAGTGGGGGTGGAGGGTAGAAGG + Intergenic
1072471769 10:95719982-95720004 AGCTGGGTATGGAGGGACAATGG + Intronic
1072783490 10:98265856-98265878 CAGTGTGGGTGGAGGGAAAAGGG - Intronic
1072908747 10:99481119-99481141 AGGGGAGTGGGGAGGGAAAAGGG + Intergenic
1072913252 10:99521868-99521890 GGGTGGGCCTGGAGGGAAAGGGG - Intergenic
1073044220 10:100626976-100626998 CAGAGGGTGTTGGGGGAAAAGGG + Intergenic
1073359856 10:102889664-102889686 CGGGGGGGGTGGAGGGAGGAAGG - Intronic
1074015171 10:109527270-109527292 TGGTGGATGGGGAGGGAAAGAGG - Intergenic
1074463162 10:113657161-113657183 CGGGGAGAGTGGAGAGAAAAGGG + Intronic
1076613191 10:131738955-131738977 GGGTGGGTGGGGAGGGAGCATGG - Intergenic
1076689341 10:132213336-132213358 CTGTGGGTGTGTTGGGAAGATGG - Intronic
1076764949 10:132627905-132627927 CGTCGGGTGTGGAGAGAAACTGG + Intronic
1079125430 11:17715006-17715028 GGTTGGGGGCGGAGGGAAAAAGG - Intergenic
1079329581 11:19522498-19522520 CGGCTGGTGAGGAGGGAAGAAGG - Intronic
1080445207 11:32331855-32331877 CTGGGGGTGTGGGGGGAATATGG + Intergenic
1080571202 11:33558532-33558554 AGGAGGGTCTGGAGGGAGAAGGG + Intronic
1080572740 11:33570885-33570907 TGATGAGTGTGGAGCGAAAAGGG + Intronic
1082044627 11:47715032-47715054 CGGTAGGTGCCGATGGAAAAAGG + Intronic
1082767569 11:57181415-57181437 GGGTGGGTGTTTTGGGAAAAGGG - Intergenic
1083175989 11:60950939-60950961 CGGCGGGTGTGGAGGGAAGGAGG - Intronic
1083375313 11:62215588-62215610 CCTTAGGTGTGGAGGGAAATGGG - Intergenic
1083474316 11:62906162-62906184 CGGTGGGAGTGGAAGGAAGGTGG + Intergenic
1083833335 11:65247611-65247633 CTGGGGCTGTGGAGGGAGAACGG + Intergenic
1083841145 11:65304972-65304994 GGGTGGGGGTGGGGGGAGAATGG - Intronic
1084522768 11:69674759-69674781 CAGGGGCTCTGGAGGGAAAAGGG + Intronic
1084601812 11:70150133-70150155 CCGTGGGGGTGGAGAGGAAATGG + Intronic
1084665417 11:70573710-70573732 CTGAGGGTGAGGAGGGGAAACGG + Intronic
1084763075 11:71286426-71286448 CTGTGGGTGGGGATGTAAAACGG - Intergenic
1084862113 11:72025884-72025906 TTGTGGGTGGGTAGGGAAAATGG - Intronic
1085907169 11:80777466-80777488 CTGTGGTTGTAGTGGGAAAATGG - Intergenic
1086755709 11:90558837-90558859 GGTGGGGTGTGGAGGGAAAGGGG + Intergenic
1087635609 11:100697864-100697886 CGGTGGGAGTGGAGAGCAAGGGG + Intronic
1088469546 11:110178030-110178052 TGGTGGGTGGGGAGGGCAGATGG - Intronic
1088984708 11:114895432-114895454 AGGTGGGTGAAGAGGGAAAGAGG - Intergenic
1089325371 11:117653188-117653210 GGGTGTGTGTGTAGGGGAAATGG + Intronic
1089454507 11:118618197-118618219 TGGGGGTTGGGGAGGGAAAATGG - Intronic
1089760697 11:120720866-120720888 GGGTGAGGATGGAGGGAAAAGGG + Intronic
1089791363 11:120946970-120946992 AAGTTGGTATGGAGGGAAAATGG - Intronic
1090197178 11:124826743-124826765 GGGTGGGGGTGGAGTGATAATGG - Intergenic
1090324163 11:125870481-125870503 CCTTAGGTGTGGAGGGAAATGGG + Intergenic
1090366620 11:126211829-126211851 CGGTGAGTGTGTAGGGAAGCCGG + Exonic
1091337034 11:134779708-134779730 CTGTGGGGGTGAAGAGAAAAGGG + Intergenic
1092011384 12:5115571-5115593 ATGTGGGTGTGTATGGAAAAGGG + Intergenic
1092943945 12:13436027-13436049 CAGAGGGAGTGGGGGGAAAAGGG - Intergenic
1092954162 12:13534085-13534107 TGGTGGCAGTGGAGGAAAAAAGG - Intergenic
1093809316 12:23472866-23472888 GCCTGGGTGTGGAGGAAAAAGGG - Intergenic
1093926297 12:24911693-24911715 CGAGGGGTGGGGAGGGAAGAGGG - Intronic
1093930065 12:24947156-24947178 GTGTGTGTGTGGAGGGAAGACGG - Intronic
1094003048 12:25717029-25717051 GGATGGGTGTGTAGGGGAAATGG + Intergenic
1094806614 12:34100385-34100407 AGCTGGGTATAGAGGGAAAACGG - Intergenic
1094842902 12:34349388-34349410 GGGTGGGTGTGGAGGGGACAAGG + Intergenic
1095814536 12:46406985-46407007 AAGTGGGTGGGGAGGGAAGATGG - Intergenic
1096309225 12:50505379-50505401 GGGTGGGAGAGGAGGGAAAACGG - Intronic
1096472900 12:51890089-51890111 CACTGGGTTTGGAGTGAAAAAGG + Intronic
1096492282 12:52019335-52019357 GGGTGGGGGTGGATGGGAAAAGG + Intergenic
1096777707 12:53974132-53974154 GGGTGGGGAGGGAGGGAAAAGGG + Intronic
1096981814 12:55732473-55732495 TGCTTGGTGTGGAGGGACAAGGG - Intergenic
1098016184 12:66107257-66107279 AGGTGGGTGTGAAGAAAAAAAGG + Intergenic
1098527791 12:71506298-71506320 AGGTGTGTGTTGAGGGAGAAGGG - Intronic
1098880613 12:75913687-75913709 GGGAGGGAGTGGAAGGAAAAAGG - Intergenic
1099015481 12:77338922-77338944 GGGTGAGTTTGGAGGGAAAAAGG + Intergenic
1099639017 12:85260606-85260628 CGGTGGAGGTAGAGGGAGAAGGG - Intronic
1100715906 12:97305143-97305165 AGTTGGCTGTAGAGGGAAAAAGG + Intergenic
1101087887 12:101254807-101254829 GGGTGGATGTGGAGAGAACATGG + Intergenic
1101556953 12:105819013-105819035 GGGTGTGTGTGGAAGGAAGATGG + Intergenic
1101700697 12:107170915-107170937 TGGTGAGTTTGGAGGGAAATGGG - Intergenic
1101706612 12:107226376-107226398 TGGTGGGGGTGGGGGGCAAAGGG - Intergenic
1102221680 12:111199052-111199074 GGGTGGGTGCGGAGAGAGAAGGG + Intronic
1102239133 12:111312935-111312957 TGGTGGGGGTGGAGGGAAGCGGG - Intronic
1103879806 12:124157389-124157411 AGGTGGGAGTGGAGGGAACGAGG + Intronic
1104673933 12:130700082-130700104 GGGTGGCTGGGGAGGGAACATGG - Intronic
1104757784 12:131279647-131279669 AGGTGGGGGTGGGTGGAAAATGG - Intergenic
1105225108 13:18424758-18424780 CTTTAGGTGTGGAGGGAAAAGGG - Intergenic
1105259647 13:18769515-18769537 GGGCGGGTGTGGAAGGAAAAGGG - Intergenic
1105260164 13:18773172-18773194 GGTTGGGGGTGGAAGGAAAAGGG - Intergenic
1105262323 13:18788832-18788854 GGGCGGGTGTGGAAGGAAAAGGG - Intergenic
1105262841 13:18792484-18792506 TGGTTGGGGTGGAAGGAAAAGGG - Intergenic
1105544117 13:21339435-21339457 GGGAGGGTGAGGAGGGAAAATGG - Intergenic
1105643520 13:22291072-22291094 CGGAGGCTGAGGTGGGAAAATGG + Intergenic
1106140383 13:27006515-27006537 GGGTGGGGGTGGGGGGAAAGAGG - Intergenic
1107462401 13:40616739-40616761 CAAGGGGTGTGGAGGGAAGAAGG + Intronic
1108282532 13:48874304-48874326 CTCTGGGTGTGGAGGATAAAGGG - Intergenic
1108676340 13:52740154-52740176 GGGTGGGGGTGGGGGGAAGATGG + Intergenic
1109269336 13:60236870-60236892 CGGTGGGTGTGGAGAACAGATGG - Intergenic
1109993846 13:70095816-70095838 TGGGGGGGGTGGAGGGAGAAGGG - Intronic
1111006347 13:82254846-82254868 CGGGAGGTGTGGAGGGAGGAAGG + Intergenic
1111732469 13:92094413-92094435 AGGTGGCTGAGGCGGGAAAATGG + Intronic
1112759696 13:102680473-102680495 AGCTGGGGGTGGAGGGAGAAAGG - Intergenic
1113567105 13:111325692-111325714 CGGTGGGTGTGGAGGGAAAATGG + Intronic
1113595679 13:111530227-111530249 GGGTGGGAGTGGAGGCAGAAAGG + Intergenic
1113741380 13:112714463-112714485 CGGGGAGTGAGGAGGGAGAAAGG - Intronic
1114009216 14:18349126-18349148 CCTTAGGTGTGGAGAGAAAAGGG - Intergenic
1114450066 14:22819610-22819632 AGGTGGGAGAGGAGGGACAATGG - Intronic
1114459681 14:22878480-22878502 TGGTGGGTGTGGAGGGTGGAGGG - Exonic
1114486682 14:23067009-23067031 GGGTGGGGGTGGATGGGAAAGGG - Intronic
1114532221 14:23403210-23403232 CGGAGTGAGTGGAGGGAGAAGGG + Intronic
1114899793 14:27043415-27043437 CTGTGGGTGAAGAAGGAAAAGGG + Intergenic
1115282236 14:31677318-31677340 TGGTGGGGGTGGAGGGAATGGGG - Intronic
1116096412 14:40375710-40375732 CGGTGGGTGTTGAGGGATTGTGG + Intergenic
1117166252 14:53036922-53036944 CTGTGGGTGAGGAGGGCAGAAGG - Intronic
1117297533 14:54393447-54393469 CGGGTGGTGTGGAGGGAGAGCGG + Intergenic
1117658184 14:57977889-57977911 CACTGGGTGTGGAGGAAGAAGGG + Intronic
1117883924 14:60339681-60339703 CGGGAGGTGGGCAGGGAAAAGGG - Intergenic
1118090790 14:62474996-62475018 GGGTAGGTGTGGTTGGAAAAAGG - Intergenic
1118110767 14:62716550-62716572 CAGTGGGTGAGGAGGAAGAAGGG - Intronic
1118157745 14:63257649-63257671 GGGTGGGTGGGGAAGGAATATGG - Intronic
1118306790 14:64661757-64661779 CGCTGTGTGTGGAGGAGAAAGGG + Intergenic
1118678160 14:68211210-68211232 CACTGGGTGGGGAGGGGAAAGGG - Intronic
1119365602 14:74089065-74089087 CCGGGGGTGTGAAGGGGAAAGGG + Intronic
1119601490 14:75979915-75979937 CTGTGTGTGTGGAAGGAAGAGGG - Intronic
1120039197 14:79733134-79733156 AGGTGGGGGTGAAGGGAAGATGG + Intronic
1120646272 14:87078295-87078317 TGGGGGCTGTGGTGGGAAAAAGG - Intergenic
1121243518 14:92446948-92446970 CTGTGGGTGTGGGAGGAAAGGGG - Intronic
1121431074 14:93888846-93888868 GGGTGGGTCTAGGGGGAAAATGG + Intergenic
1122437881 14:101711887-101711909 CGGTGGGTGGGGAGAGATGATGG - Intergenic
1122437893 14:101711927-101711949 CGGTGGGTGGGGAGAGATGACGG - Intergenic
1122437934 14:101712042-101712064 CGGTGGGTGGGGAGAGATGACGG - Intergenic
1122437940 14:101712062-101712084 CGGTGGGTGGGGAGAGATGACGG - Intergenic
1122437977 14:101712198-101712220 CGGTGGGTGGGGAGAGATGATGG - Intergenic
1122437988 14:101712238-101712260 CGGTGGGTGGGGAGAGATGACGG - Intergenic
1122437999 14:101712278-101712300 CGGTGGGTGGGGAGAGATGACGG - Intergenic
1122438118 14:101712710-101712732 CGGTGGGTGGGGAGAGATGACGG - Intergenic
1122438158 14:101712846-101712868 CGGTGGGTGGGGAGAGATGACGG - Intergenic
1122438302 14:101713382-101713404 CGGTGGGTGGGGAGAGATGACGG - Intergenic
1122438313 14:101713422-101713444 CGGTGGGTGGGGAGAGATGACGG - Intergenic
1122606074 14:102948287-102948309 GGGTGGGTGTGGAGGTGAGACGG + Intronic
1122606166 14:102948499-102948521 TGGTGGGTGTGGAGGTGAGAGGG + Intronic
1122606250 14:102948707-102948729 GGGTGGGTGTGGAGGTGAGAGGG + Intronic
1122898161 14:104770692-104770714 CTCTGAGTGTGGAGAGAAAAGGG + Intronic
1123103235 14:105819651-105819673 CCGTGGGTGGGGAGGGCAAATGG + Intergenic
1123392409 15:19889729-19889751 CCTTAGGTGTGGAGAGAAAAGGG - Intergenic
1123457028 15:20435633-20435655 TGGTGGGTGGGGAGGGAAAAAGG - Intergenic
1123661034 15:22564726-22564748 TGGTGGGTGGGGAGGGAAAAAGG + Intergenic
1123724159 15:23085562-23085584 CGCTGGATGTGGAAGGAAAGGGG + Intergenic
1124034518 15:26042455-26042477 AGGTGGGTGTGGTGGGTATAGGG + Intergenic
1124263182 15:28210786-28210808 TGGTGGGTGGGGAGGGAAAAAGG - Intronic
1124273868 15:28309510-28309532 CGGTGCGGGGGGATGGAAAAAGG - Intronic
1124314835 15:28658960-28658982 TGGTGGGTGGGGAGGGAAAAAGG + Intergenic
1125196957 15:37058141-37058163 AGGTGGGTGTGGGGGGAGTAGGG - Intronic
1125312887 15:38399876-38399898 GGGTGGGGGTGGCGGGAAATGGG - Intergenic
1125437698 15:39665069-39665091 CGATGGGAGTGGTGGGAGAAGGG - Intronic
1125796788 15:42409286-42409308 CTGTGGCTGTGGAGGCACAAAGG - Exonic
1126464615 15:48950609-48950631 CAGTGGGGATGGAGGGAAATGGG + Intronic
1126783105 15:52155184-52155206 AGGTAGGTGAGGAGGGAAGAGGG + Intronic
1126873732 15:53016154-53016176 GGGAAGGTGGGGAGGGAAAAGGG - Intergenic
1127568082 15:60213167-60213189 GGGTGGGGGTGGAGGGCAAGGGG + Intergenic
1129245682 15:74277403-74277425 CGGTGGGCGTGGAGGGGCCATGG + Intronic
1129758225 15:78111499-78111521 GGGTGGGTGTGGTGGAAATAGGG - Intronic
1130877588 15:88028039-88028061 GTGAGGGTGAGGAGGGAAAATGG + Intronic
1130993170 15:88888912-88888934 TGGTGGGTGTGTGGGGCAAATGG - Intronic
1131097138 15:89663329-89663351 TGGGGGGTGGGGAGGGAAGATGG - Intergenic
1131399111 15:92110466-92110488 AGGTGGGCGTGGAGGGAACAGGG - Intronic
1131470907 15:92696048-92696070 CAGTGGGTTTTGAGGGAAAAGGG + Intronic
1132279698 15:100602487-100602509 GGGTGGGGGTGGAGGGAGTAGGG - Intronic
1132436772 15:101812306-101812328 AGGTGGTTGTGGTGGGGAAATGG + Intronic
1132496717 16:266829-266851 GGGTGGGGCTGGAGGGAGAAGGG + Intronic
1132763189 16:1520932-1520954 GGGTGGGTATGGAGGGGACAAGG + Intronic
1132889032 16:2195359-2195381 CTGTGGGGGTGGAGGGAGGAGGG + Intronic
1133362288 16:5183999-5184021 CAGTGGGTGTGGTGTGACAATGG + Intergenic
1134122781 16:11596656-11596678 GGGAGGATGTGGAGGGAAAAAGG + Intronic
1134684535 16:16149445-16149467 TGATGGGTGTGGTCGGAAAATGG + Exonic
1134687430 16:16168616-16168638 GGGTGGGTGTGGTTGCAAAAGGG + Intronic
1135243783 16:20836063-20836085 GGGTGGGTGTGGGGGTAAATGGG - Intronic
1135603064 16:23799838-23799860 CGGTGAGATTGGAGGGAAAGGGG - Intergenic
1136590159 16:31213836-31213858 AGGTGGGAGTGGGGGGAGAAAGG + Intergenic
1136632164 16:31495333-31495355 CTGTGGGTGTGGCAGGAAACTGG + Intronic
1137580253 16:49629421-49629443 CTGTGGGTGTGGGTGGAAAGAGG - Intronic
1138468015 16:57207966-57207988 CTGGAGGTGTGGAGGTAAAAAGG - Intronic
1139752593 16:69118828-69118850 AGGTGGTCCTGGAGGGAAAATGG + Exonic
1139758645 16:69166254-69166276 AGGTGGGGGTGGAAGGAACATGG + Intronic
1140039254 16:71394821-71394843 CGGTGGATGTGGAGGGGCACGGG + Intergenic
1141852029 16:86652990-86653012 CAGAGGGTCTGGAGGGAAGAAGG - Intergenic
1143130999 17:4676811-4676833 CCCTGGATGTGGAGGAAAAAAGG + Exonic
1143166110 17:4897974-4897996 GGGTGGGGGGGGAGGGAGAAGGG - Exonic
1143875722 17:9989214-9989236 CGGTGAGTGTGGCCAGAAAATGG - Intronic
1144059994 17:11574760-11574782 CAGTGGGATTGGAGGGAAGATGG + Intergenic
1144190183 17:12838556-12838578 CGGTGGCAGTGGAGGGAATCAGG + Intronic
1144577325 17:16437295-16437317 GGGTGGGTGTGGAAAGCAAAGGG - Intergenic
1144585866 17:16487307-16487329 AGGTGGAGGTGGAAGGAAAAAGG + Intronic
1144758898 17:17695959-17695981 CCCTGGGTGAGGAGGGAGAAAGG - Intronic
1145782154 17:27570485-27570507 TGGTGGGTGTGGAGGAATAGAGG - Intronic
1146329497 17:31916369-31916391 CGGAGGCTGTGGAGGGAGAATGG - Intergenic
1146803390 17:35845009-35845031 AGGTGGCTATGGAGGCAAAATGG + Exonic
1147182211 17:38693567-38693589 CGGTGGGTGTGGGGTGGGAAGGG + Intergenic
1147401210 17:40180974-40180996 ACGGGGGTGTGGAGGGGAAAGGG + Intronic
1147613330 17:41813770-41813792 CGGCTGGTGGGCAGGGAAAAAGG + Intronic
1148205139 17:45775252-45775274 GGGTGGATGTGGAGGGGAATGGG + Intergenic
1148261433 17:46187104-46187126 CAGAGGGTGTGAAGGGAAAGAGG - Intronic
1148458990 17:47826987-47827009 TGGTGGGGGTGGGGGGAAGATGG + Intronic
1148555927 17:48578536-48578558 GGGTGGGTGGGGAGGGGGAAGGG - Exonic
1150563743 17:66319119-66319141 GGGTGGGGGTGGAGGGGACAGGG - Intronic
1150573172 17:66405934-66405956 TGGTTGGTGTGGAGGAAAAATGG + Intronic
1151104188 17:71593292-71593314 GTGTGTGTGTGGAGGGAATAGGG + Intergenic
1151381296 17:73727471-73727493 GGGTGTGTGTGGAGGAGAAAGGG + Intergenic
1151580466 17:74974779-74974801 GAGCGGGTGTGGAGGGAAAGAGG + Intergenic
1152231778 17:79117522-79117544 GTGTGGGTGTGGAGGGAAGCGGG - Intronic
1152992129 18:373278-373300 CGGTCACTGTGGAGGAAAAAAGG - Intronic
1153314687 18:3710356-3710378 AGCTGGGTGTGGAGGAGAAAGGG - Intronic
1154425863 18:14271628-14271650 GGTTGGGGGTGGAAGGAAAAGGG + Intergenic
1154426382 18:14275297-14275319 GGCTGGGGGTGGAAGGAAAAGGG + Intergenic
1154433552 18:14326870-14326892 GGTTGGGGGTGGAAGGAAAAGGG + Intergenic
1154528259 18:15314764-15314786 CTTTAGATGTGGAGGGAAAAGGG + Intergenic
1155241780 18:23870820-23870842 CAGGGGCTGGGGAGGGAAAAAGG + Intronic
1155788088 18:29927281-29927303 TTGTGGGTTTGGAGAGAAAAAGG + Intergenic
1155947184 18:31868106-31868128 CAGTGGGAGAGAAGGGAAAAAGG + Intronic
1156504749 18:37582717-37582739 TGATGGGGATGGAGGGAAAATGG - Intergenic
1157082021 18:44535704-44535726 AGGTGGGTTTTGAGGGAAAGAGG + Intergenic
1157555265 18:48609330-48609352 AGGTGGGCCTTGAGGGAAAAGGG + Intronic
1157565783 18:48678392-48678414 AGGTGGCTGGGGAGGGAAAGGGG - Intronic
1157620819 18:49016678-49016700 CGGGGTCTGAGGAGGGAAAAGGG + Intergenic
1158403938 18:57144778-57144800 GGGTGGGTGTGGTGGGGGAATGG + Intergenic
1159060099 18:63505715-63505737 GGGTGGGTTTAGAGTGAAAAGGG - Intergenic
1160066632 18:75581495-75581517 CGGTGGGTGTGGGGAGAGAAAGG - Intergenic
1160136969 18:76280567-76280589 GGGTGGGTGTGGAGGGACGTGGG - Intergenic
1160242650 18:77133952-77133974 CTGAAGGTGAGGAGGGAAAAGGG + Intergenic
1161237290 19:3204380-3204402 CAGTGGGTAAGGAGGGACAAGGG - Intronic
1161840524 19:6677614-6677636 CGGTGAGTGTGCAGGTGAAATGG + Intergenic
1162068234 19:8138363-8138385 CTGTGGGTGAGGAGGGGACAGGG - Intronic
1163034373 19:14562731-14562753 CCCTGGGTGTGGCGGGGAAATGG + Intronic
1163241567 19:16067042-16067064 CGGTGGGGGAGGGGGGAAACGGG + Intronic
1163283925 19:16334424-16334446 CAGTGGCTGGGGAGGGAGAATGG - Intergenic
1163480551 19:17553583-17553605 AGGTGGGGTTGGAGGGAAATAGG - Exonic
1163492213 19:17623572-17623594 CGGTGGGGGAGGGGGGAATAAGG + Intronic
1163577935 19:18121668-18121690 CGGCAGCTGTGGGGGGAAAAGGG - Exonic
1164450284 19:28356239-28356261 AGGTTGGGGTGGAGGGGAAATGG + Intergenic
1164471827 19:28542675-28542697 CGGTGAGGGTGTAGGGGAAATGG - Intergenic
1165089105 19:33373538-33373560 CGGCGGGTGTGGCGGGAGCAGGG - Exonic
1165762527 19:38329995-38330017 TGGTGGGTGTGTGGGGCAAAAGG + Intergenic
1166151757 19:40880245-40880267 CTGCGGGTGTGGAGGGAGAAGGG + Intronic
1166387655 19:42391140-42391162 TGATGGGTGGGGAGAGAAAAAGG + Intergenic
1167744179 19:51341145-51341167 CGGTGGGTGTGTATGGTAAGTGG - Exonic
1167867870 19:52342984-52343006 GGGTGGGTGGAGAGGGAAAATGG - Intronic
1167874592 19:52401121-52401143 GGGTGGGTGAAGAGGGAAAATGG - Intronic
925363382 2:3295050-3295072 AGGTGTGTGTGGAGAGAGAATGG - Intronic
925718670 2:6807859-6807881 CTGGGGGTGTGGAGGTAAAGGGG - Intergenic
925822880 2:7817832-7817854 CGGTGGGAGGGGAGGACAAAGGG + Intergenic
926051101 2:9745269-9745291 CAGTGGGTGTGGGGAGGAAAGGG - Intergenic
926437423 2:12852342-12852364 CGATGGGTGTGGAGGGGGACGGG + Intergenic
926641705 2:15244610-15244632 GGGTGGGTGTGGGGGAAACAGGG + Intronic
927500470 2:23579577-23579599 AAGTGGGACTGGAGGGAAAAGGG - Intronic
928078112 2:28283673-28283695 AGGTAGGTGTGGAGGGAACCAGG + Intronic
929643499 2:43604903-43604925 TGGTGTGTGTGGAAGGAAGAGGG - Intergenic
931092053 2:58896704-58896726 GTGTGGGTGTGGAGGGAAATGGG - Intergenic
931223141 2:60306306-60306328 GGGTGGGAGTGGAGGGAGGAAGG - Intergenic
931268694 2:60683112-60683134 CGGTGGATGTCGGGGGAACAGGG + Intergenic
931348089 2:61465193-61465215 GGGTGGGTGTGGTGGGGCAAGGG + Intronic
932022724 2:68104053-68104075 AGGTGGGAGTGGAAGGAAGAAGG + Intronic
932336663 2:70935684-70935706 TGGAGGATGTGGAGGGAGAAGGG - Intergenic
933771706 2:85748827-85748849 GGGAGAGTGGGGAGGGAAAAAGG - Intergenic
934492490 2:94771118-94771140 GGGTTGGGGTGGAAGGAAAAGGG - Intergenic
934494382 2:94784520-94784542 GGGTGGGTGTGGACGGAAAAAGG - Intergenic
934930587 2:98419337-98419359 CCTTGGGTGTGGAGGGAAGAGGG - Intergenic
935685871 2:105682050-105682072 CGGAGAGAGTGGAGGGAAACAGG + Intergenic
936073956 2:109389953-109389975 AGGTGGGTGAGGAGGAACAAGGG - Intronic
936232111 2:110712161-110712183 AGCAGGGTGAGGAGGGAAAATGG - Intergenic
937239888 2:120453218-120453240 GGGTGGGAGTGGAGGGCGAAGGG - Intergenic
937721812 2:125107157-125107179 GGGTGGGGGTGAATGGAAAATGG - Intergenic
937982098 2:127621958-127621980 TGGTGGGTGAGGAGGGGAGAAGG - Intronic
938527363 2:132146227-132146249 CCTTAGGTGTGGAGGGAAAAGGG + Intergenic
938663848 2:133513501-133513523 GAGTGGATCTGGAGGGAAAATGG + Intronic
939083806 2:137693293-137693315 GAGTGGGTCTAGAGGGAAAAAGG - Intergenic
939110360 2:137999403-137999425 TGGTGTGTGTGGAGGGAAGGAGG - Intronic
940195281 2:151087778-151087800 TGGTGGGTGTGGGAGGAAATAGG - Intergenic
940677811 2:156746560-156746582 TTCTGGGTGTGGAGGGAAAATGG - Intergenic
940855067 2:158723309-158723331 CTGTGGGGGTGGAGGACAAATGG - Intergenic
941673800 2:168322601-168322623 AGGTGGGTGGGGAGGGTGAAAGG + Intergenic
942100509 2:172577715-172577737 GGATGGGTGGGGAGGGGAAAAGG - Intronic
942865326 2:180666668-180666690 TGGTGGGAGTGGGGAGAAAAGGG + Intergenic
943218293 2:185068561-185068583 AGGTGAGAGTGAAGGGAAAATGG + Intergenic
944183671 2:196925639-196925661 CGGTAGGGGTGGAGAGAGAAGGG + Intronic
944604951 2:201344404-201344426 GGGTGGGGGTGGAGGGATAGGGG + Intronic
944661095 2:201922622-201922644 CGGTGGTTGTGGAGGGGAGTGGG - Intergenic
945257270 2:207813182-207813204 GGGTGGGGGTGGGGGGAGAAGGG - Intergenic
945282874 2:208052867-208052889 GGGTGGGACTAGAGGGAAAATGG - Intergenic
946884780 2:224211988-224212010 GGGTGGGAGTGGAGGGAGGAGGG - Intergenic
946948086 2:224843068-224843090 GGGTGGGGGTGGCGGGGAAAGGG + Intronic
947647402 2:231753444-231753466 CGGAGGGTGAGGCGGGAGAATGG + Intronic
947866341 2:233400411-233400433 CACTGGGTGTGAAGGGCAAAGGG - Intronic
947926512 2:233926435-233926457 GGGAGAGGGTGGAGGGAAAACGG + Intronic
1168741247 20:193270-193292 AGGTGGGTATGGAGCGACAATGG + Intergenic
1168842198 20:916766-916788 GGATGGGGGTGGAGGGAAAGAGG - Intergenic
1169165759 20:3422165-3422187 CTGAGGGAGTGGAGGGACAATGG + Intergenic
1169347188 20:4838113-4838135 CAGTGGATGTGGAGAGACAAGGG + Intergenic
1169915670 20:10680828-10680850 GGGTGGGTGAGGAAGGTAAATGG - Intergenic
1170316289 20:15044470-15044492 GAGTGGGTCTGGAGGGCAAATGG - Intronic
1170820393 20:19752551-19752573 GGGTTGGTGTGGAGAGAGAATGG + Intergenic
1170827862 20:19811521-19811543 CAGTGGGTGTGGAGGGGACAAGG + Intergenic
1170956914 20:20989532-20989554 CGGTGGTTTTGGGGGGAAAGAGG + Intergenic
1171446937 20:25211529-25211551 CCGTGGGTGTGAAGTAAAAATGG - Intronic
1171883298 20:30633329-30633351 GGGTTGGGGTGGAAGGAAAAGGG - Intergenic
1173075577 20:39815868-39815890 GAGTTGGTGTGGAGGGAAGAAGG - Intergenic
1173672075 20:44805814-44805836 CTGGGGGTGTGGAGAGAAATCGG + Intronic
1174190740 20:48738671-48738693 CTGTGGGTTTGGGGGGAGAAGGG + Intronic
1174876048 20:54227435-54227457 TGGTTGGTGTGGAGAGCAAAGGG - Intronic
1175493797 20:59398463-59398485 GAGGGGGTGTGGGGGGAAAAGGG - Intergenic
1175541443 20:59750596-59750618 CGGTGTGTGGGCAGGGAAGACGG - Intronic
1175934862 20:62509903-62509925 GGGTGGGCGTGGAGGGCGAAGGG - Intergenic
1175958463 20:62623191-62623213 CGGAGGCTGTGGAGGGAGGACGG - Intergenic
1176142116 20:63549297-63549319 CGGTGGGTGTGGGGAGGAGACGG - Intronic
1176210804 20:63920361-63920383 TGGTGGGTGTGGTGGGGGAAGGG + Intronic
1176769160 21:13053776-13053798 CTTTAGGTGTGGACGGAAAAGGG - Intergenic
1176846164 21:13878201-13878223 AGGTTGGGGTGGAAGGAAAAGGG - Intergenic
1177731540 21:25033719-25033741 CGTTTAGTGTGGAGGAAAAATGG - Intergenic
1177844047 21:26268095-26268117 AGGTGGATGGGGAGGGCAAAAGG + Intergenic
1178232798 21:30806155-30806177 CGATGGGTGAGGAGGAAAGAAGG + Intergenic
1180119408 21:45736874-45736896 CAGTGGCTGTGGAGGAAACAGGG + Intronic
1180233824 21:46444266-46444288 CTCTGGGTGGAGAGGGAAAAGGG + Intronic
1180433717 22:15279936-15279958 CCTTAGGTGTGGAGAGAAAAGGG - Intergenic
1181022887 22:20112789-20112811 CAGAGGCTGTGGGGGGAAAAGGG + Exonic
1181795031 22:25301830-25301852 CTCTGGGAGCGGAGGGAAAAAGG + Intergenic
1181835602 22:25605497-25605519 CTCTGAGAGTGGAGGGAAAAAGG + Intronic
1181893186 22:26082929-26082951 AGATGGGAGTGGAGGGCAAATGG - Intergenic
1182081412 22:27531698-27531720 AGCTGGGAGTGGAGGGAAAAGGG + Intergenic
1182183144 22:28372491-28372513 AGGGAGGTGCGGAGGGAAAATGG - Intronic
1183104687 22:35607449-35607471 GGGAGGGTGAGGAGAGAAAATGG + Intronic
1183473222 22:38020795-38020817 GGGTGGAGGTGGAGGGGAAAAGG - Intronic
1184096712 22:42320016-42320038 TGGTGGGAATGGAGGGAAGATGG - Intronic
1184341768 22:43890074-43890096 CTGTGGGTGTGCAGGGAAGGAGG + Intronic
1184557239 22:45240136-45240158 CGGTGGGTGCGGAAAGACAAAGG + Intronic
1184924165 22:47625835-47625857 TGGTGGGTATGGAGGGACAAGGG - Intergenic
1184959466 22:47918563-47918585 CTGTGGGTGTGGAGGGAGTCTGG - Intergenic
1184970901 22:48019169-48019191 AGGTGGGTTTGGGGTGAAAAGGG + Intergenic
1185056358 22:48580657-48580679 CGGTGTGTGTGGAAGGAGGAGGG + Intronic
949676677 3:6462668-6462690 CTGTGTGTGTGTAGGGAACATGG - Intergenic
949729488 3:7092111-7092133 CGGAGGTTGAGGAGGGAGAATGG - Intronic
950112276 3:10426869-10426891 GGGTGGGGGTGGGGGGAAGATGG + Intronic
950483857 3:13261284-13261306 CGGTCGATGTGGAGGGACAAAGG + Intergenic
950729964 3:14948139-14948161 GGGTGGGGGTGGAGGGGGAATGG + Intronic
952555557 3:34526039-34526061 CAGTGGCTGTGGAGGGAGAGAGG - Intergenic
953241715 3:41155422-41155444 CTCGGGGTGTGCAGGGAAAAGGG + Intergenic
953759297 3:45674253-45674275 CGTGGGGTGGGGAGGGAAGAGGG - Intronic
954466501 3:50658266-50658288 AGGTGGGTTTGGAAGGAAGATGG + Intergenic
955873027 3:63459932-63459954 CGGAAATTGTGGAGGGAAAATGG - Intronic
956732817 3:72212355-72212377 GGGTTGATGTGGAGGTAAAAGGG + Intergenic
957036379 3:75297049-75297071 CTGTGAGTGTGGAGGGAAGAAGG - Intergenic
957068897 3:75550062-75550084 TGGTGGTGGTGGTGGGAAAATGG - Intergenic
959424259 3:106166773-106166795 TGGTGGGGGTGCAGTGAAAATGG + Intergenic
959900622 3:111657500-111657522 GGGTGGGGGTGGTGGGAACAAGG + Intronic
960045521 3:113193602-113193624 AGGTGGGTGGGGAGGAGAAAAGG + Intergenic
960378538 3:116932411-116932433 GGGTGGGTGGGAAGGGAGAATGG - Intronic
960444350 3:117729577-117729599 TGGGGGTTGTTGAGGGAAAAGGG - Intergenic
961284512 3:125790265-125790287 CGGTGGTGGTGGTGGGAAACTGG + Intergenic
961640309 3:128360728-128360750 GGGTGGGAGTGGAGGGAGGAGGG + Intronic
962750205 3:138429245-138429267 TGGAGGGTGTGGAGGGGAATGGG + Intergenic
962902229 3:139771568-139771590 GGGTGGCTGTGCAGGCAAAATGG + Intergenic
964140223 3:153390039-153390061 TAGTGGGTGTAGGGGGAAAAGGG - Intergenic
964323534 3:155523077-155523099 CGGAGGCTGAGGCGGGAAAATGG - Intronic
964411027 3:156398228-156398250 CTGTCGGGGTGGTGGGAAAAGGG + Intronic
964570932 3:158106541-158106563 CGGGGGTTGGGGAGGGGAAAAGG + Intronic
966386170 3:179401038-179401060 AAGTGGGGGTGGAGGAAAAAAGG - Exonic
966917435 3:184592889-184592911 AGGCGGGTGTGGAAGGAGAAGGG - Intronic
967651076 3:191987994-191988016 AGGTGGGGGTGGAGGGAGTAGGG - Intergenic
968052221 3:195662975-195662997 GGGTGGGTGGGGAGGGTAGATGG - Intergenic
968103589 3:195985363-195985385 GGGTGGGTGGGGAGGGTAGATGG + Intergenic
968301891 3:197622956-197622978 GGGTGGGTGGGGAGGGTAGATGG + Intergenic
969368938 4:6718845-6718867 AGGAGGCTGTGGCGGGAAAATGG + Intergenic
969591481 4:8124418-8124440 CAGGGGCTGCGGAGGGAAAACGG - Intronic
969627011 4:8310804-8310826 AGGTGGGGGTGGGAGGAAAATGG + Intergenic
970204906 4:13645951-13645973 CAGTAGGTGTGGAGGGAGAGAGG + Intergenic
971021765 4:22544208-22544230 TGGTGGGAGTGGAGAGGAAATGG + Intergenic
971213255 4:24640174-24640196 TGAAGGGTGTGGAGGGATAATGG - Intergenic
974036400 4:56821788-56821810 CGGTAGGTGGCGAGGGAAGAGGG + Intergenic
975094967 4:70447062-70447084 GGGTGGGTGGGCAGGGAAGAGGG + Intronic
975355349 4:73396106-73396128 TGGGGGTTGTGGAGGGAAATTGG + Intergenic
975999105 4:80350778-80350800 TGTTGGGGGTGGAGGGAAAGGGG + Intronic
977037164 4:91969054-91969076 CAGTAGGGGTGGGGGGAAAACGG - Intergenic
977411247 4:96668044-96668066 CAGTGGGTGTGTTGGGAAATGGG + Intergenic
977592623 4:98843111-98843133 TGGTGGGGGCGGGGGGAAAAAGG - Intergenic
980078425 4:128318763-128318785 CTGTGCATGTGGTGGGAAAAGGG + Intergenic
981342496 4:143637906-143637928 TGGTGGGTGGGGAGAGAAGAAGG + Intronic
981566326 4:146105312-146105334 GGGTGGGTGTGGATGGAGACAGG - Intergenic
981616122 4:146646804-146646826 TGGTGGGAGTGGAGGGAGAGAGG - Intergenic
982816632 4:159893933-159893955 CGGTGAGGTTGGAGGGCAAAAGG + Intergenic
984541188 4:181039621-181039643 CAGGGGGTGGGGAGGGATAAGGG - Intergenic
985271266 4:188197004-188197026 AGGTGGGTGGGGAGGGGGAAGGG - Intergenic
985271302 4:188197124-188197146 AGGTGGGTGGGGAGTGAGAAGGG - Intergenic
985271350 4:188197304-188197326 AGGTGGGTGGGGAGTGAGAAGGG - Intergenic
985271397 4:188197484-188197506 AGGTGGGTGGGGAGTGAGAAGGG - Intergenic
985271411 4:188197544-188197566 AGGTGGGTGGGGAGTGAGAAGGG - Intergenic
985271425 4:188197604-188197626 AGGTGGGTGGGGAGGGGGAAGGG - Intergenic
985374955 4:189325273-189325295 TGGTGGGGGTGTAGAGAAAAGGG - Intergenic
985643614 5:1074869-1074891 CTGTGGCTGTGGAGGGAACGAGG + Intronic
985703269 5:1386273-1386295 CGGCGGGTGTGGGGGGCACAAGG - Intergenic
985794256 5:1950236-1950258 CTCTCGGTGTGGAGGGAAGAGGG + Intergenic
987216900 5:15747056-15747078 GAATGAGTGTGGAGGGAAAAGGG + Intronic
988034790 5:25813288-25813310 CTGTGGGGGTGGAGGAAATAGGG - Intergenic
989124876 5:38042758-38042780 CAGTGTGTTTGTAGGGAAAACGG - Intergenic
990511668 5:56494584-56494606 CGGAGGGAGTGGGGGAAAAAAGG + Intergenic
991524280 5:67539159-67539181 GGGTGATTGTGGAGGGCAAAAGG + Intergenic
991530148 5:67605716-67605738 GGGTGGGAGTGGAGGGACAGAGG - Intergenic
991620724 5:68542992-68543014 AGGTGGGTGTGGGGGGAGAAAGG + Intergenic
992136185 5:73748762-73748784 CTGTGGGAGTGGCGGGGAAATGG - Intronic
994934700 5:106239111-106239133 GGATGGGAGGGGAGGGAAAAGGG + Intergenic
995531442 5:113095622-113095644 CGGGGGCTGAGGTGGGAAAATGG - Intronic
995947970 5:117672906-117672928 CTTTGGCTGTGAAGGGAAAAGGG - Intergenic
996174073 5:120332995-120333017 TGGTGGGTGGGGAGGGTTAATGG - Intergenic
996185305 5:120465768-120465790 CGGTGGCTGCAGCGGGAAAAGGG + Intronic
997603523 5:135156555-135156577 GGATGGGTCTGGAGGGAACAAGG + Intronic
997689739 5:135819585-135819607 GGATGGGAATGGAGGGAAAATGG + Intergenic
998097352 5:139403783-139403805 CGGTAGGGGTGGAGCCAAAAAGG - Intronic
998103297 5:139451803-139451825 GGGTGGGTGTGTAGGGTATAGGG + Intronic
998170267 5:139868636-139868658 CGGGAGGTGGGGTGGGAAAAGGG - Intronic
999480627 5:151944943-151944965 TGGTGGGTGGGGAGTGGAAAGGG - Intergenic
999827788 5:155290640-155290662 GGTTGGGGGTGGAGGGGAAATGG + Intergenic
1000043448 5:157502255-157502277 CAGTGAGTGTGGAGGGTACACGG - Intronic
1000593555 5:163187147-163187169 AGGTGGTTGTGGAGGCAAAGAGG + Intergenic
1001665044 5:173425660-173425682 CGGTGGGTGTGGAGATGAAGAGG + Intergenic
1002190749 5:177476201-177476223 AGGTGGGGGTGGAGGGAGGAGGG - Intergenic
1002297032 5:178237531-178237553 TGCTGGGTGGGGAGGGAAAAGGG - Intergenic
1002466857 5:179412461-179412483 CGGTGGGGGGGGAGGGAGGAAGG - Intergenic
1003579284 6:7325080-7325102 CTGTGGGAGTGGAGAGAGAAGGG - Intronic
1003727178 6:8778058-8778080 TGGTGAATGTGGAGAGAAAATGG - Intergenic
1004382306 6:15143131-15143153 GGGATGGTGAGGAGGGAAAAGGG - Intergenic
1005635991 6:27753526-27753548 AGGTGGGGGTGGAGGGAAAGGGG - Intergenic
1005685072 6:28246189-28246211 AACTGGGAGTGGAGGGAAAATGG + Intronic
1006276503 6:33008681-33008703 AGGTGGGTGTGAGGGGAAACAGG + Intronic
1007285545 6:40744822-40744844 CTGGGGGTGGGGAGAGAAAAAGG - Intergenic
1008132325 6:47733103-47733125 CAGGGGGTGTAGAGGGAAAAAGG - Intergenic
1009710641 6:67314069-67314091 CGGTGGCTGAGGCGGGAGAATGG - Intergenic
1012500329 6:99881213-99881235 CGGTGTATATGGAGGAAAAATGG + Intergenic
1012938043 6:105388487-105388509 GGGTGGGGGTGGGGAGAAAAGGG + Intronic
1013773162 6:113650028-113650050 TGGTTGGTCTGGAGGAAAAAGGG - Intergenic
1014104817 6:117549710-117549732 TGGTTAGTGTGGAGGGGAAATGG + Intronic
1016174462 6:141062211-141062233 AGGTGGGGGTGGGGGGAAGATGG + Intergenic
1016581598 6:145634366-145634388 AGGTAGATGTGGAGGGAGAAAGG - Intronic
1018677514 6:166235858-166235880 GGGTGGCTGTGGAAGGAGAACGG + Intergenic
1019576282 7:1739197-1739219 CTCTGGCTGTGGAGGGAGAATGG + Intronic
1019747974 7:2711149-2711171 CTGAGGCTGTGGAGGGAAGAGGG + Intronic
1019890290 7:3941021-3941043 TGGTGGGTCAGGAGGGAGAAGGG - Intronic
1020654992 7:10918319-10918341 CGGAGGGAGTGGAGAGGAAAGGG - Intergenic
1021309694 7:19078588-19078610 CTGTGGGTGTGTAGGGAGAGGGG + Intronic
1021424547 7:20485079-20485101 AGGTGGGGATGGAGAGAAAAGGG + Intergenic
1022659100 7:32349398-32349420 GGGAGAGTGTGGAGGGAAATGGG + Intergenic
1023022809 7:36026003-36026025 AGGTGGGTGTGGATGGGGAAGGG - Intergenic
1023105445 7:36759432-36759454 TTGTAGCTGTGGAGGGAAAAGGG - Intergenic
1023736697 7:43241914-43241936 TGGGGGGTGTGGAGGAAGAAGGG + Intronic
1023862998 7:44226797-44226819 GGGGGGGTGTGGGGGGAAGATGG + Intronic
1024178376 7:46863462-46863484 GAGTGTGTGTGGGGGGAAAATGG - Intergenic
1024189428 7:46990672-46990694 CAGGGGCTGGGGAGGGAAAATGG + Intergenic
1026368546 7:69674625-69674647 GGGTGGGTGGGTAGGGAATAAGG + Intronic
1027854002 7:83485753-83485775 GGGTGCATGTGGAGGGAAATAGG + Intronic
1028855617 7:95589273-95589295 CTGTGGGGGTGGAGGTAACAAGG + Intronic
1029574664 7:101395558-101395580 CAGCGGGGCTGGAGGGAAAATGG + Intronic
1031910904 7:127515865-127515887 AGGCAGGTGTGGAGGGGAAAGGG - Intergenic
1032308043 7:130755173-130755195 AGGTGGGAATGGAGGGGAAATGG - Intergenic
1032430071 7:131853714-131853736 GGGTGGGTGTGAAGAGACAAAGG + Intergenic
1034429125 7:151032156-151032178 AGGTGGGGGTGGAGTGTAAAGGG - Intronic
1034459613 7:151191280-151191302 CTGCAGGTGTGGAGGGAAGAGGG - Intronic
1034470592 7:151252345-151252367 TGCTGGGGGTGTAGGGAAAAGGG - Intronic
1034885289 7:154794213-154794235 CTGTGGGGGTGGAGGGGAGACGG + Intronic
1035975830 8:4310301-4310323 GGGTGGGTGTGGAAGGGAAAAGG + Intronic
1036432153 8:8701838-8701860 CGGTGGGCGGGGAGGGAAAGAGG - Intergenic
1036988193 8:13560764-13560786 CTGTGGGGGGGGAGGGAAAAAGG + Intergenic
1037510468 8:19576994-19577016 AGGTGGGTGTGGAGGGCGAGAGG - Intronic
1037659783 8:20916616-20916638 CAGTGGGTATGGGGGGAAACTGG + Intergenic
1038012672 8:23487254-23487276 AGGAGGGTGTGGGAGGAAAAGGG + Intergenic
1038307926 8:26421347-26421369 GGGAGGGGGTGGAGAGAAAAAGG + Intronic
1038311587 8:26449584-26449606 GACTGGGTGTGGAGAGAAAACGG + Intronic
1038691192 8:29765035-29765057 CAGTGGGTGTGAAGGGGAAAGGG - Intergenic
1038914390 8:32004245-32004267 CAGTGGATGGGGAGGGAAATGGG + Intronic
1039435356 8:37556171-37556193 GTGTGGGTGTGGAGGGGAAGGGG - Intergenic
1039542128 8:38381566-38381588 TGGGGGGTGTGGAGGGAATTGGG - Intronic
1040011019 8:42661301-42661323 AGGTGGGGGAGGAGGGAGAATGG - Intergenic
1040102687 8:43519423-43519445 GGGTGGGGGTGCAAGGAAAAAGG + Intergenic
1041782170 8:61589087-61589109 CAGAGGCTGTGGTGGGAAAAGGG + Intronic
1042085747 8:65106772-65106794 AGGTGATTGTTGAGGGAAAAAGG + Intergenic
1042713718 8:71748054-71748076 TGGGGAGGGTGGAGGGAAAATGG - Intergenic
1044441607 8:92230776-92230798 AGGGGGGTGTGGAGGGAGAGGGG + Intergenic
1044602050 8:94015092-94015114 CAGAGGGTGTGGATGGAAAAAGG - Intergenic
1044686430 8:94830318-94830340 GGCTGGGTGAGGAGAGAAAAAGG + Intronic
1044692313 8:94893850-94893872 GGGTGGGTTTGGGGGAAAAATGG - Intronic
1044794268 8:95880443-95880465 AGGTGGGTGTGGTGGGGATAAGG + Intergenic
1045084980 8:98672250-98672272 CGGTGGGTGTGGGGGGTTAGGGG + Intronic
1046562429 8:115854890-115854912 ATGTGGATGTGGAGGCAAAAGGG - Intergenic
1047096984 8:121636440-121636462 CAGTGGGACTGGAGAGAAAAAGG - Intronic
1047157536 8:122337594-122337616 CGGTGGGTGGTGGGGGAAGATGG + Intergenic
1047191645 8:122683649-122683671 GGGGGAGTATGGAGGGAAAATGG + Intergenic
1047676633 8:127209562-127209584 GGGAGGGTGGGGAGGGAAGATGG + Intergenic
1048867835 8:138773703-138773725 CTGTGGGTGCTGAGGGAAGACGG + Intronic
1049030864 8:140036427-140036449 CGCTGAGTGGGAAGGGAAAAGGG + Intronic
1049281977 8:141754114-141754136 CTGTGGGTGAGGCGGGAGAATGG - Intergenic
1049720763 8:144114496-144114518 CGGTGGGCGGGGAGGAAAACTGG - Intronic
1049939579 9:532528-532550 TGGAGGGAGTGGAGGGAAATGGG - Intronic
1051765252 9:20515578-20515600 CGGTGAGTATGGGGAGAAAAAGG - Intronic
1051942777 9:22529147-22529169 GGGTGGGTGGGGTGGGGAAAGGG - Intergenic
1052303055 9:26974939-26974961 CCTTAGGTGTGGAGGGAAATGGG + Intronic
1052331684 9:27276549-27276571 CTGTGGGTGGGGTGGGGAAACGG + Intergenic
1052395154 9:27929504-27929526 GGGTGGGGGTGGAGGGAAGGAGG + Intergenic
1052825227 9:33169259-33169281 ATGTGGGTGGGGAGGGAAATAGG - Intergenic
1052877995 9:33581736-33581758 GGGTGGGGGTGTAAGGAAAAAGG + Intergenic
1053021381 9:34696854-34696876 GGGTGGGTCCTGAGGGAAAAAGG - Intergenic
1053497987 9:38562468-38562490 GGGTGGGGGTGTAAGGAAAAAGG - Intronic
1053529672 9:38867712-38867734 TGCTGGGTGGAGAGGGAAAAGGG + Intergenic
1053662744 9:40295848-40295870 GGGTGGGTGTGGATGGAAAAAGG + Intronic
1053665511 9:40314836-40314858 GGGTTGGGGTGGAAGGAAAAGGG + Intronic
1053665901 9:40317352-40317374 AGATGGGGGTGTAGGGAAAATGG + Intronic
1053728822 9:41031572-41031594 CTGTTGGGGTGGAGGGAACATGG + Intergenic
1053913190 9:42926023-42926045 GGGTGGGTGTGGATGGAAAAAGG + Intergenic
1053915096 9:42939883-42939905 CGGTTGGGGTGGAAGGAAAAGGG + Intergenic
1053915479 9:42942397-42942419 AGATGGGGGTGTAGGGAAAATGG + Intergenic
1054201897 9:62092139-62092161 TGCTGGGTGGAGAGGGAAAAGGG + Intergenic
1054374874 9:64442072-64442094 GGGTGGGTGTGGATGGAAAAAGG + Intergenic
1054376664 9:64454866-64454888 GGGTTGGAGTGGAAGGAAAAGGG + Intergenic
1054377055 9:64457380-64457402 AGATGGGGGTGTAGGGAAAATGG + Intergenic
1054518710 9:66058931-66058953 AGATGGGGGTGTAGGGAAAATGG - Intergenic
1054519103 9:66061448-66061470 GGGTTGGGGTGGAAGGAAAAGGG - Intergenic
1054521869 9:66080436-66080458 GGGTGGGTGTGGATGGAAAAAGG - Intergenic
1054636460 9:67496220-67496242 TGCTGGGTGGAGAGGGAAAAGGG - Intergenic
1054699688 9:68400511-68400533 CTGTTGGGGTGGAGGGAACATGG - Intronic
1055398841 9:75901466-75901488 TGTTGGGGGTGGCGGGAAAAGGG + Intronic
1056138887 9:83655356-83655378 GGTTGGGTGAGGAGGGAATAGGG + Intergenic
1056674112 9:88658716-88658738 CAGTGTGTGAGCAGGGAAAATGG + Intergenic
1056677281 9:88686291-88686313 GGGTAGGTGTGGAGGGAGAGGGG - Intergenic
1056805792 9:89727616-89727638 AGGGGGGTGTGGAGGGGAGATGG + Intergenic
1057227592 9:93300715-93300737 CGGTGGGTGTGCAGGGTACTGGG - Intronic
1057502084 9:95603977-95603999 GGGAGGGTGGGGAGGGGAAAAGG - Intergenic
1057676173 9:97137663-97137685 GGTTGGGGGTGGAAGGAAAAAGG - Intergenic
1059059023 9:111015394-111015416 CAGTGGGTTTGGAGGGAAGAAGG - Intronic
1059305046 9:113347430-113347452 CTGGGGGTGGGGAGGGAAATAGG - Intergenic
1059421600 9:114195920-114195942 AGGTGGGTGAGGCAGGAAAACGG - Intronic
1059465707 9:114467512-114467534 CGGCGGGGGGGAAGGGAAAATGG + Intronic
1059735684 9:117097222-117097244 AGAGGAGTGTGGAGGGAAAAGGG + Intronic
1060472863 9:123963223-123963245 CGGGGGGTGGGCAGGGAATAAGG - Intergenic
1061690090 9:132320487-132320509 GGGAGGTTGAGGAGGGAAAATGG + Intronic
1061886969 9:133596053-133596075 GGGTGGGTGTGGAGGCAGAGTGG + Intergenic
1062470452 9:136701288-136701310 AGGTGGGGGTGGAGAGACAAGGG - Intergenic
1186081043 X:5932136-5932158 CTGGGGGTGTGGAGGGGAAGGGG - Intronic
1186137016 X:6532760-6532782 AGGTGTGTGGGGAGGGAGAAAGG - Intergenic
1186190454 X:7062690-7062712 AGGTGGGTGGGGAGGGAAGCTGG + Intronic
1186267270 X:7844538-7844560 TGGTGTGTGGGGAGGGAGAAAGG + Intergenic
1186297720 X:8169113-8169135 TGGTGTGTGGGGAGGGAGAAAGG - Intergenic
1186325139 X:8467358-8467380 TGGTGTGTGGGGAGGGAGAAAGG + Intergenic
1187414246 X:19078873-19078895 CAGAGGGAGGGGAGGGAAAAAGG + Intronic
1188747376 X:33862751-33862773 GGGTGGGTGTGGAGGGGAGGTGG - Intergenic
1188945019 X:36290019-36290041 GAGAGGGTGTGGAGGGAGAATGG - Intronic
1189794773 X:44635236-44635258 AGGTGGTCCTGGAGGGAAAAAGG - Intergenic
1190404044 X:50068461-50068483 GGGTGGGGGTGGAGTGGAAAAGG - Intronic
1190752145 X:53372016-53372038 CAGTAGGTCTGGAGGGATAAGGG - Intergenic
1191716656 X:64198355-64198377 GGGTGGCTGAGGAGGGCAAATGG - Intronic
1194682616 X:96872242-96872264 AAGTGGGTGGGGAGGGGAAATGG - Intronic
1195264209 X:103164289-103164311 TGGTGTGTGTGGAGGGGAATGGG + Intergenic
1195378443 X:104249836-104249858 GGGGAGGTGTGGAGGGAAAATGG + Intergenic
1195520397 X:105822648-105822670 AGTTGGGAGTGGAGGGAAACCGG - Exonic
1195720739 X:107865545-107865567 GGGTGGGCGGGGAGGGAAACAGG - Intronic
1195958537 X:110360810-110360832 CAGTGGGAATGGAAGGAAAATGG + Intronic
1196497321 X:116336348-116336370 GGGTTGGTGTGGAGAGATAATGG - Intergenic
1196527190 X:116740472-116740494 AGCTGGGTATAGAGGGAAAACGG + Intergenic
1196794797 X:119493542-119493564 CTGTGGGTGGCGAGGGAACAGGG - Intergenic
1197579417 X:128263184-128263206 GGGTTGGTGTGGAGAGATAATGG + Intergenic
1197909870 X:131470472-131470494 CGGTGAGGGTGTAGAGAAAAGGG - Intergenic
1198370718 X:135986061-135986083 CTGGGGGTGCGGAGGAAAAAGGG - Intronic
1199086308 X:143634059-143634081 CGGTGGGTGAGGAGGAAGAGAGG + Intronic
1199530273 X:148838951-148838973 GGGTGGGTGTGAATGCAAAAAGG - Intronic
1199795749 X:151194144-151194166 TGGTGGGTGGTGAGGGAAAGTGG + Intergenic
1199838680 X:151620892-151620914 AGGAGGAGGTGGAGGGAAAAAGG - Intronic
1200068654 X:153517412-153517434 GGGTGGGTGGGGATGGAAACTGG - Intergenic
1200342456 X:155411792-155411814 TGGTGGGTGTGGTGGAAATAGGG + Intergenic
1201232021 Y:11874245-11874267 AAGTGGGTTTGAAGGGAAAAAGG + Intergenic
1201438646 Y:13985638-13985660 TGGTGGGTGGGGAGGGAGGAAGG - Intergenic
1201445927 Y:14057070-14057092 TGGTGGGTGGGGAGGGAGGAAGG + Intergenic