ID: 1113567807

View in Genome Browser
Species Human (GRCh38)
Location 13:111329210-111329232
Sequence CAGCCTGCACAGCACGCCCT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 1, 1: 0, 2: 3, 3: 18, 4: 197}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113567807 Original CRISPR CAGCCTGCACAGCACGCCCT CGG Intronic
900245366 1:1633877-1633899 CAGCCCCCACAGCTCGTCCTGGG - Exonic
900256597 1:1701036-1701058 CAGCCCCCACAGCTCGTCCTGGG - Intronic
900350668 1:2233109-2233131 CAGCCTGCACGGAAAGCGCTTGG - Intronic
900625543 1:3606965-3606987 CAGGCTGCACAGCAGGCCCCAGG - Intronic
901146686 1:7069654-7069676 GAGCCTGGACAGCAGGCTCTGGG + Intronic
901259558 1:7861607-7861629 CAGCCTCCGCAGCAGGCCCCAGG + Intergenic
902850029 1:19148010-19148032 CAGCCTGCACACCAGCCGCTCGG - Exonic
902894064 1:19466716-19466738 TGGCCTGCACAGCATGCCATGGG - Intronic
905455169 1:38083654-38083676 CAGCCTGCACAGCAGGGCGGGGG - Intergenic
907097119 1:51791985-51792007 CAGCCTGCAAAGTAAGCCCTAGG + Intronic
907316244 1:53574575-53574597 CACACAGCACAGCAAGCCCTGGG + Intronic
907491537 1:54811879-54811901 CATCCTGCACATGAGGCCCTCGG - Exonic
907905684 1:58782566-58782588 CAGCCTGCACAGCGAGCCGCCGG - Exonic
912693380 1:111821521-111821543 CCGCCTGCTCAGGAAGCCCTGGG + Intronic
913248040 1:116887599-116887621 CAGCCTGTACAGAAAGCCCTGGG - Intergenic
913711434 1:121487891-121487913 CAGCCTGCACATCTCACCCATGG + Intergenic
918001602 1:180502440-180502462 GAGCCTGCTCTGCACGCCCAGGG - Exonic
920699632 1:208208077-208208099 CATCGTGCACAGCACACACTAGG - Intronic
921163213 1:212487463-212487485 CATCTTGCACAGGACCCCCTGGG + Intergenic
922161874 1:223084183-223084205 CATCGTGCACAGCAGGCGCTTGG + Intergenic
924634062 1:245768027-245768049 CAGACTCCACTGCACCCCCTTGG - Intronic
1063420515 10:5909197-5909219 CAGACTCCACAGCACCCTCTCGG - Exonic
1063424961 10:5943668-5943690 CAGCCTCCTCCGCACGCCCGTGG - Intronic
1066355915 10:34683707-34683729 CAGCCTGCACAGGATGGGCTGGG - Intronic
1067374864 10:45718575-45718597 GAGCCCGCACAGCACGCACAAGG + Intergenic
1067378861 10:45753964-45753986 CAGCCCGCACAGCAGGCACAAGG - Intronic
1067882680 10:50060222-50060244 CAGCCCGCACAGCACGCACAAGG + Intergenic
1067886564 10:50094626-50094648 CAGCCCGCACAGCAGGCACAAGG - Intronic
1068820978 10:61377133-61377155 CAGCCAGCACTGCCGGCCCTGGG - Intergenic
1069571423 10:69496632-69496654 CAGCCGGGACAGCACTTCCTGGG + Intronic
1069868352 10:71517970-71517992 CAGCCAGGACAGCAAGCTCTGGG + Intronic
1071438133 10:85665961-85665983 CAGCTTGCACAGCTCACCCCTGG + Intronic
1073153810 10:101330565-101330587 AAGCCAGCACAGCAAGCCTTTGG - Intergenic
1076694897 10:132242675-132242697 CAGCCTGCACATCAGCCCTTGGG + Intronic
1076744921 10:132508059-132508081 TGGCCTGCACAGCAGGCCTTGGG - Intergenic
1076765659 10:132631522-132631544 CATCCTGCACAGCACCCCAGTGG - Intronic
1076852870 10:133101634-133101656 CAGCCCCCACAGCCCGGCCTCGG - Intronic
1077119849 11:901870-901892 CAGCCGGCAGAGCAGGCCCATGG - Intronic
1077315387 11:1917380-1917402 CAGCCTGCTCCCCACTCCCTGGG + Intergenic
1078619509 11:12893988-12894010 CAGGCTGCCCAGCCTGCCCTGGG + Intronic
1080223506 11:29934261-29934283 CAGCCAGCACCGCCGGCCCTGGG + Intergenic
1083855425 11:65390780-65390802 CAGGCTGCCCAGCAGGCTCTGGG - Intronic
1083997524 11:66279482-66279504 CAGCCTGCCCAGCTCGGCCCTGG + Intronic
1084834875 11:71795202-71795224 CCGCCTGCACAGGATGCCCGGGG - Intronic
1085269881 11:75264046-75264068 CAGCCTGCCCAGCAAGCTCTAGG + Intergenic
1085345951 11:75768436-75768458 CTGCCTGCACCGCACGTGCTTGG + Intronic
1088485981 11:110340898-110340920 CAGCCTGCAGAGGATGCTCTTGG - Intergenic
1091949912 12:4584171-4584193 CTGCCTGCACAGAACTCACTTGG + Intronic
1094436853 12:30430314-30430336 CAGCAAGCACAGCACACCCAGGG + Intergenic
1103175685 12:118861366-118861388 CAGCCTGCACAGATAGCCCTTGG + Intergenic
1103175874 12:118862621-118862643 CAGCCTCCATCCCACGCCCTTGG - Intergenic
1103902149 12:124308866-124308888 CACCCTGCACAGGCCACCCTAGG - Intronic
1104747797 12:131221045-131221067 AAGCCTGCACAGAACGCAGTGGG - Intergenic
1104855493 12:131900579-131900601 GATCCTGCCCAGCATGCCCTGGG + Intronic
1104898588 12:132176025-132176047 GAGCCTGCTCACCTCGCCCTTGG + Intergenic
1105240985 13:18609605-18609627 CAGCCTGCGCAGCGGGCACTCGG - Intergenic
1105583406 13:21721783-21721805 CAGCCTTCACCGCTCGCTCTAGG + Intergenic
1106786571 13:33113561-33113583 CATCCTGCAAAGCAAGTCCTGGG - Intronic
1108483492 13:50900586-50900608 CAGCCTGCACGGCACGTTCAAGG - Intergenic
1108858972 13:54829762-54829784 CAGCCTGCCCTGCTGGCCCTGGG - Intergenic
1113567807 13:111329210-111329232 CAGCCTGCACAGCACGCCCTCGG + Intronic
1115961178 14:38837351-38837373 CTGCCTGGACAGCACCTCCTGGG + Intergenic
1118976070 14:70677576-70677598 CTGCCTCCACTGCCCGCCCTGGG - Intergenic
1119330171 14:73787404-73787426 TAGCCTGCACCCCCCGCCCTGGG + Intronic
1119706004 14:76782979-76783001 CAGCCTACACAGCAGGAGCTGGG - Exonic
1119768690 14:77206582-77206604 CAGCCTGCACAGGAACCACTGGG + Intronic
1121603405 14:95222898-95222920 CAGCCAGCACAGAGCGTCCTGGG - Intronic
1123490372 15:20775540-20775562 CAGCCTGCGCAGCGGGCACTCGG + Intergenic
1123546873 15:21344627-21344649 CAGCCTGCGCAGCGGGCACTCGG + Intergenic
1127299621 15:57639854-57639876 CACCCTGCCCATCACCCCCTTGG - Intronic
1127710371 15:61591446-61591468 CAGCCTGAACAGCTCTGCCTAGG + Intergenic
1129740441 15:77987180-77987202 CTGGCAGCACAGCACGCCCCAGG + Intronic
1131441666 15:92464286-92464308 CAGCCCGCATACCATGCCCTTGG + Exonic
1202955204 15_KI270727v1_random:71843-71865 CAGCCTGCGCAGCAGGCACTCGG + Intergenic
1132549164 16:547294-547316 CACGCTGCACAACACGCCCGTGG + Exonic
1132797507 16:1732510-1732532 CAGGCTCCACGGCACGCCCCTGG - Intronic
1132939704 16:2500648-2500670 CAGCCTGGACAGCTGGTCCTGGG + Intronic
1132975366 16:2708512-2708534 CAGTCTGCACAGTACCCCTTGGG - Exonic
1133020008 16:2963219-2963241 CAGCCTGCCCAGCCCGCACCAGG - Intergenic
1139923375 16:70473081-70473103 CAGCATCCACAGCAGGTCCTGGG - Exonic
1139949982 16:70663985-70664007 CAGCCTGCCCAACACAGCCTGGG - Exonic
1140152899 16:72390050-72390072 CAGCCTGCTCTACATGCCCTAGG + Intergenic
1140205235 16:72928013-72928035 CAGGCTGCACAGTGCCCCCTGGG + Intronic
1141889595 16:86917850-86917872 GACCCAGCACAGCACACCCTCGG + Intergenic
1142029788 16:87832820-87832842 CAGCCTCCACTGCCCGACCTGGG + Exonic
1142074711 16:88110754-88110776 CAACCCGCACAGCACTCCCTGGG - Intronic
1142273119 16:89101307-89101329 GTGCGTGCTCAGCACGCCCTTGG - Exonic
1142855010 17:2724422-2724444 CAGCCAGCCCAGCGCGCCCGGGG - Intergenic
1142968436 17:3595422-3595444 CAGACTCCACAGCAGGGCCTGGG + Intronic
1143189878 17:5033475-5033497 GCACCTGCACAGCACGCCCATGG + Exonic
1144371231 17:14593842-14593864 CTGTCTGCACAGCACCCCCATGG - Intergenic
1149430880 17:56594783-56594805 CGGCTTGCACACCATGCCCTCGG - Exonic
1151455088 17:74221320-74221342 CAGACTGCAGAGCCCGGCCTTGG + Intronic
1151570184 17:74922040-74922062 CAGCCTGGACAGGACACCCCAGG - Intronic
1151665262 17:75542052-75542074 CTCCCAGCACAGCAAGCCCTCGG + Intronic
1151828116 17:76534955-76534977 GAGCCTCCACAGCCAGCCCTGGG + Intronic
1152070210 17:78130583-78130605 CAGCATGCACAGAGCTCCCTGGG + Intronic
1152599049 17:81252350-81252372 CAGCCTGCAAAGGAGGACCTGGG - Exonic
1152608155 17:81303269-81303291 CGGCCTGCTCAGCACACCCTGGG - Intergenic
1153956425 18:10100212-10100234 CACCCTGCACAGCAGTCCTTCGG + Intergenic
1154122716 18:11664658-11664680 CTGCCTGCAGAGCCCTCCCTAGG + Intergenic
1154447979 18:14450297-14450319 CAGCCTGCGCAGCGGGCACTCGG + Intergenic
1155416409 18:25604521-25604543 CAGCCTGAACAGAATGTCCTTGG - Intergenic
1156372566 18:36484748-36484770 CAGCCTTCACCACACCCCCTGGG - Intronic
1156783795 18:40883828-40883850 GAGCCTTCGCAGGACGCCCTTGG + Intergenic
1160346715 18:78138135-78138157 CAGCCTGCAATGCACCCCCAGGG - Intergenic
1161156182 19:2732916-2732938 CACGCTGCCCGGCACGCCCTGGG + Exonic
1161238402 19:3208973-3208995 AAGCCTGCTCGGCACGCACTGGG - Exonic
1163752498 19:19085986-19086008 CACCCTCCACAGTACGCCTTGGG + Intronic
1166304751 19:41931365-41931387 CTCACTGCACAGCACGCCCGCGG + Intergenic
1167373913 19:49101301-49101323 CAGCCTGCACACCAGGCCCTGGG - Intronic
1167780375 19:51594950-51594972 CAGCCTCCTGAGCACCCCCTGGG - Intergenic
1168247086 19:55117706-55117728 CGACCTGCCCAGCACACCCTGGG - Intergenic
925007269 2:453442-453464 CAGCCTGCACCGAAGGCCCATGG - Intergenic
925153585 2:1634235-1634257 CAGACTGGACAGCAGGCCCCTGG + Exonic
927497972 2:23563379-23563401 CAGCCTGCACAGCCCCTGCTCGG - Intronic
930593380 2:53356533-53356555 CAGCCAGCACCGCCGGCCCTGGG + Intergenic
933897323 2:86823853-86823875 CAGCCTGTCCAGGAGGCCCTGGG - Intronic
935137574 2:100321494-100321516 CAGCCTGCGCAGCCGGCACTCGG + Exonic
936965099 2:118119512-118119534 CAGCCTTAACAGCAAGACCTGGG + Intergenic
940775217 2:157876760-157876782 CCGCCTGCCCCGCGCGCCCTCGG - Intronic
943942709 2:194020260-194020282 CAGCCTGCCCCGCTGGCCCTGGG + Intergenic
944311831 2:198242195-198242217 CAGCCTTCACAGCACCCATTAGG - Intronic
946277510 2:218642563-218642585 GAGCCTGCACAGCCTGCCCCTGG - Exonic
946310550 2:218880587-218880609 CAGCCAGCCTCGCACGCCCTCGG + Exonic
948048789 2:234964172-234964194 CAGCATTCCCAGCACGCCCCAGG + Intronic
1170530684 20:17288037-17288059 CAGCCTGCAGAGCCAGCCCTTGG - Intronic
1170574645 20:17653175-17653197 CACCGTGCCCAGCGCGCCCTCGG + Intronic
1172118362 20:32584319-32584341 CAGCCTGCCCGGCACGGCCACGG + Intronic
1174378389 20:50141065-50141087 CAGCCTGCACAGCACACACCTGG + Intronic
1179720106 21:43311449-43311471 CAGCATGCAGAACACTCCCTGGG + Intergenic
1179898767 21:44378070-44378092 CAGCCTCCCCAGCAGGTCCTGGG - Intronic
1179902531 21:44401498-44401520 GAGCCGGCACAGCACAGCCTGGG - Intronic
1179925596 21:44532424-44532446 CAGCCTGCACAGCACGTCCCTGG + Intronic
1180027149 21:45172637-45172659 CCGCCTCCACAGCACACCCATGG - Intronic
1180061442 21:45387182-45387204 CAGCCTGCAGAGACGGCCCTGGG + Intergenic
1180181193 21:46119360-46119382 CAGCCCTCACAGGATGCCCTGGG - Intronic
1181439377 22:22927877-22927899 CAGCCTCCTCTGCACGCCTTAGG - Intergenic
1182913105 22:34004128-34004150 CAGCCTGCAGGGCACGCCCGAGG + Intergenic
1183596928 22:38818402-38818424 CTTCCTGCCCAGCACCCCCTAGG + Intergenic
1183744696 22:39685811-39685833 CAGCCTGCAGACCACGCTCGAGG + Exonic
1184792394 22:46708075-46708097 CAGCCTGCACACCTGGCCCTTGG + Intronic
950712177 3:14820410-14820432 CAGGCTGCATCGGACGCCCTGGG + Exonic
951881491 3:27484544-27484566 CAGCCTCCTCAGCGCGCCCGCGG + Intergenic
952945216 3:38474393-38474415 CAGCCTGCAGCCCAAGCCCTAGG - Intronic
954411532 3:50373371-50373393 CTGCCTGCCCACCACGCCCGAGG - Intronic
961158299 3:124699987-124700009 CAGCCTTCCCAGCGAGCCCTCGG + Intronic
961887134 3:130103707-130103729 CCGCCTGCACAGGATGCCCGGGG + Intronic
968996272 4:3947708-3947730 CCGCCTGCACAGGATGCCCGGGG + Intergenic
969757710 4:9160982-9161004 CCGCCTGCACAGGATGCCCGGGG - Intergenic
969817688 4:9698495-9698517 CTGCCTGCACAGGATGCCCGGGG - Intergenic
970554480 4:17217437-17217459 CAGCCTGCACAGCACAGGGTGGG - Intergenic
970663105 4:18308115-18308137 CAGCCAGCAGAGCATGTCCTGGG + Intergenic
972046444 4:34670710-34670732 CAGGCTGCCCAGTACCCCCTGGG - Intergenic
974468872 4:62293122-62293144 CAGTGTGCACAGCACCCTCTTGG - Intergenic
982262363 4:153505877-153505899 CAGCCTCCTCACCACACCCTGGG - Intronic
983835407 4:172377797-172377819 CAGCCTGTGCAGCCAGCCCTGGG - Intronic
984999739 4:185471434-185471456 CCGCCCGCCCAGCGCGCCCTCGG - Intronic
985178073 4:187224587-187224609 CAGCCAGCCCAGCACCCCTTTGG + Intergenic
985531312 5:435316-435338 CTGCCTGCACAGCACAGGCTGGG - Exonic
986512651 5:8524555-8524577 CAGCCTCCACAGCCAGTCCTTGG - Intergenic
990343931 5:54852641-54852663 TAGGCTGCACAGTACTCCCTGGG + Intergenic
990447028 5:55903110-55903132 CCTTCTGCTCAGCACGCCCTGGG + Intronic
992048852 5:72925591-72925613 CAGCCAGCACTGCTGGCCCTGGG + Intergenic
997352928 5:133243961-133243983 CAGCCTGCACAGCGGCCACTCGG - Intronic
1002448008 5:179301949-179301971 CAGCCTGCACACCTCGCCCCTGG + Intronic
1003128445 6:3374761-3374783 CACCCAGCACAGCCAGCCCTGGG + Intronic
1003592260 6:7446054-7446076 CACCCTGCACGGCACCTCCTGGG + Intergenic
1004321045 6:14631710-14631732 CAGCCTGGACAGGACCCCCTGGG - Intergenic
1007751807 6:44075738-44075760 CAGCCTTCACAGGCCCCCCTAGG + Intergenic
1008078589 6:47171199-47171221 CACCCTGCACAGGAGGTCCTTGG - Intergenic
1010465995 6:76166934-76166956 CAGGCTGCACACCACAGCCTTGG - Intergenic
1012418840 6:99039289-99039311 CAGCCCTCACAGCACTCCTTAGG - Intergenic
1017009919 6:150056437-150056459 CAGCCTGCAGAGCACCCCTCAGG + Intergenic
1017135465 6:151143586-151143608 CAGCCTGCACAGGACGCAGGGGG - Intergenic
1017338544 6:153291185-153291207 CGCCCTGCTCAGCAGGCCCTGGG + Intergenic
1018685736 6:166302929-166302951 CAGCCTTTACAGCAGGCACTAGG + Intergenic
1019340894 7:508353-508375 CAGCCTGCTCTGGACCCCCTGGG - Intronic
1019471946 7:1225645-1225667 CAGCCTGGACAGCGCGCTCGGGG - Intergenic
1019786537 7:2980805-2980827 CTGCCTGCCCTGCACGGCCTGGG - Intronic
1020005984 7:4783999-4784021 CACCCTGCTCCGCAGGCCCTGGG - Intronic
1029315596 7:99710337-99710359 CAACCTGCACAGCGCACCCAGGG + Intronic
1029321326 7:99763129-99763151 CAGCCTGCACAGCACACCCAGGG + Intronic
1029331530 7:99860371-99860393 CAGCCTGCCCAGCGCACCCAGGG - Intronic
1032079781 7:128853091-128853113 CGTCCTGCCCAGCACCCCCTTGG + Intronic
1032128744 7:129212450-129212472 GAGCCTGCAGAGCAGGACCTGGG + Exonic
1035047018 7:155974294-155974316 CAGCCTGCAGACCCAGCCCTGGG - Intergenic
1035617297 8:1011811-1011833 CAGTCTGCACAGTGGGCCCTGGG + Intergenic
1036122770 8:6036264-6036286 CAGCCTGCACAGCCCCCACCCGG + Intergenic
1036762367 8:11518169-11518191 CAGCCTGCACAGAGTGGCCTTGG + Intronic
1036776537 8:11616844-11616866 CAGCCTTCACTGCAAGCCCCTGG + Intergenic
1036848605 8:12186318-12186340 CCGCCTGCACAGGATGCCCGGGG + Intronic
1036869967 8:12428599-12428621 CCGCCTGCACAGGATGCCCGGGG + Intronic
1037494261 8:19423879-19423901 CAGGCTGCACAGAAAGCCCTGGG + Intronic
1037594806 8:20346008-20346030 CAGCCAGCACAGCTCACCCATGG - Intergenic
1038017894 8:23530067-23530089 CAGCCTGCCCAGAACACCCCAGG + Intronic
1040304528 8:46205159-46205181 CAGTCTGCCCAGCACAGCCTTGG - Intergenic
1040315915 8:46260830-46260852 CAGCCTGCCCAGAACACCCCTGG - Intergenic
1040322812 8:46327107-46327129 AAGCCTGCAGGGCACCCCCTGGG - Intergenic
1040340097 8:46436108-46436130 CAGCCTGCCCAGGACACCCTGGG + Intergenic
1040794164 8:51271339-51271361 CAGCCTGCGCCGCCGGCCCTGGG + Intergenic
1041304840 8:56447588-56447610 CAGCCTCCACAGTGTGCCCTCGG - Intergenic
1044457025 8:92400987-92401009 GAGCCAGCACAGCAATCCCTTGG - Intergenic
1045743350 8:105387547-105387569 CAGCCGGCCCCGCCCGCCCTAGG - Intronic
1049299277 8:141861233-141861255 CAGCCTGCCCAGCACCCCATGGG - Intergenic
1049340783 8:142111576-142111598 CCCCCTGCACAGCGTGCCCTGGG + Intergenic
1049365536 8:142235130-142235152 CTGCCTGCACTGAGCGCCCTGGG + Intronic
1049551155 8:143260591-143260613 CCGCCTGGACAGCACCTCCTGGG + Intronic
1049664015 8:143835178-143835200 GAGCCTGCACAGCAAGCCAGCGG - Exonic
1061933501 9:133845297-133845319 CAGCCCGCATGGCACGCCCAAGG + Intronic
1062191735 9:135251396-135251418 CAGCCTGCACAGCAAGAAGTGGG + Intergenic
1062211027 9:135364182-135364204 CAGACTGCACACCCAGCCCTGGG + Intergenic
1062361289 9:136189541-136189563 CAGCCAGCCCAGCCCTCCCTCGG + Intergenic
1062399910 9:136367785-136367807 CTGCACGCACAGCACGCCCGGGG - Exonic
1062524020 9:136971010-136971032 CAGCCAGCTCAGAACCCCCTTGG + Exonic
1187701426 X:21967718-21967740 GAGTCTGCACACCACTCCCTGGG - Intronic
1189373071 X:40445408-40445430 CAGCCTCCCCACCATGCCCTAGG + Intergenic
1192214488 X:69149240-69149262 CAGCCTGCAGAGGAGGGCCTGGG - Intergenic
1200208112 X:154332528-154332550 CAGCACCCCCAGCACGCCCTCGG + Intergenic