ID: 1113568430

View in Genome Browser
Species Human (GRCh38)
Location 13:111335807-111335829
Sequence TGGTGTAAATGCATCACTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 98}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113568426_1113568430 7 Left 1113568426 13:111335777-111335799 CCAATGAAGCAGAGATCCAACCG 0: 1
1: 0
2: 0
3: 5
4: 54
Right 1113568430 13:111335807-111335829 TGGTGTAAATGCATCACTCCAGG 0: 1
1: 0
2: 0
3: 9
4: 98
1113568428_1113568430 -9 Left 1113568428 13:111335793-111335815 CCAACCGTGTAAAGTGGTGTAAA 0: 1
1: 0
2: 0
3: 2
4: 49
Right 1113568430 13:111335807-111335829 TGGTGTAAATGCATCACTCCAGG 0: 1
1: 0
2: 0
3: 9
4: 98
1113568422_1113568430 24 Left 1113568422 13:111335760-111335782 CCCAATTTCCTCACATCCCAATG 0: 1
1: 0
2: 2
3: 14
4: 232
Right 1113568430 13:111335807-111335829 TGGTGTAAATGCATCACTCCAGG 0: 1
1: 0
2: 0
3: 9
4: 98
1113568425_1113568430 8 Left 1113568425 13:111335776-111335798 CCCAATGAAGCAGAGATCCAACC 0: 1
1: 0
2: 0
3: 5
4: 120
Right 1113568430 13:111335807-111335829 TGGTGTAAATGCATCACTCCAGG 0: 1
1: 0
2: 0
3: 9
4: 98
1113568424_1113568430 16 Left 1113568424 13:111335768-111335790 CCTCACATCCCAATGAAGCAGAG 0: 1
1: 0
2: 0
3: 26
4: 222
Right 1113568430 13:111335807-111335829 TGGTGTAAATGCATCACTCCAGG 0: 1
1: 0
2: 0
3: 9
4: 98
1113568423_1113568430 23 Left 1113568423 13:111335761-111335783 CCAATTTCCTCACATCCCAATGA 0: 1
1: 0
2: 2
3: 24
4: 302
Right 1113568430 13:111335807-111335829 TGGTGTAAATGCATCACTCCAGG 0: 1
1: 0
2: 0
3: 9
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113568430 Original CRISPR TGGTGTAAATGCATCACTCC AGG Intronic
901781789 1:11599112-11599134 AGATGTAATTGCATCTCTCCTGG + Intergenic
904405777 1:30287070-30287092 TGGTGTGAGTGAATTACTCCCGG + Intergenic
905925545 1:41746955-41746977 TGGTGTAACAGCATCACCCCCGG + Intronic
906074336 1:43041105-43041127 TGGGGGAAATGCTTCACACCAGG + Intergenic
914810191 1:151022082-151022104 CTGTGTAAAAGCATCATTCCTGG + Intronic
916583669 1:166130956-166130978 TGGTGTATCTGCATCTCCCCAGG + Intronic
916990058 1:170233360-170233382 TGCTTTAAATTAATCACTCCAGG - Intergenic
919186265 1:194154831-194154853 TGATGCAAATACATCACTCAAGG + Intergenic
919849035 1:201660092-201660114 TGCTGTAAATGCTCCACCCCTGG - Intronic
920789954 1:209080519-209080541 TGGTGAAAATGCAAGCCTCCAGG + Intergenic
920831919 1:209473226-209473248 TGATGCAAATGAACCACTCCAGG + Intergenic
1069613408 10:69790588-69790610 TGGTGAAAATGAGTCACTTCTGG - Intergenic
1075911941 10:126132505-126132527 GGGTGTTCATGCAGCACTCCTGG - Intronic
1078737307 11:14032432-14032454 TGGTGTTAATGCTTCCCTCTGGG + Intronic
1078779492 11:14423461-14423483 AGATGTAAATGCATAACTACAGG + Intergenic
1080313418 11:30921609-30921631 TGGAGAAAAACCATCACTCCTGG + Intronic
1087781599 11:102306553-102306575 TGGTTTAAATGCATCTCATCAGG - Intergenic
1092490392 12:8939764-8939786 TGGGCTAAATGCTCCACTCCAGG - Exonic
1092795238 12:12104253-12104275 TTGTGTGAATGCATTACTTCAGG - Intronic
1093201148 12:16187637-16187659 TGGAGTAAATGGAACACTGCAGG + Intergenic
1094189452 12:27682700-27682722 TGTTGTAAGTGACTCACTCCTGG + Exonic
1096946096 12:55411395-55411417 TGGGCTAAATGCTCCACTCCGGG + Intergenic
1097810859 12:64017393-64017415 TGGTGTAATTGCAGCACTTTGGG + Intronic
1098659731 12:73076580-73076602 TGCTGTACATGCCTCTCTCCAGG - Intergenic
1100807669 12:98304559-98304581 TGGTATTAATGCATCACCCATGG + Intergenic
1102594932 12:113985050-113985072 TCTTATAGATGCATCACTCCAGG - Intergenic
1104467453 12:129002505-129002527 CGGTGTAATTTCATCATTCCAGG + Intergenic
1104504876 12:129321999-129322021 TGGTGTAAAAGCATCAGTGCTGG + Intronic
1106005120 13:25762436-25762458 AGATCTAAATGCATCACTCATGG - Intronic
1106694280 13:32154754-32154776 TGGTGTAAATGTTTCACACATGG + Intronic
1109136018 13:58652192-58652214 TTGTGTACATGCCACACTCCAGG + Intergenic
1110619961 13:77584400-77584422 GGGTGTAAATGCATCACCCTTGG + Intronic
1111190123 13:84795939-84795961 TGGTGCAAATGCAACACTACAGG + Intergenic
1111448302 13:88379542-88379564 TTGTGTATATGTATCACTCTAGG + Intergenic
1111480852 13:88824349-88824371 TTGTGAAAATACATCACACCTGG + Intergenic
1113568430 13:111335807-111335829 TGGTGTAAATGCATCACTCCAGG + Intronic
1118319935 14:64747157-64747179 TGCTGGAAATGCCTCACTTCAGG + Exonic
1119318474 14:73714687-73714709 TGTTGGAAATGCATCCCTCATGG + Intergenic
1127310102 15:57744873-57744895 TGGTGAAAAAGCAGAACTCCAGG + Intronic
1133637029 16:7676918-7676940 TGGTGAAACTGCATGACTGCTGG + Intronic
1135048833 16:19176008-19176030 GGGTGTAAATGCACAACTCTAGG - Intronic
1140253765 16:73317595-73317617 TGCTGTGATTGCATCACTGCTGG + Intergenic
1144496488 17:15749400-15749422 TGGGGGAAATGCATCCTTCCCGG - Intergenic
1144606074 17:16666804-16666826 TGGGGGAAATGCATCCTTCCCGG - Intergenic
1144636879 17:16915774-16915796 TGGTGAAAATGTTTCTCTCCTGG - Intergenic
1144648645 17:16991952-16991974 TGGTGAAAATGTTTCTCTCCTGG + Intergenic
1144905092 17:18635299-18635321 TGGGGGAAATGCATCCTTCCCGG + Exonic
1149151438 17:53569048-53569070 TTGAGTAAATGCAGCACACCTGG - Intergenic
1164052594 19:21595912-21595934 TGGGGTAAGTGGATCACTCGAGG - Intergenic
1167428323 19:49441066-49441088 TGCTGTAAATGCCTCTCTCCCGG - Intronic
931091999 2:58896270-58896292 TTGTGTATATGAAACACTCCTGG + Intergenic
936257299 2:110927785-110927807 TTGTGTAACTACATCACACCTGG + Intronic
937968215 2:127530678-127530700 TGGTGGATATGCAGCATTCCAGG + Intergenic
939095429 2:137828154-137828176 TGGTGTCAATGCATCTCCCATGG - Intergenic
1173038384 20:39435061-39435083 AGGTAGAAATGTATCACTCCAGG - Intergenic
1173133237 20:40414302-40414324 TGGTGTAAATGCTTCCACCCTGG - Intergenic
1173314590 20:41931791-41931813 TTATATAAATGCCTCACTCCTGG - Intergenic
1174486441 20:50864270-50864292 TGTTGTACAAGCATCACGCCGGG + Intronic
1175587211 20:60150890-60150912 TGGTGTCAAGGCATCACTGTAGG - Intergenic
1177786695 21:25679429-25679451 GGGTGTAAAGAAATCACTCCTGG - Intronic
1178611430 21:34085322-34085344 GGATGTCAATGCATCACACCGGG + Intronic
1178894582 21:36548255-36548277 TGGTGAAGATGCAGCTCTCCAGG - Intronic
1179329817 21:40388792-40388814 TGGTATAAATTCACCACTCTGGG + Intronic
949398179 3:3637335-3637357 TGTTGTAAATTCATCACTTCTGG - Intergenic
950984646 3:17348416-17348438 TGGTGGAAATGCAGAACCCCAGG - Intronic
954816450 3:53285149-53285171 TGGTCTAAATGCAGGTCTCCTGG + Exonic
958771872 3:98434994-98435016 TGGTGTAAGTACATCACCACTGG - Intergenic
960044365 3:113181748-113181770 TGGCTTAAATGCATCATTTCAGG - Intergenic
968436203 4:590996-591018 TGGTGTAAATGCCCCCCTCATGG - Intergenic
969596799 4:8153680-8153702 TGGTAGAAACCCATCACTCCGGG - Intronic
977784250 4:101014607-101014629 TGGTGTAAATGATTCATACCAGG + Intergenic
978211489 4:106142812-106142834 TGGTGGAAAAACATCACTACAGG + Intronic
979353221 4:119670487-119670509 TGCTGTATATGCATCAGTTCAGG - Intergenic
980012314 4:127610589-127610611 TGCTTTCAATGCATCCCTCCAGG - Intergenic
985697813 5:1351364-1351386 TGGTGTGAATGCACCACAGCTGG + Intergenic
985856709 5:2434027-2434049 TGGGGTGAATGCATGACTCAGGG - Intergenic
986539513 5:8828965-8828987 TGGGGTGAATGCAACACTCCAGG - Intergenic
987259082 5:16185661-16185683 TGCTGGAAAAGCATCACTGCGGG + Intergenic
989206149 5:38810544-38810566 TGCTGAAAATGCAGCACACCCGG + Intergenic
992372576 5:76159627-76159649 GTTTGTAGATGCATCACTCCAGG + Intronic
995987604 5:118198354-118198376 TGATGCAAATGCATAAATCCTGG + Intergenic
996884817 5:128342348-128342370 TGGTGTTAAAACATCTCTCCTGG - Intronic
999773498 5:154793073-154793095 TGGTGTAAATACACCAGGCCTGG + Intronic
1001569780 5:172722904-172722926 TGGTGTAAAGGCAACAGTACTGG + Intergenic
1004020676 6:11773489-11773511 GGGTGCAAATGCTGCACTCCCGG - Intronic
1007130548 6:39468966-39468988 TGGTGTCATTTCATTACTCCAGG - Intronic
1015052423 6:128858040-128858062 TGGTGGAAGTGCCTCACTCCGGG + Intergenic
1023617941 7:42039955-42039977 TACTGAAAATGCATCACTACAGG + Intronic
1032843952 7:135736818-135736840 TGGCCTATAGGCATCACTCCTGG - Intronic
1034209879 7:149354230-149354252 GGCTGTAGAAGCATCACTCCAGG - Intergenic
1034297639 7:149988453-149988475 TGGTGCTAAAGTATCACTCCAGG - Intergenic
1034808383 7:154108400-154108422 TGGTGTTAAAGTATCACTCCAGG + Intronic
1035822579 8:2610433-2610455 GTTTGTAGATGCATCACTCCAGG - Intergenic
1037691354 8:21183868-21183890 TGGAGCAAAAGCTTCACTCCGGG + Intergenic
1044206435 8:89496657-89496679 CCGTGTAAAGTCATCACTCCTGG - Intergenic
1045999590 8:108403323-108403345 TGGTGGAAATGCAGCATTCTAGG - Intronic
1057239953 9:93399611-93399633 AGGTGTAAATGCTTCACACTTGG + Intergenic
1057366767 9:94429764-94429786 TGGAGTAAATGCAGCACCGCTGG - Intronic
1057656568 9:96958300-96958322 TGGAGTAAATGCAGCACCGCTGG + Intronic
1059745426 9:117195793-117195815 TGGTGTCAATAGATCACTCTAGG - Intronic
1061380550 9:130254166-130254188 TGGTGCTAATGCTTCACTGCAGG - Intergenic
1061944483 9:133901200-133901222 TCATGTAAAAGCACCACTCCGGG + Intronic
1062295742 9:135825519-135825541 GGGTGTGAAGGCCTCACTCCCGG + Intronic
1187227786 X:17390393-17390415 TCTTGTAAATGAATCACTTCAGG - Intronic
1188615515 X:32154169-32154191 TGAAGTAAATGCATCACTTATGG - Intronic
1193102092 X:77625746-77625768 TGGTGTGAATGCAGCAATCAGGG + Intronic
1193386961 X:80883832-80883854 TGGTGTAGCTGCCACACTCCAGG - Intergenic
1197604762 X:128572539-128572561 TTGTGAAAATGAATCACTCTGGG - Intergenic