ID: 1113568842

View in Genome Browser
Species Human (GRCh38)
Location 13:111339144-111339166
Sequence GCCTCCCCAGGTGGCCACGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 250
Summary {0: 1, 1: 0, 2: 3, 3: 19, 4: 227}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113568842_1113568848 -2 Left 1113568842 13:111339144-111339166 CCCTCGTGGCCACCTGGGGAGGC 0: 1
1: 0
2: 3
3: 19
4: 227
Right 1113568848 13:111339165-111339187 GCTTGACTTTTGCTGAGGCTGGG 0: 1
1: 0
2: 2
3: 10
4: 166
1113568842_1113568852 14 Left 1113568842 13:111339144-111339166 CCCTCGTGGCCACCTGGGGAGGC 0: 1
1: 0
2: 3
3: 19
4: 227
Right 1113568852 13:111339181-111339203 GGCTGGGTTGGAGAAGGCACGGG 0: 1
1: 0
2: 4
3: 60
4: 440
1113568842_1113568847 -3 Left 1113568842 13:111339144-111339166 CCCTCGTGGCCACCTGGGGAGGC 0: 1
1: 0
2: 3
3: 19
4: 227
Right 1113568847 13:111339164-111339186 GGCTTGACTTTTGCTGAGGCTGG 0: 1
1: 0
2: 2
3: 11
4: 188
1113568842_1113568850 8 Left 1113568842 13:111339144-111339166 CCCTCGTGGCCACCTGGGGAGGC 0: 1
1: 0
2: 3
3: 19
4: 227
Right 1113568850 13:111339175-111339197 TGCTGAGGCTGGGTTGGAGAAGG 0: 1
1: 0
2: 8
3: 55
4: 562
1113568842_1113568853 22 Left 1113568842 13:111339144-111339166 CCCTCGTGGCCACCTGGGGAGGC 0: 1
1: 0
2: 3
3: 19
4: 227
Right 1113568853 13:111339189-111339211 TGGAGAAGGCACGGGAAACTTGG 0: 1
1: 0
2: 1
3: 25
4: 204
1113568842_1113568846 -7 Left 1113568842 13:111339144-111339166 CCCTCGTGGCCACCTGGGGAGGC 0: 1
1: 0
2: 3
3: 19
4: 227
Right 1113568846 13:111339160-111339182 GGGAGGCTTGACTTTTGCTGAGG 0: 1
1: 0
2: 1
3: 11
4: 157
1113568842_1113568854 23 Left 1113568842 13:111339144-111339166 CCCTCGTGGCCACCTGGGGAGGC 0: 1
1: 0
2: 3
3: 19
4: 227
Right 1113568854 13:111339190-111339212 GGAGAAGGCACGGGAAACTTGGG 0: 1
1: 0
2: 2
3: 22
4: 170
1113568842_1113568849 2 Left 1113568842 13:111339144-111339166 CCCTCGTGGCCACCTGGGGAGGC 0: 1
1: 0
2: 3
3: 19
4: 227
Right 1113568849 13:111339169-111339191 GACTTTTGCTGAGGCTGGGTTGG 0: 1
1: 0
2: 1
3: 21
4: 201
1113568842_1113568855 24 Left 1113568842 13:111339144-111339166 CCCTCGTGGCCACCTGGGGAGGC 0: 1
1: 0
2: 3
3: 19
4: 227
Right 1113568855 13:111339191-111339213 GAGAAGGCACGGGAAACTTGGGG 0: 1
1: 0
2: 2
3: 11
4: 177
1113568842_1113568851 13 Left 1113568842 13:111339144-111339166 CCCTCGTGGCCACCTGGGGAGGC 0: 1
1: 0
2: 3
3: 19
4: 227
Right 1113568851 13:111339180-111339202 AGGCTGGGTTGGAGAAGGCACGG 0: 1
1: 0
2: 15
3: 192
4: 834

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113568842 Original CRISPR GCCTCCCCAGGTGGCCACGA GGG (reversed) Intronic