ID: 1113568870

View in Genome Browser
Species Human (GRCh38)
Location 13:111339293-111339315
Sequence GTTTAGGGGAGGAATTGACC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 105}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113568863_1113568870 25 Left 1113568863 13:111339245-111339267 CCAGTCAAGGATTTGTCTATGAT 0: 1
1: 0
2: 2
3: 8
4: 111
Right 1113568870 13:111339293-111339315 GTTTAGGGGAGGAATTGACCTGG 0: 1
1: 0
2: 1
3: 16
4: 105
1113568864_1113568870 2 Left 1113568864 13:111339268-111339290 CCAATAAGTGTTTTCCTTGTATT 0: 1
1: 0
2: 0
3: 36
4: 387
Right 1113568870 13:111339293-111339315 GTTTAGGGGAGGAATTGACCTGG 0: 1
1: 0
2: 1
3: 16
4: 105
1113568862_1113568870 26 Left 1113568862 13:111339244-111339266 CCCAGTCAAGGATTTGTCTATGA 0: 1
1: 0
2: 2
3: 20
4: 139
Right 1113568870 13:111339293-111339315 GTTTAGGGGAGGAATTGACCTGG 0: 1
1: 0
2: 1
3: 16
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113568870 Original CRISPR GTTTAGGGGAGGAATTGACC TGG Intronic
902717664 1:18283525-18283547 GTTTAGGGGAAGAGTGGTCCAGG + Intronic
903935643 1:26893065-26893087 TTTTAGAAGAGGAAATGACCCGG - Intronic
904721655 1:32514532-32514554 GTTAAGGAAAGAAATTGACCTGG + Intronic
911002810 1:93183474-93183496 GTTTAGGGGAAGAGTTATCCAGG + Exonic
911275787 1:95855431-95855453 GTTGAGGGTAGGGATTGACTAGG - Intergenic
911844099 1:102726842-102726864 GTATAAGGGAGGAATTGATTTGG - Intergenic
915143265 1:153779688-153779710 GTTTAGGGGAGGAGGTGACAGGG - Intronic
916347651 1:163812075-163812097 GTTCAGGCTATGAATTGACCTGG + Intergenic
918185255 1:182121128-182121150 GTCTAGGGGAGGAGCTGCCCTGG + Intergenic
923220073 1:231884856-231884878 TTTTACAGGAGGAATTAACCTGG + Intronic
923622492 1:235589803-235589825 GTCTAGTGGAGAAAATGACCTGG + Intronic
924423546 1:243931203-243931225 GATGAGGGGAGGAAGTGGCCCGG - Intergenic
1069106193 10:64385656-64385678 GTTTAGGAGAGGAATTCAAGTGG - Intergenic
1069381678 10:67848757-67848779 TTTTAGGGGAGGAACTGGGCAGG + Intergenic
1069802071 10:71087920-71087942 GCATAGGGGAGGGATGGACCAGG + Intergenic
1072512351 10:96140167-96140189 GTTTTGAGATGGAATTGACCAGG + Intronic
1073200797 10:101733597-101733619 GTTTGGGGTAGGAATTGAGGAGG - Intergenic
1073724844 10:106218319-106218341 GTTACGGAGAAGAATTGACCAGG - Intergenic
1078377842 11:10810826-10810848 GTTTATGTGAGAAATTGACCTGG + Intergenic
1079798173 11:24833845-24833867 GTTTGGGGAAGGAAGTGAGCTGG - Intronic
1082752159 11:57031031-57031053 GGTTAGGGGTGGAATTGTTCTGG - Intergenic
1083943936 11:65913428-65913450 GTTTTGGGGGGCCATTGACCTGG + Intergenic
1085263131 11:75219728-75219750 GTTTAGGGGGTGAACTGACCAGG + Intergenic
1085271288 11:75271682-75271704 GTGGAAGGGAGGAATTTACCTGG + Exonic
1087245811 11:95835500-95835522 ATTTAGGGAATGATTTGACCTGG - Intronic
1088278005 11:108109403-108109425 GGTTGGGGGAGGAGTTGACTTGG + Intergenic
1088322485 11:108568266-108568288 CTGCAGGGGAGGAAATGACCAGG + Intronic
1089308020 11:117538830-117538852 GTTTGGGGGAGGATCTGAACTGG + Intronic
1095849217 12:46782977-46782999 GTCTAGAGGAGCAATAGACCAGG + Intronic
1098280506 12:68857536-68857558 TTTTAGTGGAGGAAATGATCAGG + Intronic
1100705888 12:97199568-97199590 GTTGGGGGAAGGAATTGCCCTGG + Intergenic
1103125471 12:118418500-118418522 GTATAGGCTAGGGATTGACCAGG + Intergenic
1103877491 12:124139875-124139897 GTTTTGGGGAGGAAGATACCAGG + Intronic
1107683830 13:42877265-42877287 CTTTAGGGGAGGAGTGGAGCTGG - Intergenic
1113568870 13:111339293-111339315 GTTTAGGGGAGGAATTGACCTGG + Intronic
1114896615 14:26998720-26998742 TTTTAGGGGATGAATGTACCAGG + Intergenic
1116053384 14:39832835-39832857 GTTTTGTGGAAGAATTGACTAGG - Intergenic
1117642005 14:57809966-57809988 GTTAAGGGAAGGACCTGACCAGG - Intronic
1119578172 14:75747646-75747668 CTTTAGTGGAGGAACTAACCTGG - Intronic
1120492097 14:85191023-85191045 TTTGAGGGGTGGAATTGAGCTGG - Intergenic
1122205128 14:100144548-100144570 GTTCAGGGGAGGGATGGACTTGG + Exonic
1124941848 15:34225530-34225552 TTTTAGGGGTCGAAGTGACCGGG + Exonic
1126263646 15:46726262-46726284 GTTTTGGGGAGGTATATACCTGG + Intergenic
1128749533 15:70139178-70139200 GTTTGGAGGAGGATTTGATCTGG - Intergenic
1128991382 15:72263477-72263499 GTTTAGGGAAAGAAATGACGTGG - Intronic
1131120989 15:89823400-89823422 GGTGGGGGGAGGAATGGACCAGG + Intergenic
1131779690 15:95843072-95843094 GCTGAAGGGAGGAATTGATCAGG - Intergenic
1133660240 16:7909485-7909507 GCTTAGGTGAGGAATGGACCAGG + Intergenic
1141054221 16:80802341-80802363 GTTTAGGGGTGAAAGTGATCTGG - Intronic
1144841219 17:18187197-18187219 GTTTAGGGGAGGAAATGAACTGG + Intronic
1146127384 17:30239645-30239667 GTTTGGGGGAGGAACAGATCAGG + Intergenic
1147299436 17:39513066-39513088 GTTTGGGGCAGGAAATGAACAGG - Intronic
1160876929 19:1300702-1300724 GTGTCTGGGAGGAAATGACCAGG - Intergenic
929863669 2:45700007-45700029 GTTGAGGGGAGGCAGTGGCCAGG + Intronic
930365298 2:50432187-50432209 TTCTAGGGGAGGAAGTGACCGGG - Intronic
933025520 2:77252777-77252799 ATTTGGGGGAGGAAATGACATGG + Intronic
935684864 2:105674253-105674275 GTTTGGGAGAAGGATTGACCTGG - Intergenic
936076627 2:109405516-109405538 GTTTCGGGGAGAAATGGACCAGG - Intronic
936163241 2:110100689-110100711 GTGAAGGGGAGGAATGGTCCAGG - Intronic
937337881 2:121072862-121072884 GGTTAGGGACGGAATTGACGTGG - Intergenic
938189132 2:129258618-129258640 GTAAAGGGGAGGAATTCACAAGG + Intergenic
941112060 2:161426898-161426920 GTCTAGTGGCGGAATTGTCCAGG - Intronic
941651175 2:168094151-168094173 GATCAGGGGAGGACTTGGCCTGG - Intronic
944476282 2:200110239-200110261 ATGTGGGGGAGGGATTGACCAGG - Intergenic
944620875 2:201514982-201515004 GTTTAGGGGTGCATCTGACCTGG - Intronic
945907005 2:215605088-215605110 GTTTAGGGGAGGGAAGGCCCAGG - Intergenic
1168970823 20:1929669-1929691 GTTCAGGGGAGGAAAAGGCCAGG - Intronic
1169546330 20:6654728-6654750 GTTAAGGGGAGGAATTTCCCTGG - Intergenic
1171951076 20:31423085-31423107 TATTAGGGGAGGAAATGAGCAGG - Intergenic
1182049648 22:27302976-27302998 GTTTAGGGGACAAAGGGACCTGG - Intergenic
1182289871 22:29268686-29268708 GTGAAGGGGAGGATTTGGCCAGG + Intronic
950499733 3:13355990-13356012 GTTTAGGGGTGGAACTCAGCTGG + Intronic
951009738 3:17662368-17662390 GTTTAGAGGAGGAGGTTACCTGG + Intronic
951074959 3:18379472-18379494 GTTTATGTGAGAAATTGTCCAGG - Intronic
951635464 3:24770089-24770111 GTTTTGAGGAGTAACTGACCAGG - Intergenic
956157403 3:66312742-66312764 GTTTAGGGGAGGTAGTTCCCTGG + Intronic
959206051 3:103308457-103308479 GTGTAGGGGAGGCATTGAGGTGG + Intergenic
960573258 3:119205934-119205956 GTTTGGGGCAGGAATTGCTCAGG - Intergenic
960624027 3:119662744-119662766 GTTTAGGGGTTGAATTCACCAGG + Intronic
960886487 3:122400381-122400403 GTTTAGGGGAGGGATAGCACTGG + Intronic
961015819 3:123467354-123467376 GTTTAGAGGAGGAATTAAAAGGG - Intergenic
961904771 3:130251403-130251425 GTTTAGGGAAAGAATTTCCCTGG + Intergenic
965723582 3:171688768-171688790 CTTTGTGGGAGGGATTGACCTGG - Exonic
965829669 3:172770959-172770981 GTTTAGGGAAGGTATTGGCCTGG + Intronic
967479504 3:189957479-189957501 GTTTGGGGGAGGAGGTGAACTGG + Exonic
973957308 4:56075606-56075628 GTTTGGGGGAGGGAGTAACCAGG - Intergenic
975864251 4:78709888-78709910 CTTTTGGGGAGGTATTGACTAGG - Intergenic
978130718 4:105193268-105193290 CTTTAGGGCAGGAATGGGCCAGG + Intronic
980158360 4:129132880-129132902 GTATAGGTAAGGAGTTGACCTGG + Intergenic
982578734 4:157151327-157151349 GTTTAGGGCAGTAATTGATAAGG + Intronic
985629384 5:1006833-1006855 GTCTGGGGGAGGAAGTGTCCTGG - Intergenic
986208023 5:5644490-5644512 GATTTGGGGAGGAATTAACAAGG - Intergenic
990014613 5:51044554-51044576 GTTTAGAGGAGAAGTTCACCGGG + Intergenic
990348089 5:54888737-54888759 CTTTAGATGAGGAATTCACCTGG - Intergenic
990982092 5:61610990-61611012 GAGTAGGGGAGGAATTGACAAGG - Intergenic
992344916 5:75866905-75866927 GTGTAGTGGAGGAAATGACAGGG + Intergenic
992921802 5:81531542-81531564 GTTTAAGGTAAGAATTAACCAGG + Intronic
993185150 5:84608260-84608282 GTTGAGGGAAGGAATAGAACAGG - Intergenic
1000269701 5:159672372-159672394 TTTTAGGGGAGGAATTCAAGTGG + Intergenic
1001318828 5:170663696-170663718 GTGTAGGGGAGGAAATGTCAAGG - Intronic
1009662012 6:66625838-66625860 CTTTTAGGGTGGAATTGACCTGG + Intergenic
1011515482 6:88148181-88148203 GTGATGGGGAGGAGTTGACCAGG - Intronic
1011628999 6:89306619-89306641 GTTTAGAGGAAGGACTGACCAGG - Intronic
1012332946 6:98016773-98016795 GATAAGGGGAGCAAGTGACCAGG + Intergenic
1014721858 6:124926694-124926716 GCTTAGGGAAGGAATCGTCCTGG + Intergenic
1014785417 6:125613131-125613153 GTTTAGGGGATGAGTTGACAGGG - Intergenic
1018576075 6:165261755-165261777 GTTTTGGGGAAGAATTAAGCAGG + Intergenic
1018856182 6:167677048-167677070 GTGAAGGGGAGGACTTGACCAGG - Intergenic
1020660262 7:10973669-10973691 GTTTATGGGCGGAATTGCACAGG + Intergenic
1020959557 7:14786380-14786402 GTTTTGGGAAGTAATTGACATGG - Intronic
1026105603 7:67418366-67418388 GTTCAGAGGAGGAAAAGACCGGG + Intergenic
1031520472 7:122758858-122758880 GTTTAGGGGAGGAAAAAAACAGG + Intronic
1031595400 7:123644234-123644256 GTTAAGGGCAGGAATTGGCAAGG + Intergenic
1037804444 8:22051169-22051191 ATTTAGGGGAGGATGTGACCAGG + Intronic
1039216675 8:35279609-35279631 GTTTATGGGAGTAATAGACCTGG - Intronic
1041571046 8:59337161-59337183 GTTTAAGGGAGGAAATCACATGG + Intergenic
1042099125 8:65255259-65255281 GTTTAGGAGAAGAATTGATTTGG - Intergenic
1043469885 8:80551605-80551627 GTTGTGGGGAGGAATTTTCCGGG + Intergenic
1049246926 8:141567765-141567787 GTTCAGGAGAGGAAGTGACCTGG - Intergenic
1049616269 8:143577043-143577065 GTTTAGAGGAGGGACTGACCGGG + Exonic
1051570832 9:18557023-18557045 GATTAGGGAAGGAAGTGACAGGG + Intronic
1061414396 9:130438514-130438536 GTGTAGGGGAGGAAGGGACTGGG - Intergenic
1187201807 X:17141191-17141213 GGGTAGGGCAGGAATTGACTAGG - Intronic