ID: 1113572843

View in Genome Browser
Species Human (GRCh38)
Location 13:111370897-111370919
Sequence GGAAACAAAGGTGGCCCAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113572843_1113572856 25 Left 1113572843 13:111370897-111370919 CCATCTGGGCCACCTTTGTTTCC No data
Right 1113572856 13:111370945-111370967 GCATGGAAACAAGCCCTTCCTGG No data
1113572843_1113572857 28 Left 1113572843 13:111370897-111370919 CCATCTGGGCCACCTTTGTTTCC No data
Right 1113572857 13:111370948-111370970 TGGAAACAAGCCCTTCCTGGTGG No data
1113572843_1113572852 8 Left 1113572843 13:111370897-111370919 CCATCTGGGCCACCTTTGTTTCC No data
Right 1113572852 13:111370928-111370950 GGGGAAGCCGAGGCCCAGCATGG No data
1113572843_1113572850 -2 Left 1113572843 13:111370897-111370919 CCATCTGGGCCACCTTTGTTTCC No data
Right 1113572850 13:111370918-111370940 CCACACCTCTGGGGAAGCCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113572843 Original CRISPR GGAAACAAAGGTGGCCCAGA TGG (reversed) Intergenic