ID: 1113574435

View in Genome Browser
Species Human (GRCh38)
Location 13:111383985-111384007
Sequence CCTGAGCTGCTCCGTGGCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113574425_1113574435 17 Left 1113574425 13:111383945-111383967 CCCTCACGTCTTGCCTCAAGAGA No data
Right 1113574435 13:111383985-111384007 CCTGAGCTGCTCCGTGGCCCTGG No data
1113574426_1113574435 16 Left 1113574426 13:111383946-111383968 CCTCACGTCTTGCCTCAAGAGAC No data
Right 1113574435 13:111383985-111384007 CCTGAGCTGCTCCGTGGCCCTGG No data
1113574423_1113574435 23 Left 1113574423 13:111383939-111383961 CCACACCCCTCACGTCTTGCCTC No data
Right 1113574435 13:111383985-111384007 CCTGAGCTGCTCCGTGGCCCTGG No data
1113574428_1113574435 4 Left 1113574428 13:111383958-111383980 CCTCAAGAGACACAGGTGCCCCT No data
Right 1113574435 13:111383985-111384007 CCTGAGCTGCTCCGTGGCCCTGG No data
1113574422_1113574435 26 Left 1113574422 13:111383936-111383958 CCTCCACACCCCTCACGTCTTGC No data
Right 1113574435 13:111383985-111384007 CCTGAGCTGCTCCGTGGCCCTGG No data
1113574424_1113574435 18 Left 1113574424 13:111383944-111383966 CCCCTCACGTCTTGCCTCAAGAG No data
Right 1113574435 13:111383985-111384007 CCTGAGCTGCTCCGTGGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113574435 Original CRISPR CCTGAGCTGCTCCGTGGCCC TGG Intergenic
No off target data available for this crispr