ID: 1113575398

View in Genome Browser
Species Human (GRCh38)
Location 13:111391713-111391735
Sequence TAAGCCCCTGCTGGTCACCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113575398_1113575408 19 Left 1113575398 13:111391713-111391735 CCTAGGTGACCAGCAGGGGCTTA No data
Right 1113575408 13:111391755-111391777 CAAAGAGAGGGTTCACGTCTGGG No data
1113575398_1113575410 24 Left 1113575398 13:111391713-111391735 CCTAGGTGACCAGCAGGGGCTTA No data
Right 1113575410 13:111391760-111391782 AGAGGGTTCACGTCTGGGGCAGG No data
1113575398_1113575412 28 Left 1113575398 13:111391713-111391735 CCTAGGTGACCAGCAGGGGCTTA No data
Right 1113575412 13:111391764-111391786 GGTTCACGTCTGGGGCAGGGTGG No data
1113575398_1113575404 -5 Left 1113575398 13:111391713-111391735 CCTAGGTGACCAGCAGGGGCTTA No data
Right 1113575404 13:111391731-111391753 GCTTAAGGGGAGTCGGCAGCTGG No data
1113575398_1113575406 7 Left 1113575398 13:111391713-111391735 CCTAGGTGACCAGCAGGGGCTTA No data
Right 1113575406 13:111391743-111391765 TCGGCAGCTGGACAAAGAGAGGG No data
1113575398_1113575411 25 Left 1113575398 13:111391713-111391735 CCTAGGTGACCAGCAGGGGCTTA No data
Right 1113575411 13:111391761-111391783 GAGGGTTCACGTCTGGGGCAGGG No data
1113575398_1113575407 18 Left 1113575398 13:111391713-111391735 CCTAGGTGACCAGCAGGGGCTTA No data
Right 1113575407 13:111391754-111391776 ACAAAGAGAGGGTTCACGTCTGG No data
1113575398_1113575405 6 Left 1113575398 13:111391713-111391735 CCTAGGTGACCAGCAGGGGCTTA No data
Right 1113575405 13:111391742-111391764 GTCGGCAGCTGGACAAAGAGAGG No data
1113575398_1113575409 20 Left 1113575398 13:111391713-111391735 CCTAGGTGACCAGCAGGGGCTTA No data
Right 1113575409 13:111391756-111391778 AAAGAGAGGGTTCACGTCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113575398 Original CRISPR TAAGCCCCTGCTGGTCACCT AGG (reversed) Intergenic