ID: 1113575402

View in Genome Browser
Species Human (GRCh38)
Location 13:111391722-111391744
Sequence GACTCCCCTTAAGCCCCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113575402_1113575407 9 Left 1113575402 13:111391722-111391744 CCAGCAGGGGCTTAAGGGGAGTC No data
Right 1113575407 13:111391754-111391776 ACAAAGAGAGGGTTCACGTCTGG No data
1113575402_1113575413 24 Left 1113575402 13:111391722-111391744 CCAGCAGGGGCTTAAGGGGAGTC No data
Right 1113575413 13:111391769-111391791 ACGTCTGGGGCAGGGTGGAGTGG No data
1113575402_1113575408 10 Left 1113575402 13:111391722-111391744 CCAGCAGGGGCTTAAGGGGAGTC No data
Right 1113575408 13:111391755-111391777 CAAAGAGAGGGTTCACGTCTGGG No data
1113575402_1113575406 -2 Left 1113575402 13:111391722-111391744 CCAGCAGGGGCTTAAGGGGAGTC No data
Right 1113575406 13:111391743-111391765 TCGGCAGCTGGACAAAGAGAGGG No data
1113575402_1113575412 19 Left 1113575402 13:111391722-111391744 CCAGCAGGGGCTTAAGGGGAGTC No data
Right 1113575412 13:111391764-111391786 GGTTCACGTCTGGGGCAGGGTGG No data
1113575402_1113575409 11 Left 1113575402 13:111391722-111391744 CCAGCAGGGGCTTAAGGGGAGTC No data
Right 1113575409 13:111391756-111391778 AAAGAGAGGGTTCACGTCTGGGG No data
1113575402_1113575405 -3 Left 1113575402 13:111391722-111391744 CCAGCAGGGGCTTAAGGGGAGTC No data
Right 1113575405 13:111391742-111391764 GTCGGCAGCTGGACAAAGAGAGG No data
1113575402_1113575411 16 Left 1113575402 13:111391722-111391744 CCAGCAGGGGCTTAAGGGGAGTC No data
Right 1113575411 13:111391761-111391783 GAGGGTTCACGTCTGGGGCAGGG No data
1113575402_1113575414 25 Left 1113575402 13:111391722-111391744 CCAGCAGGGGCTTAAGGGGAGTC No data
Right 1113575414 13:111391770-111391792 CGTCTGGGGCAGGGTGGAGTGGG No data
1113575402_1113575410 15 Left 1113575402 13:111391722-111391744 CCAGCAGGGGCTTAAGGGGAGTC No data
Right 1113575410 13:111391760-111391782 AGAGGGTTCACGTCTGGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113575402 Original CRISPR GACTCCCCTTAAGCCCCTGC TGG (reversed) Intergenic
No off target data available for this crispr